koxylitones [Eftl aad lts Effects on BDI|I

Document technical information

Format pdf
Size 11.1 MB
First found Nov 13, 2015

Document content analysis

Language
English
Type
not defined
Concepts
no text concepts found

Persons

Organizations

Places

Transcript

Mechanislic Studv ofa ovel nnficonwkaal
koxylitones [Eftl aad lts Effects on BDI|I
and C-f0S fupression
A Thesis submitted in Pattia.l Fulfillment of tie Rcquhements
for the Degree of PNosoPhy itr Pharmacology
6t
frlufr4rrrrruf Ndlzdf, .ts
fr$
2012
H.EJ. Research Institute of Chemistry,
Intemational Center fot Chemical and Biological Sciences
&
Depattmeot of Pharmacology,
Faculty of Phamacy,
University of Karachi" Karachi-75270, Pakisan
Intef,trrdonal C€utcr for Chauicd antf Biofodcaf
Scnenc€E
UDn/crsfv of (rr.cld Iorrchi
icTo'
P.&btatr
lf
CERTIFICATE
T1O
rday
ml2
ACCOMPANY TEE TMSIS
It ir crdified thar thcr
g)
rcul @ticMttbort ituytitone,
[VZ] ad itt 6ett on BDNFod c.Fot qftstk'r{ s!tuj@,by Mrhroord
Nadccm Alhraf is dl originsl pi.ce of lls€dch work c{iried out by thc
ftaeie cntitf€d ",1.1€.,ari!jti.
tttd,
of a
crdida.e uader ny stpervisbD.
(tr) Litenry lnes€[t tion
public€tioo,
i,
sstirf.otory and thc thesb ir
ir e fotn
ruibble for
(Itr) Wort dcnonrt"at s dlc capacity ofthc c{Ddfttd for critic€f o(lni[arioq
iodcpend€ot.nd anaDticd judgnent,
'sEW4il"W,ffi'
(fris tfresis is [efrcate[ to
nty parents,
'uife, antr teacfrcrs
CONTENTS
Lilt
of Flgures
Iv
Lilt ofTrble
List of AbbrevirtioN
vII
x
CHAPTER I-INTRODUCTION
I
l.l. Ovcrviw
2
1,2.
'
of lhe
clrent sludy
Backgrcud
r.2.1. EpileFY
3
r.2.2. Classifi cition of cpilep$y
6
1,2.3, Parhophysiolog/ olepilepsy
7
1.2.1. Genetic €ll$es
1.2.5. Status
8
of€pilelsy
9
epilepncs
1.2.6. Epileptogenqis
l0
1.2.7. KindlinS model of cpilept%.ocsis
ll
1.2.7J. Types of kindling
13. Rol€ ofvolrago-gatld sodiun
chtr.ls
in epilcPtic scizure
1.4. Rol€ ofc-Fos in epil€psy
1.5. Role
1.6.
oIBDNF in epilepsy
Tr.llnmt
of cpilepsy
r.7. ILAE €uidel'nes fof the u€ ofABDs h epilepsy
r.8. Resenrch objcctive3
CHAPTER 2-METIIODOLOGY
l6
l8
20
2i
25
26
26
27
2.1,2. Reagents / chemicals
2.1.3. Subctrtdous p€ntyld€teta?ole_iduc€d s€iture
idu€d
tdt
(scPTZ
2a
acutc seizures modcl)
2a
2.1.4..rr vt'o nodeb of epileploS€ncsis
2.r.4.1. sc-?Tz_ioduced chenical kindliry nodcl or
29
cPilcproSoeis
2.r.4.2. Eleclrical kindlin8 nodel
2.1.5. Inmunohistochemisay
2.l.s.r.lHc
2.1.5.2.
(lHC)
tbr c-Fos and
Imge
ofepileptog€nesis
33
39
BDNI
39
analYsir
'11
2.1.6. Rev6e trdscriplos€-polymcrase chain rcaclion (RT'PCR) 4\
analysis for c-JAr mRNA exprssion
2.1.7, Vohage-gated sodium chatnel inhibitiotr and dose-respons 45
study of isoxylitodq ,t tl'o
4E
2.1,8. MorphologJ [email protected] ed cell imge analvsis
2,1.9. Quutitative roal time revdse lrdcriPtase'lolvmerasc
reacrron rqRT-PCRr aalysis for BDNT expres'ion
2.2,1. Cell cnltue
2.2.2,
chain
55
ofrat conical ncuotr
55
de(roPh)rrolog -tudies
2.2.2.1. Yoltage-gated sodium chamel iihibition md doss
PI.h 'lamping
49
dnd
55
respome study of isoxylitotrq tn vir.o
2.2.2.2. Effects of ;soxyliton€s on sodirm ch$nel recovery
inactivalion
2.2,2.3. Effecls
chM.l
of
isoxylitones on d€velopmont
in&tivarion
of sodium
59
ohain
60
2.2.3. [email protected] real time rcvcB€ tantcri [email protected]
reaclion (qRT-PCR) anallsis for sodiw chamel alPha subunils
2.3. Qu&tilative
ed
Stdthtical Analysis
CITAPTER 3.RESULTS
6.3
66
67
3.1.1. Subcutaneols pentylen€tetrazol€-induccd seizDre t€sl GcPTZ_
induced acul. sei4res modcl)
67
3.1.2.1, vtto models of epileplogsesis
of
70
3.1.2,2. Elecrical kindlitrS model ol epilePlosensir
70
3,1.2.1. scPTzinduoed chemical kindlins mod€l
epilepbgenesis
3.1.3. cFo.s
[email protected] (lHC)
3.1.4. Reve6e ranscriptaepolymerase chain
mRNA exFcssion
analysis for
ctr
3.r.5. BDNF inmunohislochemistry
@tion (RT'PCR)
(lHc)
11
EO
3.1.6. Voltas€-gated sodiun channel inhibition and dose-response studv
80
ofisoxylilones n vtto
[email protected]$clion and cell inage 4alvsis
3.1.E. Qudtilativc real time Berse trescnpirsepolymerasc cnan
3.1.7. Morphology
E7
a7
rcaction (qR I -PCRI ualysis for BDNF qPrcssion
99
3.2.1. Vollage-gated sodium ohann€l iniibition
siudy of isoxylitones m viho
ud
dosc{esPoffe
99
isoxylitones on sodium cbamel ncovcry tom
99
L2.3. [email protected] of jsoxylilones on drydoPmmt of sodium chmel
t0z
3.2.2. Elf.cts
of
inactivation
inactivation
3.2.4. Quantiteliv€ real time rcvcBe tr46ip16€-polvmerue chain
rcactior (qRT-PcR) balysis for sodiun chM€l alpha subunits
CHASIER 4.DISCUSSION
105
ll4
130
t3l
REFERENCES
t32
LIST OF FTGURES
FIGURE
l:
isoxylilones
ncURE
ed prcl@ NMR s!4lnm of the
st u.
SEuctm
[BZ]
2r Diagram of a voltage-gated
Na' ohdmel
15
FIGURE 3: A .oprsentativc photograph ofNMN nice used in rhe studv
of chcnical lindting nodel ofepileptogensis
FIGURE .l: Th. Sprague Dawley (SD) rars (Chtul4 River, Cdada) used
foreleclrical kindlios odelof epileliogeresis
TIGURE 5r Thc palch clamp rig setup used for elcclrophysiology studies
flGUR!
6r ReplseDtative
agqN
gcls shoeing RNA and DNA bands
FICURI 7: Mortality restirg of isoxylitotrq foUowing ac e
IIGURE
E:
t
scPTZ-
Eflect of isoxyliton$ on scPTz-inducen kindling
l0: The reprsentadve phoiomic.oSraph
ll:
Effsts ofisoxylirong dd
PTZ @ c-l6r mRNA dp.€ssion
IIG(JRf, l2r [email protected] of boxTlitones oD BDNF
5J
69
72
75
itununocactivny iD cotrEots dd isoxytitons teled groups
FIGURE
47
7L
FIGURE 9: ProSressive development of EEC seizw &tivny in ipsilareEl
side of the nt b.ain during mygdala kindling
UGURE
38
77
fo owing
6l
FIGURE 13: Cmphical rcpresenration of volr2Se-gated sodim chaMels
inhibilion by isoxflitones in kindled and control adull m! bEin cortical
84
sc'PTZ jnduced kindlitrg
neuons at vdrous
oncfltalion
levels
protein €xpression
r, r/v,
FIGURE l4: [email protected] of Isoxltilones on volhgc [email protected] sodim chamels
ryCSCs) in adult kindled rat brain corrical neuroro (both plrarnidal and
inlemeuons,,
-
3-5) using [email protected] gorocol
85
bo$ in kirdlod md conEol (nonneubd in a conceDtsliotr-d€peldcot mmer wilh olnosr
flCURE 15: koxylitonG 'blek
kindl.d)
6niel
1N.
86
A
represedanve photonicrograph obtained by confocal
microscopy showitrg the leconstruction of morphology ard arborisation of a
conical pyramidal reuon patchcd in a mt bnin sli@ for dce rcs?oN
snrdy of isoxylitonq n ,'o
FIGUR.f, 16:
E8
totll BDNF mRNA
dpressio! ir mnrrol, khdled groups atrd grouts treaied with isoxylitones
9l
FIGURE 18: Mdedenl and compdson of BDNF
expffision lcvels iD conlrol, kindled ,'d t eared groups
92
FIGURE 17: [email protected] and compaison of
treidipt III rRNA
flGURE t9: Mguremcnt and compeison of BDNF traffcripl IV mRNA
exprsion levels io entrol, thdlcd and lte€red Sroups
9l
PIGURE 20: M6umcnt &d empeison of BDNF r.escript !'t hRNA
expres\on twets
kindlcd dd r€aLed goups
'ncontrol,
94
FICURI
2li A
rcpr.senhlive 6gue of anplification ptors
ot
DNA
96
FICURE 22r Rcp.eseolarive fisure ofa srodard curv€ obtained quar
!o
ry
theDNA in uknown sampler showilg ?r, slope .nd cxpqiment
cfficiqcy
97
p,
odJcts obtained ar Lhe end ot edch 40 crcle run of unlnolvtr DNA
sarnolq
olgYru B:
t
[email protected]
cwe
afler ejch pcR hermar profir€ !16
98
oddetl ro veri6, rhd no [email protected] producB
had fomerl
x:
or isoxvlitona on votlas'sared so<rru' chenrr
IIGLTI ndFne.9
srppessDn
panial reveEibrriry aao uashoui aivafloN
@nenrrarion
rv€$ ot soxyt'tones in cultured rar cortical neurons n
v,ro
FIGURX 25r Craphicaj rep.€senlarion of the Yc
rcdlcdon of vott g€-garcd
soorum chann€ls at differenr concentrations
and dose response study in
cultured coni€l
r00
l0l
neurons
II
FICURE 26: Rcpresentation of fraction of sodium cw€nt (lNJ [email protected] r03
from inactivation (indic.ted by dowt at diff.nnl tim. poioG nshg Pulse
Drctocot for sodium
cnmd
inaclivaaion{ecovery
FICURE 27: Isoxylilones slows dowtr sodim chaoxel [email protected]
fton
104
FIGURE 28: The fi8ure r€prcse s lhc sodium curenls elicited in a single 106
ceu at diffcrd. voltagc levcls uing a slow !olt!8e rdP Protocol (shovn at
the botton) to study lhc cffecB of isoxvliiones on tle developmdt of
sodiun chNtnel inaclivation
FIGI'RE 29: Sodium curcnls elicil.d in a singl€ c. using $e slow
voltage ranp lulse protocol showitg lhe innibition of sodium currcnl
dplitudc at diffffit volage levels as thc steady-srar. iftctivatiotr
develops in the cullucd rd conicnl treuroos
FIGURE 30: hoxylitones eihances stoady slal,e iracdvation and
voltq€ dependerce ofinaclivation to more hnerpolari4d Pot€ntials
107
shjfrs
10E
FIGLRE 3t: The Iraphical repEsenlation ofcb valu* of voltagegated
ch.oel subtype slpha subuils nRNA assayed for Ue presence and
"odrm
rolalivo abudarce in the culrurcd rat conical neuom used for
[email protected] slxdiG
n
LIST OF TABLES
30
TABLE l: Bebaviordl .dtins scil€ for PTz-induc€d epilcFogenesis
TABLE 2: TreatmeDt grouls of scPTz"Induced Chemical Kindling Mod€l
TABLE 3: Two seLs of elcctical kindling aninel models of mts wele
devclopcd for r, vtro sludies ofisoxyliiones
TABLE 4: P.imer sequ€nces used for c'l6s mRNA aftlysis
TABLE 5: PCR primer seque.ces and produoi sizes used for total BDNF,
BDNF rmnsc.ipb dd tsacain fiRNA amlysis in d concx
TAALE 6: PCR prirner sequencis for rhe ealysis ofvoltng€-galed sodium
channel alpha subuits mRNA sludied in cultured rar conical neuons us.d
lbr path clamp ad clccLophysiolo$/ studics ta vifo
TABLE 7: Effeot of isoxylirones on inhibition dd dualion of seizws and
nodality in aculc scPTz-induced seizures in mice
68
TABLf, 8: Percenl chdge in the clx mRNA cxgcssion
79
TABLf, 9: Muhipl. compdisons of BDNF and ihe transcriprr among
dre
95
TABLT l0: MulLip.e conpeisons rone-w.y ANOVA dd po! toc
tt2
llliJ:'j[i*::jj"*.,*
ofsodim chan f|arpha
subutrils 5rudied in
IIST
IDD
ADI
,tEX
AMO
EDNF
bFGF
CCAC
OT ADBNEVIATIONS
Afr*di!.&dfp
tui@
AHilcl|Ig.
oltahold
kd..piLtdc
'tu8t
A&ygdsli
Bdi.daillld nq|trtolhic
b8sie
k
finobblt growth &ctd
C'r!tir! Ccult o Ado.l C.Ic
CditGd
CNS
CREB
Ci
.
C<.irll N.rrou. Sydan
cAmrlrpc.to.dbiodirg
N6|lllrcd
cycL ltftshold
cfx
Al
DZ
EEc
Elo$ec.lbt c'rre
W3
8.dy Sncith !..roo!.
G,.|BA
CAPDH
caio!
Depkxordendzxtn
Dirz.!.r
ff..c
[email protected].Jrrc.d.r
gbntuqd+3rhdphr&drtydroSEru€
HIP
HLTB
3
}ruliob
tcai!
odlorid
IC:o
lEGs
IHC
ILAE
1N,
IPS
IUPHAR
nJPSC
MMP-9
NGF
NIH
NMDAR
NMR
NMRI
PTZ
Rol
SD
SPSS
TNF-0
VECF
vGSCa
Minimum inhibitory conc€nlta.ioff for 50yo in[ibilion
llnmediai,e early Sdes
I
nunohislochdistry
Inaemational [email protected]
Agai$t F4ilepsy
Sodium currcnt
bsilat€ral
Intemdiolal Udon ofBasic dd Clinical Phainacolos,
Miniaruc irlibi&ry pos.{yDllic currot
MrrixMerdloprolcinaseg
N.eegrcw0r frclo.
National Llsliture ofH€alth
N-methytD-aslariicacidreceplos
Nucl@ M.gnetic Reson nce
Naizt Medicat Rcs.!rch Instirlie
P.nrylm6t6tr.zotc
Regions ofinicaesrs
spmguc Dawt€y
Sbrisricat pack ge for Sociat ScieDc.5
Tluntrftc.osis facto!- o
Vascular €ndo&elial gro*dr facror
Votragc-gar.dsodiMcharuets
VI
ACKNOWLEDGEMENT
In the nase of
and gives
A[AH,
ne lhe wisdom,
endN dd accomplish
tookirg
back,
Im
received ltuoudoul
ne whcrc
special
hops
knowledgo
ud
colrage, 3nd who €quipped
ne
to
rhis task succe$tully.
sur?ns€d
ud
al thc srne lime v.ry 8ra&nn for
al I have
0\s yed. It har cedainly sbaped mc d a !60r od hd led
I m mw All tbse
tlaot
she
Most Graciour Mosl Merciftl. It is Hc, who cMted mc
goes to
ytr
rly hebftl
of PhD studies .rc tull of such 8in5. The
supcrvisd, Dr. Shabana U. Sinj.e for au l,\e
las put on me. The supefl,ision .nd suppon she provided truly helped
fie progr*sion ad smoolhness ofmy PhD ltudies. Her coolcration and guiddoe
is much indeed appreciated.
I tlank
Prof. Mich.ael O Poul!.r, Direcior Gnduate Prognm in [email protected],
Robafs Rscarch Inslitut€, Faculty of Medicinc, Thc Univenity of Weslern
Ont rio 0JWO), London ON, Cnud!, for providing tne tbe grca1 oppo.tuity !o
work ar collaboative re*rrcner in his lab
[email protected] ophysiolog sludies
I
also
lha*
NeNscioc.s
lrd c{rryins out IaLI
wlich constiol| a signifioant portior of my
Margaret Falncslock Professor, Psychiarry
ad
Associatc Dirlcror, Gmdure Prog6m
McMasG! Itrsrituc for
clamping and
N.uroscid.! Dbc.vtry &
&
PhD
Behavionl
in NMscidoe,
Study (MINDS), F&ulty
of
VII
H6llh Scioc€s, McMst r Univqlity, H.Dilton ON, Canad4 for
and consisler! help, suppon ard guidanc€ tbrcudout tlese yeds
not only gave ne the opportunity of rcsealch coll.boFlion
h
hor invaluablc
ofmy PhD.
She
her lab to do th€
BDNF nolecular studi€s, but also helped De to shape $e uiquc oPPonuity to
work in thc labs oftwo grea. expdts
I
ir
lheir [email protected]
li.lds.
rbank my senior PhD mllcague Ccze Gavrilovici for his [email protected]$ help in
canring oul patch olam! and elecLrophysiology studies at Robdds tusedch
lnsiitute, UWO, Canada. I also
thsft Debdah Andss€n ed Michele Ev.6t for
their adnidstrative and tecboicrl suppoG
6!€.tively durirg
my slay at Robtrts
Th.nLs to tJre lab coordiDator Bemadela MiohaLski for her valuable h€b and
ssisllnG
I
that lhe off€red ne fo. BDNF ealyses at McMa$er Unive$ity.
aho thank olh€r !€ople
I
m€l during my visit to Canada for the woderful
&iedsbi! ad coop€lnnotr Uk. Zeinrb Birjedian, Fiona Simpso4 Chsknvdthi
Ndla
I
Chiara
[email protected] sd Blyse.
fe€l proud for being 6gag.d
d
a PbD studdt at Inremalionat Coler for
chemiql md Biological Scienca, (ICCBS), Univdsity ofKarachi, pakisr{n.
I
am grateful ro
Di
$ppon provid€d-
I
Asmat Salim and Dr. Siddiqua
Jdall fo. their constanr
$ank ou cnemisrry cotlaboraro$ of ICCBS specirlly Dr.
vtl
F;m
sbL.a [email protected] [email protected]
of
6.
ilildsdq|l
[email protected]|ld
ddt.bic.leppc!
& drdrtu b ry Lbccy col-gE..p.ddty S:r.d t.[&Ati
It nSltur.ri!6aft.i. coq.do dnfog eb edt.
I
ibt &
I"re td d h4
Sfd.l
vcry
I
St lt.ddDr.
Ftt rd trlsr. &. th.t !..!in|.ed DeI &ppat
! trir tb* yo ro ry idq R.h1 Ward L I rrdd t .
io
ry
dtft!.ot p.€6 iod$/,
.d t K{d bv.
b!.o od.n !,
dre !E L. !o fdih
ItD.
D(
EUMMARY
of neurclogical conditions having diveBe aetiology ed
Epilepsy i5 a Sroup
symplomology a-nd
is
ohdacledzed
abnomd, hypc6ynch$nous
i
d
by unpovoked, recurmt seiaues. An
dcessiv. n€Nnal activity in tho b.ain r€sulls
o epileptic seizures. D€spite major advances in
elilclsy t qirnent s!€ificslly
dudng the lasr two decades, epilepsy r.mains a major medical chall.nge and
$e
hunt for new AXDS conlinuer. Tbe rcots of the plerDelphinim dentdatM
indigenous to lhe Himalayas aid Kshmir bad beetr reponed |o b€ used
seizure, by loc€l folk m€dicine practiliorers.
[email protected] ftom thc afordedrioncd
ller
hwe
i! tlatidg
Althoud, th€ €xtracls /
bm
fraclions
previouly studied in
acute
seiaie modcls, thc purific4 parenbd coror,omd (Palent No. 7,399,888 82) ntnod
isoxylilones ([sz]-2,pro!anonal,3,5,5-eim€rlyl2{yclotexeD- t -ylidire) had nor
been
[email protected] for
we
domonskaled thar isoxytirons sullress€d lrogression
epileptogenesis
in
its tuii-epileptogenio properties md mechobm of actions.
PTz-itrduced kindting tnodet
eleclrophysiolory sludics wcre employed ro
of mi@.
dttorc fie
of
seizu.es and
T1le palch ctam! 6nd
me.hanism of action and
dose{qpolse cwe of this novel [email protected] @mpound bothis liro
ud
ttto.
cBert
El€ct ophysiolog/ studis showcd tlar boxyiitones [email protected] sodiun
(1NJ in N41.3
will IC$
i',ta
in
ed Na" 1.2 D vro
in a @n €nt ation_deFnde mannq
b
200 nM isoxytitones concent arion.
values ranging from t85 nM
Moreovcr isoxylitones subilized srady{t41e inactivation of sodium
chann€l by
x
Ldyltls .ho .lgniddrry rlt.lld
tbc vohgc d.p.ad.roc of rt .dy!t@ irtvdiE by lhilUlg 6! [email protected]
Gqulion o|n/e i0 th! nat \yp€Aohriz.d oo@{dsb. Ir lbo .i8niio'rry
r4F!r!.d clccliol / ddi€r tbdlilg-idiEGd r.l,."oid c$r rrd BDNF
lbrrirg dom itr r.covrry n@ iordr/dioo.
opr.&rior in vadoo! lodcd br.b r.giorr !trdi!d. B.!6d on rh.sc obt!fv!ti@!,
w!
igSd 6d irorylitoG nry
b. .
!d..tid
c.",r"r.rr io bc d.vdo!.d
I r
fisrr! AED fta ih! [email protected] of id!6bto Cplkpd.s,
x
-,, Lllr L' \'\,,)* u,t +,-fi -tu "t -l t'.9.12 +. /. 4 G V f. lt
+ rry1' / C,f 6o -' L'!r+ c,.Ff. - f-' o' 4 Jv, i'-; o- q.> v'!,1
'!r,i E 6,,8-'t'./,,)L, $ &6 z,4tc, t,,t L tZ lb L' t)r,,L ui V
",F L a rf r"u Z
-+tt,lJh!-t'r(/
a6'! t+, +' 4 4 u';V tyt/-l 2u.lz 1o'jt6n ;* u"a41.^11-tit /,
1 + o&)P| L,tz i A tL a, 4o1./t -,.)!,r,',,.iL J pE rlr e u,]c tu ( o
:)*t j/1(t(iJ. / u,,t0t t:.,,-/,;,y' d.,/+tzV
'/,'v G d/.bL u;v
fr. ltt ; v L.' v, L ( _t n!,J?.^' e { L,f ;/, t -?Alr,t tt, + A".xrrit *"\
* + (,, /,fL 1 L ou,t u, - L rf,s s i;7,1, 7., 7 6r.-/u L vu L,.t nt
"'
er);lttaacraat,:}Q{L(trhLo39"6b-ttJ.-iLJ./(Db
r
t
>.
t
*o!t *t ; / r11l e. 2 2- b, L - V i L 6fu b, tuL,r4 (Eraropbysioros,)
ov'l-'!A"fi'C,tng,i!urdrL/ N*t2,tL1ut,,, N*t.3nttL(httJ:
'!
u
-
lfv{e.'L
(lf'.!
J;v
zoou,tl-
-
it 1lu,J- 4ia(i, L
'f+V6.4. tlu$yLao)Ettu
4 trc
r ss,t t
5
t)
6,??V. Ab.L )6, 4t /)
nsoxyt."orest
|
,t4;1. Jr.?
F/r,Btjon 2t,vct
ltL,*4r /,i_(A/e)b
Lt' L /L,t/ J, A J,4 | U L o _Lj-r. a u 1f tsi1
i/
6/ L $ O,.t J, L,r
f a,t'J- 4v. tt {4,,Ltn d-/,i,^t DDtrF.t eF os,} u tlL o p,gL Lt, L v i V
{L/ k -'L ) q u ?1tL - p,t {rj p,,I,-fp 0.,*yt a,*.>, *a ),, llu! L.tz" f)
|
|
-?d,.at
CHAPTER
1
INTRODACTION
l.Introduction
1.1. Overview of the Current Studyl
Extiacts of pldts have
bd
disordel!. Tx€ roots of the
indigeoous to th.
by
wdtm
ddy ycN
. veiety
of ncwlogical
llarr Maed Delphihiw de"udaru
(Dd) which is
Eed fo.
Himalaya3 €nd flashmir have been used !o trcat seizws
loel folt nedicinc practitiones (io.5lly
a numbef
to [email protected]
of aqu€ou! 0!d orgmic €xltacls
called Jadwd). Chernical isolrtion
ha befl
of
retorted Pr€viously and shown
to contain @mpoutd! termed isoxylilones. Although, the extacb Pr€pared from
tbe aforerre ioned
(kza.
plet
have bem prcviously studied in .cute
et a1.,2001^i 8324 et
al.,2w1b;
Raza" el al.,2a03), ihe
s€ire
models
higlly purined
isoxylitones have not be€n chancterized for their me.hanism of actiod and any
biological or nolecula! effecls.
Thc isoxylitones ([E/Z]-2-propeonel,3,5,5-trim€thyD'cyclohexa-lylidine) de
Dovel isomdic ompo!trds coniainirg lhe
E/Z isomers in a ralio of l:2 a!
deilmiaed by probn NMR spectum (Fisucl).
discovercd
Tl'w
tuoud a biosssay-guided isolation sludy on
lhe nedicinal llanl
DeLphiniw destdarun aad pal€nled by International centq
[email protected] Sciences (ICCBS), Univ€fsity
of Keachi,
20080004353). P.evious findings showed that aqueous
compounds werc
fc
chemical
ud
Pakistm (US Pat€nl
.xiacB of DelphiniM
denulatuh tthi,bited sutained repetitive tuing ofhippocm?al
pruidal newns
(Rrzq et al.,2004ikaza, et al, 2002; Rrz3, ,t al, 2003) suggesling that sodrun
channel inhibi.ion day b€ ihc modo of action of thes.
out both
ir v''E
and
n viho
.xtracb Her., wo cMi.d
pZ isomdic mixtue
studics to .vsluat. thc cffccts of
of isorylitonar on vohase galed sodium chan'cls (VGSCS)
h o!&r
to detennine
its mechanism of action. Wc abo studi.d its €ffccls on important biological
ndkc
of €pilQsy
i!
veiou3 nodcls of kindling tlcn@, the whol. sludv is
aim.n to conduct ihc mcohanbtic sMies oflh€ nov€l anticrnvutsont iloxvlil,onet
d<l evalurc its rotc in.pilepsy in ordd to develop it
fttuc rnti-.lil.ptic
drug
a
a
Pol otial @didaL for
(ArD) lh.| could lddt*s lhe cb'lldsat of l..k of
appropriltc drug rcgimlns for the various foriN of€pilepsy
1.2.
BrcLgro'rnd
1.2.1. Epilepsy:
Epilep6y
n a group of ncurologicil c$ditiot8
symptoDolop which
tnos
no ncial,
hsving divcrsc a.riolog/ aDd
gogrrphiq
boudsics. Epilcpsy is ch&aciedzed by uProvoked
agc, socirl ol.!s, or Dtdonal
d
@uirt:rt scizruls ud is
mnked arnong the most pr€valent chronic n€uologicd diso.ders with 3 million
Arericm
and morc
the
50 million pcotlc living worldwid. wilh epilepsy &om
which about E0 % livc in dd.loping &d economicclly
er
hckw.td @uEi*
cl., 2YJ8). Epilclsy is thc lhird most common n.urologicil disordcr
after Akleim€1s
dis@.
and slrokc. Ils
prdllace it
great€r
lha
h
(Boer,
thc U S.
ce!€blal latsv,
IG
ITT
FituE l: 6arr..rr.
rd
fro&! NMR.f..f{r oflh. boE rh nL|!rc of
bdr[..o6 EfA.
1
nultiplc $ldo6is
dd ParkiM's
dis.{sc conbiftd.
Dspil!
diagnosis and tr€atinenl and how connon th€ dkeasc is, epilelsy
the leasr undcNtood of major c.brodo medic-at
dis€.se resls not only on ll)c auffding
on 0le
(R!dos, 2005).
Tls€ b a big laps. in
on thc
fmity
thc aaailalilib/ of th€ @rrcnt updated dara
l3E Diuiotr epil.ptic
lakista! (Klatria, .r al, 2003) with illc
ra1€
of9.9
iom
a mcdical crEditior
lcr
1000 individuals ofgereral
.16 rhe ir
tr irjury rhat areds ilc bnia
cause may b€ untnown (idiopatlic). Epilepsy is the reiult
ote bmin tissue
rhe sfudics
palicors tave b€€tr rcponad in
pop',latioo (She€rui, 2005). ln PakisLr, ir is morc comrnon in rural
Eliletsy [email protected] due !o
and indirccrly
more comnon in adulls thm in childdn
for the patients sufferirg from elilepsy in Pakisrrn Howdo,
conducled until 2005, about
remli6 mong
clnditim. Thc impacl ofrh.
laricnt but also
comunity. Epilepsy, worldwidc i!
admc.s in
major
o! r,'r.
of!€rnanenr clunges
(jNing thc neuoB !o be t@ willble
'n
or [email protected] .!d rte.eby
!€nding out abnormal signak due to mlid eledrical activity, rerultinS iD rep€a&i
and u?r€dichble scizlu!6.
bchaviou th.d occu aftd
There ee many diffdent
major catcgories
called panial
p.rlle witl
the physioal
flndiqs or cheges in
epilod. of abdomal [email protected] ic5l acriviry in tLe bnin.
tyle of
i.e focnl
seim,
e
A sdzw is
seizures, however,
seizur€s
ooour in
ud [email protected]
jut
seizug de divided
iDto two
scizurEs. Focrl seiares,
dro
orc pan of the bnin. Abour 60 pe$mr of
epil€psy have tucal seizurls. 'nl€6e seizxtas
e
fiqumrty d6lribcd
by lhc
da
ofthc brai!
i! *hich
they origimte e.8.
Institut. of N€urological Dhordds
dd
Stroke,
&otal
Ntro.
furth.r classified inb nvo crlegories; simple focnl
When
s.ires sprdd on bott [email protected] ol
,!d
brain
lobe seizwes (National
T1lo
fo.il seizuG aft
crmplex foc3l seizut€s.
it is c.lled
seiares. These sciuues lnay cause massive muscle spa$rs,
coNciousness.
Th€
oonwlsion". Wh.n
a
is
p6or's
gctr.olized
frlb, or
loss of
on€n uled interchangeably with
body shaks [email protected] and npidly, ir
k
called
@nwlsions. During @nwlsions, the individual,s muscles conbacl and retax
rc!.ardly
(PubMed Hedlh).
r.2.2. Classifi catior of Epilepsy:
The lnLernarionat League Agai,sr Epilepsy (rLA€) clmni5sion
(Pan
yiololoul$, 2011)
proposed th€ classificatim
i,
of epilQsy ald
syndrones on the b4sis of caus€s, age oforu€t, seiare tDes, signs
ad
1989
rctar.d
sympioDs,
[email protected] (EEG) lasem into the followins:
A) Cercrrlizad .pilepsy
rd
syndrones ar€ characlerized by 8€neralizld
seizue wbich involve bo$ rhe c€reb.al henistheres
coBciousnqs
soeralid
@mmon
ed
rhe seiz@ pan.m Ere reflccr.d
seizues
r
aronic, clonj, myoclooic
Bulrjlg in
o!.
positioD.
of
in EEG. V.rious typq of
ed
ronic seian s. The nosr
tyle !s tonic-ctonio seizw, ch.racterizcd by rigid
conr.actioB with fsing of limbs in
the loss
and violcnr muscutar
Incdiztior rellt.d or Prnid or locrl i.tzursr
B)
locilized point
i!
originat! Aom a single
the bEin which de tunher categorized as (a) Locdization
relaled idiopathic epilepsies mauly links to childhood epilepsics rhat may
dy
stase; and
()c4
O) Symptomatic lo.:liz6tion r.lated .pil€psies '/hict bave
dd lromireDt f€t@ of seianls ed
a
at
cl€.r
lh€ ovcEl picMc r.semblcs !o gmeratiz€d
c) Udeterhio.d epil.psis ,nd ryndrcd.. i... r[ethcr focrt o. gemrrtizcd,
Ilrs clas include rhose
epilepsi€,, or syndroDes which are not inctudcd
D) Specirl sydroDn, .rilopsy wirh rcflex seiaucs
iI
in
the
whict sizuE lre
precrpitated by so.sory stimuli €.g
musicogenic epilcpsy, pholos€nsitive epilepsy,
ho1
watcr
.!ile!sy
€tc_
Moreov€., ihe ILEA (ComlxisrioD 1989)
also characr.rizln
ovc. 40 distinct q?es ofolher
syndromes in
{
s
calegory.
E) Ref..crory epilepsy, the leported
.videncs has suggesrcd uat one
epilepsy patierrs are resist
nl to cunent teatmetrl regimes with anti+pilepric
druss (AEDS). 'nris is rermed
!s
rJ3.
ttj(l of
rltlctory
epitepsy.
P6thopysiolog/ of Epitepsy:
The valuable @ftibutioDs
in rhe pa&ophriotory
ofepdqxy wq.
Hugiiinss, David Ferier and
.Iheodd
Cusrav
(colo6on4 e/ al., \991). A
s€izutc origindA
wh.fl a g.oup of rcrve crlls in tle brain [email protected] bT€r-
cxcildlc lr|{l ddeclivc knoM
duc
as
.tilQtic foci. Thcs.
foci 6.bibir plasric ch,rng6
to inbrldc. in ilhibitory !!d ocitdory neuroml cu[rots ad
cxccssivc butsb of n€uonal cu.I.nt ar€
€inittd. Epilcpric [email protected]
e
sudd.o,
porhrid siret
for th. geoclltioo of s.iaftc lnd edibit high levelr of nru.d acrivity. Th.
variour caures of .pilcpsy palholos/ rBulthg
h sbnormd hner-otcii|biliry ad
slnclmricity include infecrioni, traumr, !b6.€ss€s! cysr!, n opbsm,
abnmlitj.s, chonic
inlliMtory
dcgenedtivc di!.rs.s of CNS and gco.rics.
br.in
proc€sscs in
at.. 2002i
veani,
inro two
nair
also
mcrabolic
'Ih. v&iouj
contribut to lh. cpilcpioScn.sb (V€zs!i,
.,
et al., 2008). Broadly, th! cpilcpsy parholos/ c{o be dividcd
typ€ of causcq
priErry cru..s snd 3.cod.ry or .cqdr.d
crus. Printly calscs include bh.rn n
crcldon ofepil.ptic foci in thc
gcneldon (Arneg.$, e,
idiopathic cpilepsics with
al,
bl.h
dcf6ts in tlr. gcncs r..sulting in fie
ccrebEl con :<,3 pot atid site for c!il.p6y
1996; Mullc.y, e,
uoh$M
ee.
CNS and meningd and various chonic
al,
[email protected]
2003).
eB6
'Ilar.
arc moctly
inctud. infetions
of
d.g.n rative bmin disord€G Crymiaisky
& T.lor, | 996; Lrnglob .r al, 2005).
1.2,4. G€Deric Causes
The cpilclsy gcnctics is
ofEpilep€y:
. vcry complcx phcnomcnoo a[(| thc progr8!
llsr lwo dccade prcvides
nd
nd.
h
rhc
lossibilirie fo! lhc .liagrosis ond trc{rnqr of
inlcritc! .!ilc!sy disordqs (Johnso{
er
al,
2003;
Mdiri,
"r
at, 2003i Dunc$, et
ar, 2006; Mcldilm & Rogawski, 2007i Lopes-Cend€s, 2008; Tsn & Berkovic,
2010)- Tle senctic factor cnfftitures about 40 % in the pathogctrcsis of epilepsies
and
yeiou
Somea
epileptic syldion€s due !o gen€ mutatioff (Loles-Cmdes, 200E;
ar,
er
201
l).
OD€
of rhe
o.ir
the geffs cading for lhe ditrer€nt
MuUey, er 4L, 2003;
Ymdoro,
et
sLrses inhqited epile$ics .rc [turarioN in
ior chrorels (cEtdiner & Irh€sjoh,
at.,z0tti Zrcco'i,20l t; Hill,
There channelopathies €xhibit defecrs in voltaSe-gated
which
m
id
2000;
er a/., 2011).
ohannel
fomarioc
rol influx and oudlow of sorliue, calcium and lotassium ioN in rhe
neuon l cills (Wallace,
er
ar, l99E; H.wki!s,
er
al,
201
l).
Some of
tE
Mples
of iDlqitod .pil.psics assmiated with channelopa$ies ircludc fanilial mesial
lemloBl lobe €pilepsy, autosonal dominant juvenile myoclooic €pilepsy, ud
fanilial bdigD n omlal seiafts (C€onam, d al, 2003; Pulsiptft, et a1.,21t09)
[email protected],
er
1.2.5. Status
Statu
dl,
2009; CroDptoq ./ at, 20 t0).
Epilepticus:
?ilelticu
is denned as "oDe conlinuou
Mining
seizue lasting longd
th& five mbut6 (Naia er ar., 20ll) or reclurenr sciarfts witiout
conscioun4s b.t*ccn seia&s for
g.st!. thm five
coNidered !o be a medical emergency because
mirutes are sufficient ro damage tb. trcuoN
udikely to sclf-lernilat by that spa! of
rir.
lh@
ed
tbat
minutos".
re
rcgaininS
It is
always
widence, rlat fiv€
rle sci^re, aE higbly
Slatus cpilepricus i,'
turhq divided
into two calegori$- conwktue and non-conwkive. The various causes of status
cpilcpticu itulude stokc, h€norrhsgc, iltoxicanB or v&ious ndyeN rcacliot|s to
drugF, [email protected]
cosmptio!,
fasting
or dietiry while tlking [email protected]
(Strliukyniene, e, ar, 2009).
1.2.6.
Epileptoge&sis:
Thc cpileptosenesis is e process of €lilepsy development in a Domal individud
duc ro
c.lluld,
iddal
iffdt
molccular
(Rskhd€
od
neuonal ohasSes in th€ n.two.k lrovoked by an
& JGetr. 2009). Ille d6r co6Eo! uoos veioN
contributing faclors of opilepaogenesis and fornation
neuronal and synapric llasticiry,
€
ular deails, inflammarory calcades, neurons
Irclif.mliq dd itMu€ $loder (Pilka&4
Tle
developm€ntal p.ocass6
dcpending upon
process.
ninules
fic
duration
of
ed
In the devcloltnent of
of ltc c?ibpnc foci ar.
201
l).
epil€ptogeiasis could be acule
or
chronic
inr.nsiiy of the initial iruult triggainS the
@t
.lileplogeretu, changcs tik llacr in
!fieting Oc ior cb&els t\.Riy chegilg
their aotivities
ed rtigSqhg
cpilcFy. The changas h ion clannels involve Elid depolariz.edon, aclivation of
i&ncdiare
aly
gen.s
dd
post-traNlarional chane$ in fimctional prcLiB. The
dcvelopmdt of chronic €pileplog$asis
undcrlyhg meclanilms
of
t*e, week to ftond|s
which hvolve
mossy fibre sprouting, neuogenesis,
glidis ed
..o.geizarion ofncuolEl network (Tinofev, e, ar, 2010). Anitul studiA h.ve
l0
shown thal the
udslyiog
mechmisms
of
oPileptogene'sis
incllde decrcls'd
numb€r of GABA receptor wiih mo$y fibre slroutinS' ccllulu
pbticity' ed
I)
D.uronal dca0rs (Vivash, ,r d/., 201
1.2.t. Kindlitrg Mod€Ls of Epileptogenasir:
th' basic
Appropdalc animal models of AileploScnesis aIe rEquired to undeistad
mc.hdisEs of cPilcFy drd seizw disord.rs The Fosi widclv
study tle underlying
us€d mod'ls to
b$ic [email protected]!ru ofcpilePsv dd seize disordd arc oall€d
ptoc-lss in tninals is
kindling model ofepileptogenesis in which .lilePtogmcah
lhe
iniliaEd by kjndling (McNanda- rr 41, l9E5) Wbm
drdslioc in ftutonal
permatent rcorgailr3tton
aotivity @ produced, lhc mammalian CNS undqgoes a
of
synaptic conncodons (Huh€l
& M$d'
1965) Pancmed activitv in lhc
!o the form'iioo of
mdal
svnapitc
dcveloli4 nsious systen is
essendal
conneotiotrs (Shatz, 1990; Cline
& CoD!&nlinePaton, 1990)' 4d exces neuronal
to lhe fornalion of
activity in the matu€ rcrvous s'st€m also contribuGs
sbno@.I [email protected] [email protected] (Sutuh' e'
dl,
l98E;
R'pct'
et
al'
1993)
fle€tins
Kindling is a rnod.l of cPil€psv in $'hich ncuonal activitv undelgoes
changas in
fie form oftansi{t
fooal seiaires le3ding lo lifelonS tunctional and
stnDtulal [email protected] of lhe marntnatian
decribed by Goddard in late 1960s
t!
b!!il
Thc kinding model
*'s
filst
be pro'6s of rcP"&d applioation of sub
conudsive chemical or elecldcal stimuli r€sulting
in an incre'sed
n€uronal
u
tbsholds folowed by Spnedlizsd teizrtes (Goddsrd' €l dl,
2001;
alone
MGtti,
er
1969;
T'dlkn! tr ar,
ar, 2008). L!!er over $c Past.two dc.ades' the rcscarcbe6 have
t dendous work to und€rst&d lhc kindling mechadsms (most comonly
rodmts bul could bo o$er
as well €.8. monkevs, cai8' dogs etc
einals
ir
) md
aloning better knowl.dge and undcrsttnding of.9il€psv. The kindling induod
!€tnane
chang€s lhat
!e$ht
peme€nt (D.Mison, .r 41,
over long pcriod oftime and
1995).
lt
has been rePortcd
de genercllv semi'
$at undtrlving cheg€s
ofkindling involve intiacelllld m€cha.isms and various neuotrdnilter svstems
(Raoine, 19?8; Averzini & Franc4schitti, 2003; McNanar4 e'
of gdedcally
etrgineeEd
us€
mic, ha bcln r€podcd to ude$l4d lhc Eoetic
mechanisN of khdling (McNamr4 1995i waaambc, .,
1.2.7.1.
4t' 2006) 'nE
al,
1996).
Typ6 of Kindliry:
The mosi widcty
s.d
modcls
ofki
Uing
e c!.Dicrl4d el'rfticd models of
epileplogo6is. The cb.oic.l nod.t of ktdling is s well loown epilep6v no<lel
in which chemicnl conuisanls sre dministored periodically
coNulsive dos€ that
prcsressiv.
seire
i
tuce changcs
h
ir
animals
h
a sub
lhc seizue $reshold tesuliing in
activity (Maron, 1972). Som' of
a
[E chemGconwlsrnts ue{r
for chernical kindling inolude pentvl€netotazole (PTZ), bicuculline'
chlordinoform (Gilben, 1994; Gilbcn, 2001) 'Ihe elect
cll
lindane'
xlndlins r€fe$ to
prcgi€ssive seizure activities in response to repeated sub conwlsive elstncal
1Z
srimuli r€sulting
ir
Tb. elcctrical slimuli in Ble.lrical
10 g€n€ralizld sli2ures.
kidling @ appli.d in lh. form of clrent inlcnsity
dischaqe for dre kindlins developmenl.
so lhat it
TI. rcpoted .[email protected]
rhe afier-dischdge threshold thus lead ,o
mut
indu@
an6-
stimulatiotrs
lowd
$6 lroduction of aft.r-dischsrge ard
ultirEtely lcading to kindling (Racine, 1972a).
1.3. Role of Voltage-gated
vollagqgaled ion channels
activated
by
cbanges
io
Sodiud Chanrels tn Epileptic Seizures:
e
a cl6ss oftlts-mdbratc ion chmels that arc
voltlge-gar.d ion [email protected] ar. pr.scnt
are conmotr in many olhe.
The
ed
of
diti.sl itnpod4@ [email protected]
, but
b"c', of c.lb Thcsc
n€uroDal and mlscl€ excilability
aepotui:arion
ocrt lh! [email protected]
olocLical polcntial diflor.nce
in r€spoEe io
dut
ioD
allows
a
@cial role in
crordinden ard rapid
in votlgc. AmoDg th6e
(VGSC' havhg Particulu ioPortare
epihlic seiarG, d€ prcscrt in 0l! lncmbrec of
tyP€s
s
triSgc.itrg th. cbange
chaonels, volrage-sated sodium channels
myoc]ts, md cedain
chfinels Plsv
excilable @lls such
n
d rcuron!'
of Stia Ttcr. VGSCS arc r€sposiblc for the rising
phse of actiotr pokntials.
fte
voltage is a major souroe
ofN!* .nry
when the neuron is depolarize4
comequenlly allows fo. ihe action poiential to Propagate (Jesell'
er
al,
2000:
ud
Hill'
2001). Sodiun channels conrht of a largc alPha (o) sDbuit that associat$ with
other proleins, €.s. one to tqo bcta (p) subunits havinS several tunctiors including
13
modulatiotr of
the
[email protected] sating osom,
clamd is fdmed by d subunit
2001)
$ shom h
the Fieure 2A.
and lhis submit is tunctioml
fte
or its
of
core
om
Thc
llplE subuit peteiq whcn cxpEs.d by a @I is lble !o forll chmds thlt
conduct sodium ions in a voltage-saled way.
contaitrs a selcctivity
filt ! madc
'fte
pore (alpha subunit) of VCSCS
of rogalivcly cbaScd sEfno acid retiducq which
&aw th€ Na'positiveions in and kc.p the negativcly chnged ions
oul
..g. chlondc.
According
to the
IUPHAR (Intd.tionll Ution
Phamacology) which maintairs the currcn y
for sodilm chamels, lhcrc arE
b
d al,
2005) as shom in 1tlc Figue
f't[owing
rtaacs
i.e. d.aotivat€d o. re6ting st
/
ope6 to allow Na+ ertry into the @U),
ud
usc st ndardized mmmclatur€
29
(Cattaall,
is closed aftcr action potcntial
Clinicnl
lino*D nenbcrs of th€ hDily ot VGSCS
DiDe
responsive ro depoldizntion srimuli
of Bsic 6d
t
VOSCS hav€
th@ ditrerent
(lhe [email protected] i5 closed bul
signal), depolrrlz{tiotr sttle (ihe chamel
4d ilrctihted ltlte
not respotsivo to
vollge
in
wtici
the
cbdel
changes (Ysnaok4 er
ar, 2006) as shoM in lhe ligue 3C. The gromdwo.k of udelstading
[email protected] i fting came &om thc [email protected] work of HodSkin
and
Hlxley, *ho showed
that the upstroke ofaction poiential is due to the mPid inward flow
ofsodiun ions
(Hodgkin & Huxley, 1952). Sodium currents (/NJ ar€ vibr for lhc iailiatio
?rcplgation of newnal c.tl
tulg.
Thcy ue
iblliolt€d
L
the
Plav ctucial
'nd
rcls
in
r€grlating rhe neu.oral exciiability, and hner'excitabilitv of the n€uronal Detwork
l4
*o"o,0]L
1t
(A)
Figure 2: Di.gEm of
!
vollrye-grt€d
N!' cbrtrrel (drpt€d from
hll0://erwilipedir.org/wiltsodium_chrnnel).
A)
tbe web
Sodium channel Alphu
n'hunil. Phosphorllation (PJ, glycosylalion (C). inacrivation (l). ion seledi!itl
(s). lositive (-) char8cs in 54
e
important lbr tmnsmembnne vohage sensin!.
Bli l-ikel) elolutionq- rclalionship
of$c
nine tno$n human sodiuo channcls.
C)i rhree ditirenl slalcs of sodium channeli.e. Closed (prirncd). Open(acrivared).
l5
@ntribut€s io the seiauo-p.one stNt€ and cpiLPly.
Ion chmds are inteSral menbrane prot
co rcl.
i
and arc, thcrefor€, undd 86€tic
The Senelic mutations of ion chamels arc accounl.able fo.
dis€ases and channelopalhies, ransing ftom cardiac
&
to migrahe (Fiead
vdiou
huruan
atrbthnias to cvstic fibrosir
Gddine., 2003r Jhtsch, sr
dt,
2004). Innate
fom
(inhqiled) of epilepsy compris€ a leadins examplc of channclolathies in which
of ior
dysfunction
channel
altc6
tle
herercgen€ous state tbat can bc rcaulicd
inhentd
dor
tom !n &quir€d brain
in lig.nd- or voltngc 8a&d
2004; Geo.8 , 2004; Gr.vcs, 2006).
neuloMl excitabilitv. EPilePsv
fifttion of
iNlt
is
a
or &oi[ an
ion chatnel (Bena.d' .r 4't,
B.nig! fanilial oco['ral conwlsioru w4 tho
first voltage gat€d chann.l defect reportcd du€ to polassium chamcl lutatiotr
(Biwe.!
have
et
bm
al,
1998)
disc.v€red in
might €von result
(Berkovic, er
1.4. Rol€
dd
al,
sinc€ lhco th. scveral genetic mutatiols
fmilic'r'rfth epilcPsy
&@
.
2006).
ofc-FN in EpilePsY:
dd ee beliFved
procss. c-Fos.
,1,
Somc hhe.ited forDs of€Pilelsies
combiiatid of envircnn nial md gdetic fa.toa
Imodiate ea.ly 8ercs gEGs)
excitation
ofion [email protected]
a
have b€en r€poned 10 b€ involved in the
to play
.
role in the developneni of he kindlitrg
prolein encoded by thc FOS g€nc (Monje, el
2005; Konsman
neuoml
al,
2005; Bossis' €r
& Blomqvist, 2005), is a cclluld lroto oncogerc utai belongs
l6
to thc fardly
oftaBcriptioo hclols crllcd illlncdiat€ €nrly gcn€s Expnssiotr of
e/6 is Nsociated wi& brief chugd in re'lMal !.livitv lo FtEdot
modiiicatiotr of neuronal slrucnirc and fillction in lhc tlmnlalian oervou svstem
(W^tMb.,
et aL, 1996). The c-Fos tr.nscnPtion is upftSulat!-d in respoN to
[email protected] sanals suct
concedlntiotr of
tr$iently
c-rr
s
srosth factots (BDNF, VEGF, TNF o €tc.) The ba$l
it
is very low in brain cellsi lowev€r,
can be induced
in respon$ to vanous slimuli e.g. s.izur€s (Schreit$, et al., 1991a)
'Iho c-ltor gene encodcs DNA binding prclcins (c-Fot dnt can
lr
sactivate otha
inducible genes (Kaczmarelq et al.,2002; Co [email protected],2004; Rnivich & Bebens,
2006; GN€tal, 2004). Th€€ sr€
circusrrniial evid€nc$
€lem€nt of a cnai! of molecular
[email protected] @I
activation
.l al,
a]m ir
1993i Kiessling
cv.ds that cmcludc in outgro"th of
seiarc mod.ls.
ofefos taacription
&
bereafrer by expression
suggEsling ftar
and othff
Scizur€s are sutftcient
io
IEG (Morga & Cutra4
l9l;
Gass, 1993) in lhe dentale
c-lo
is
delaare
induce rhe
l2biner,
sruule @ns, fonowd s{oo
of gen.s c{dins for n€urotrophic fa6t0rs e.g. bnin-
derived neuotophic faclo! (BDNF), basic fibroblat growth factor
OrcF), lerv€
gro*1n factor (Gall & lsackon, 1989; Emfors, er
1993;
al,
1994), and neurotrolhic factor
1993; Bogr4 €r
It hd bm
al,
al, l99l; Gall,
call,
re.rpto6 e.g. FGFR- l, Trk B @qszan, et
?r
aL,
1994).
r€portcd tbat
a singlc sdbinisuatior of
pmtyloetetrele (PTZ) (45 ms&d
!o
r
knolyn coowbnt
mie induc.n c-t6 explBio
in
vsiow
17
b.ain r€gions (Dmgunoq
rt al,
speculated that the ioduction of
1988; Slgar, er
c-tr
dl,
1988). Iher€fore,
al, 20{0).
indicate,s rccent activity (Day,
,r a/.,
dino &id
ilduc.d
ft.
c-for mRNA uFregulrtion in
! rcuron
2008)
ad ncumMl dpr€ssior of ctor
urBierlly [email protected] duilg seizru.s whcn neurds @ r+idly fting
potentials (Dragunow
€x!rcsion cd
1.5. Role
be
& Faull,
m€dNd
1989; VanElzlkk€r, e,
as an
i5
.xprcssion mighl play an imporilnt rol€ i,l
thc ddelopmdt of $izutes, as wcll as in the excitalory
neuoloxic.ity (Yosbihis4 e,
it
al,
is
actioo
2008), thercforc, thc
indirao! markcr of neuronal activity.
ofBDNF in Epilepry:
i!
a
ser.€ted prclein (Biadcr
Schetu2a 200a) eftoded by l[e BDNI 8clc
ir
hunanr (Jooes & R€ichardr
Bmin-derived neuotrophic faclor (BDND
1990i
Maisoryi@, e, al,
thc developiry
l9l)
rwous slstcm
aod i5 ubiquirous
rhcrc
h
i! I prcolrurc
tbe CNS ttroughNt lifc.
phase not r.quiring
&
Ir
[email protected]
aclivity d'iriDg the fonnatioD of neurooai crmectioB, aDd a later aclivity
dcpodent phase. The e&ly [email protected] of
ilrg.l $lection ud don l
path
fndirg
arc not considered to require rcurat activity, wher€as rh€ larer fine-tuning
of
[email protected] into their addr pattem! rcquircs rculonnl activity (coodma! & Shara
1993i
PtNs,
ncuronal
et al., 1994). Differmt cnracclluld $gnats regular€
[email protected]
such signals
and rh@ is
fte grcyth of
r sEiot crobol of tinirg, loc.lizrioo ad lqcb of
*hich is critical for norn t d.vclopn€d of
D€utonal comcclions.
l8
Ihere signals may b. util'zed for supporl of neuronnl 3urvival, diffcrmtiatioq
pldticity md fturit! go$th. Ncurokophic factors promoi! neurile
fiom neuroff and crll survival
h fie peripheral
Balde, 1980; Barde, l9E9), how6v€r, lh€
swival ed go$,lh h tt.
sugg.st thrt BDNF
1996) of CNS
&d
ncuon!
CNS
h
not
outgro$,th
nervout sysien Gllo€ren
mcchanb
and siSnals promoting
y.t compl.lcly ud6!ood. [email protected]
olher ncurotophiff control
srudi.s
diffdlrliation (Many,
€r ar,
tar. p.d in th. etlblisbsdt of fibctioMl n.moal
aDd
.t.1,
mrwo*s (&belli, e, at, 1995; Cohalcory & Ftar€r, 1995t McAllist€r,
1995; Riddle
& Lo, 1995).
ft ha, bear report d lhat BDNF bRNA c.nc.ntntions arc incrE{scd by
activity in kbdline and oth€r s€iau. nodels 0$ck5oq €r 4/.,
Gall,
er
at, 199r.
antibodics durins
(Binder, er
al,
Sclccrivc bloctld€ of EtB rcc€ptoE usiDg
khdlins
1999).
It hs
also
epil€ptog@.sis
ed
lrt{p4ific 'c€ptor
kindling
h.ar sllor|n th!. BDNF incrt.$e
ncuroDlr
in the aft{s
impliclrcd in
inteftrcnc. in BDNF sie!.I transduction supp|lsg th.
dr.l,
1996). Th.sc cvidcoc€s susscst
BDNF contdbutes !o epilcptogcncsis, howcvcr, tnolccuh
ed
[email protected] by whioh BDNI influcnce, conne.tiviry and €xcitlbility
ed
ya
1993;
of
dw€lopmmr ofcpilepric stalc ia vr'w (Gall,
bmin is nor
sire
l99l; Cr[,
dev€lopment inhibit rhc dci€topm€nt
€xcitlbility ,nd is lo.ilizcn rnd uprcgulatld
tut
&
esiablishcd
@Uula!
h
lntl fidher invetiSarions could pmvide nov€l
adult
iargcrs
cmcepts fo. snliconwlsant or eti-epileptogeric ther4y.
l9
1.6.
Trcrtment of Epilepsyl
Anong lho multi-nodel th€iapi€s availablc for epil€lsy tr€attncn! thc fint line
modc of thqapy comiderEd to bc lhc mosl.ffective
epileptio druss (AEDS)
Mntly
1997i Kem€ny, 2001).
Ite
ed
prevcnl
rill
dat€
ir thc usc oi adi-
being oommonly ued worldwidc (Mycek, er 4t,
AEDS, also oalled antico dsants, altlough crnEol
s.irues, cannot entircly cu! epil.psy ([email protected], 2001; [email protected]'
2002). Therc AEDS are adminished in paliesls havirs r€curr.ot scia&s w'lh
unlno*r ctiology
Escueto, €r
dl,
and are
foudaiion of l$abeDt for elileltic palimis (Delgado-
1983). Olhe. dErap€ulic oprioN include kelogenic
ndve stimulation (VNS), ssmrna knif. mdiothdapy
Labt,
et
s.rvcd
tl., lgqgrKati.r,
et aa, 2009). Surgcry
i,
ud $rgerv
an
diel
vaeus
(Spcnc.., 1986r
ex!€m.lv s.lc{riv. option
for paridb eho hsve res€cbble cpilcPtic lesion
dd
do nol r.spond to
themedicalthcrapy(K€neDy,200riT.llez-Z. EN,et a|,2009)
Sincc thc introduction ofpotassiurn bromide as lhe
fi^t
drug for thc treatment
of
hysrcrical s€izues by Sir chades Locock (Pearce, 2002), several AEDS havc b€en
intioduccd duing last 160
for cpil.pric paliots
hypnocis) limit€d
yes.
(Mdilt &
Ph.nobarbiton was lhe
fist
!s.d
svnthctic dniS
Puh.|m, l9E4) but the sid. etrelb (scdltiod
its long term usd in epilelsy. The anticorwlstd
sdeening took modem tum
in
dd
drug
1938 when severat fst-getrelation (classical or
baditioml) ABDS includins Phcnlaoin (Swinyud
& Tonm,
1950) and
C3rbMaftline, [email protected], clonazeparl prirnidorc, vatlroic
lats'
aci4
and
20
.rt6sinid4
rw
19?3; Coveis,
[email protected] dqilg lb. Pqiod of 1960-19B
et al.,
1982). Di."rP3n
beradiazepioos [email protected]
@ giva i.v. to @!hol r!€
til
acule
d.dte
for thc
!!d
(de Pasqu.t et ar,
loFz€palo
tre ihe odv
lr.dhedi ofsbnls epilopticu
and
s.i4rc, (R!j, 4 ar, 201l). Both lhc dsg3 bde
equal eficaoies; however, lomzepam r€plaed disz€p0n as first drus of choice in
stltns epn€ldcus [email protected] of
(tap!ik,
&!oM
dt
d
&ti@ md
ar,
1983).
A
it!
trq clss
shon
h.lf lifc Nd
loDs
dti-seire
[email protected]
of AEDg emersen in 1993 whicfi cane io b€
sond-geneation AEDS. Tha. AEDS hsve .tfiercDl d.cheism of
phMkir€tic
profilcs
s
coop.r.d to the lal-gdefttiu AEDI
SemGgoqation AEDS e b.nd [email protected] wifi
ls svw ady6. efrects ud
efd thd [email protected] AIDS (Ail@ & Broel),
2000j
Pc.l@ & K*Etr,
2005;
Sbii, et ar.. 2011). [email protected] [email protected] AED! includc Lnotrigine lwet'ecetab,
gdaFntia felb.bate, [email protected], tiaglbin€, pngab.ho, oxcarb&€pire ad
Dnisdidg Dspire rh. iDroducrio! of
ns
AEDS,
m@ thd
3Cn6
patidts Mained poo.ly @nEoll€d with th€sc fi.ondire AEDS
dpeiidce mdesi.able
sidc
eficct (Bid.r,
2006).
'Ih.
of
e! eFy
.d lNy
most suit ble rhwpeutic
option for ilt6e pati.nls wouLl prcbably be th€ combined adminiltrariotr of two or
nore anti€pileptic agdts or tlE lpplioarion of nov€l third-gden ion AEDS
(Bblq, €ra.l., 200?). Aier rle 3!.ond-gcncodoD ctss, phmacsnjcrl [email protected]
h.vc prodlced eld licds.d rouy nov.l AED8 of lhird goe.atiotr
caresory
i&luding Blicr.loepin , rufllsidc, t{o3rmidq Migsbitr , dd [email protected]
2l
Thcre i! no formuh
10
opt which seiarc medicilioo to usc for
a
ponicular
prti.al
No one druB dominales for effectivmoss, &d all have a veiety of side etreots. It
ni'
b€8D
r wel estlblished fact
howcv€r, if lhe pa.i.nl
lhen the patien!
ude
lllt
ther. is no 100
0,6
trcatment remairu s.iaue
clr€ of€pilcpsy by drugs,
te.
at
[email protected]
night udergo Eadual withdrawal ofAEDs. If
a
for tb@ ycds
latiai
r€mai$
seiare Ate suctKtully atur the total withdlawal of AEDS the th@ ee chuc€
for lhe paicnt to have
l.7.ILAI
$ire
ft.e life afrerwards (ILAB suid€lines, 2006).
Guidelines for the UsG ofAEDs in Epilepsy:
lntcmational Leasue Asainst Epilepsy
to propaly diaAnose lnd
clNify
ol/\E,
2006) re.ommods lhat it is crucial
rhe t)?c ofepilepsy befor. srnrting the lrcarnent.
Ancr oEt single drug lieabadt of cldsical o. ftw.r AEDS with minilnd rc9uircd
ltcdpotic
dose and l€rst sidc eff€cb should bc
givo If sciaues
of tie Flicnt
ee 3lill ucontroled lhm the dose should be giadually hcre$€d rill the naximd
th€rap€utjo dose is achiev€d.
could
A
second
AED can be addcd whib fie fili1 dru8
eift.r bc @ntinucd concoDirintty if
withdnw. 'Illc combharioD of ola$i.rl &d
nccded
tr
n*cr dn$
glldDtty renued ed
is [email protected]
it
rhe
tol',thempy is needen. cender, agq typo of epil.lsy md lssociated [email protected] and
pr€8Mcy a.o some importrnt factors !o be considd€d when prcdibing lhe
AXDS (PeMy
& NewmtuL l9?9; Penry &
suidelines, 2006 clauscr,
Porrer, t979; Suder,2004; ILAE
eral, 2006).
22
1.8. Reserrch
Objectiver:
li!
Th€ pftscnt ltudy is aim€d 10 cxllorc
a
pd€ot€d
mectoism of aotion of rh. nov€t rnd
iconwlsant @mpound isoxyliioner and invesriga& ir! .frccts oo lhc
expression of Gfos md brain-d€riv€d
bnir A! discussen .irli6,
ncuotolhio fador (BDNF) in the kindled
rhcr! is tro 100 %
cre
of epileFry and
D@ thd
30 %
lalietrB worldwid€ arc still living with reftacrory €pilelsy, thcrcfore, lhere ar. srilt
scno6, umet [email protected] fof thc
he{hdt
of €pilep$y aad therc remaiB a dirc nccd
for the develolment of rcw AfDs rhat
cs decr@ *ire
tEquenoy ar well a! imprcv€ tol€mbility and $fety.
syn1h6nc compouds
ed
have cbrcnic
ad
Cumtly
sev.rity &d
availabl€ AEDS er€
doserchred
bncit
involving
virtually wery major organ syslem, t€mrogenic effecB and adv€Be cff*ts on
cngDition
ald behviour (Sni!\
Samren, er
sDd
Blcck, 1991; Holn6, 1993i Mnttsor! 1995;
al, t999).
Natural p.oducts from
foft
imovation of modem dNgs
rcm€dies
sd @
of nw AEDS wilh novel
driconvubst
bc sn alternative
structurcs
(FlGworth, 1994; C..Ag et al.,
compouDd has
haw significandy co ribaed
succ
MeldM,
thc
for the dcv.lopnent
,nd bett€r eflicacy and sf€ty
19911
b
profrles
1997). The invcsli8atioml
bem €xtraoted and puified
ton
rools
of
a
redici,Ml h.tb Delphi"iw d2ndaru thra has r hi$tory of Ne for lle ftitlncnt
of epilepsy in the sub-cotrtiDeni by folk praciitionen (Said, 1970). Earlicr,
eizw
model shrdie had
shoh [email protected] ed.cizG etivity in
i,
''1o
aqu@^a
ta.tion (AF) of D' de^rdatu (FJ@, et at., zoor). rn additioq ir bad b€€n
rcpoded ihat ihe
AF
suppr€ssed susbired reporiiirc
hippompal ncurod (Rrza
fuing
e, ar, 2004) bur the higbty purificd
of prnnidal
hoxylilo!$
hav€
nevq b@ chlractaizd for its mootdnisn oi actioo .nd ary molecular or
biologiod effect9. 'tlEEfore" wc hypothcsizld lhrt sodiun
ct ed ilhibiriu My
b. the mechaaism acrion of isoxytiron s, and if so, w€ wlrc fiuth€r inter€sl€d ro
s@
hw
it suppresscs t[e sodium cunont and [email protected] afleci thc rrav.linS of acrion
lotetrtial- We also hyporhesized r!.at irorylitord
BDNF cxlrcssion by deocising
broader selsq
Dy
donDrcg,nne o-Fos and
tlc ftl)tonal activitt ir ki.dcn brair. ftus,
in
I
tlE presert study was cmied out to d.illop rhe novcl
eticonvulsant isoxylitones
lEZl s, a lot
ntial cudidaie for tutur€ Ar.D.
CHAPTER2
METHODOLOGY
25
2.1.
1'
ft
viro STUDIES
u'vo expdiments for Pharmacological shdres w.re cdied out 3s oudined
2.1.1.
Atrinals:
Adult Mrle NMRI albino nicc (stain ac{uir€d fiom
Insriture, Sweden)
lntcmationnl cente. for
w@
access !o
wd
mainrained ar 2J
r
w@ houed at Animal
Chdicnl ed Biologicrl
kept under
circadian [email protected]@, all thc experinents
House Facility,
wft
of
conEoucd cooditions havirg
and water. Thc hollsing ,Ica
2oC wirh Lhe lighL/dnk
and
Science, 0CCBS} Univelsity
envircmolaly
$.n brd labo.alory food
fr€.
pm. The ute
at M€dical Research
of weighl 20-25 g were ured for acuto seizure mod€l
chemical kindling model. The aaisrls
Karachi- The mi@
N
qcle of
tempcnllr
12 hours €ach. To avoid
perfom€d botwe€n 9:00 an
1o E:00
of aninals was aFroven by $e Scientific Advisory Commino€ on
Animal Care, Usc
.d
Sciences. Univ€Bity
Cridelines for the
Slrndardr, lntlrnrliotral Center for Chemical and Biologicd
of Kanc.hi, Paki$aa
i!
c.Dplimce witl lhc IntaDrdoMl
Cre md Use oflaboratory Animals.
Adult male S!88u. Dawlcy (SD) rars (Chad€s River, Canada) wcighing 200 250 g at
ti€ time of
study were used for electdcal kindlinS
$nples for real-lime PCR analysis. Tle oimals were
sp€rialized cages wilh
fr.!
access !o food
ad
for acquiriDg
housed individually
ud watd and 12:12
h Iighu
ds*
ir
cycle
26
was mainlained. Th€ cxpdimcntll protocols wer€ approycd by the Animal Cara
Cotmit@ of Th. Univasity of
ed wqe
.wgicrn
Ontario, Calada (Prolocil #
carried out in complirn@ wilh lhe gdd€lind of
20l&0l?)
Ceadid goucil
on
Anihal C$e (CCAC).
Prior to thc exp€ritnenbtioDs, lhc
exFnnental environment
rninimizc
strK
to thc
nmbs ofanioals
uitrds wde selirDtized
and with the €xp€rim€n1er.
,nim,l. ed
tLe grcup size
for 2-3 drys
wili thc
All the efforts were made to
wls detmi..d lo lbc
milimu
for valid siatistical analyss.
2.1.2. Rergents / Chemicals:
The chqnicals and rcaS€nls uscd fo. lhis study w€.c of analytical [email protected] and
srsnd4d labo.atory grade. Pentylene&rnzole (PTZ)
Chcmical CorD?dy (St. Louh, MO, USA)
ud
wd purohlt€d Aom Signa
Biocytin fiom Sisna-Aldrich,
Oakvi[., Ontano, Ceada. ltE stadard drug i.c., diazcpm (DZ) w$ a ldod gifr
fiom Roch€ Phmaceulic2ls (Roche Palisbn Ltd. P'kistu) 'Ih€ c-F$ primary
adiMy
sc-52
nbbil polyclonal IgG
and BDNF (N-20)
dbbit IgG w.rc pwhded fioD Sdla
AlcE Fluorc
Cu
prinuly lltibody st546
Bioteolmlos/ Inc. (CA, USA). The
546 goat anti-nbbit IgC s.condary andbody
InviE%o (Life
Technologia3,
wls pwbssed &om
}IY, USA). AI lhc solutiotrr w.re pr€FEd
ft€sh
pr'or to us€ in lhe experim€nii in order to avoid the environrn€ntal €ff€.ts on tbe
[email protected] The
t6. @mptMd isoxylitotr* (rE/4-2-pb!donct,3,5,5-trimcl[yl27
2-cycloh€xenJ-ylidine)
wa syDticsiz.d by ow
chemist @llaboators a! ICCBS,
Universiry of Karachi, Pakislsn.
2.1.3,Subcutancou! Pertyl€retotnzrle.Induc€d Seizrre Test (scPTZ.
Induc€d Acut€ Seizures ModcD:
Andcon!{lsant effccts
of iso}llilones
Mluated by administering al least tbi€c
ng/4(g
!o
groups
of six
mic€, at
using scPlz acute s€izure resr was
doses
lesr
i.c. 15 mgftg, 20 mgr€
ed
30
30-40 min b€fore subcut neou3
adninist?lion of convulsive doses of PTZ (90 m8fte). Afrer adrninilterins PTa
the nice wer€ isolaled and pla.ed sepdately itr a cl@ plqiglass clanber and
closcly observed for atr hour for the
seizure pattems (Losch€r, er
pffic€ d
at, l99l)
abscn@
of dilreMt tylas of
i.e. o.ier of body reilch6, drcshold
$izures, gderaliz.d scizurq with loss ofriShlbg refloq loss of righdng renex
with lonic forelinb seizur6, loss of righliDg reflex wi0t
toic
forclimb ald hind
Imb senuEs (Iable l). The protlclion from PTzinduc.d Dort lirt was
nonilored within 24 hous. In all €xpenne s, die€pdn (7
5
mc^s
iP)
also
w's lsed
2.r.4.In ,i'o Models of Epileptoge!€sisl
Two typcs of kindlinS mod€l of epilelsy werc used
b
induce epileptogensis in
2.1.4.1. scPTzlnduced Chemical Kitrdling
On@
sd.d.d in 1he acute seirue
comloud
on the dcvelopnert on epilepsy
of NMRI mic, (Fisurc 3). Sin€
30 mglkg
Dodel,
*e
Mod.l of Epile!'togemais:
w. n xt lwluted the effccr of (4r
pr()cs uilg chmicil kindliDg Eodel
observed thar lhe
[email protected] rctarded thc acut!
tst cornpoud
w$
seizur€s $ercfore, it
this do6e fo. kindling experimenls. The kindlitrS
*ts
at lhe dos€
decided 10
ue
nduc€d according to the
nrodified nethod of D€ Sarro (2000). Bricav, anirnals were divide/
gloups
of
irio fou
d shom in the Table 2. Each tr€3tmst Sroup 68hk of 12 male NMRI
givcn submice.angins ftom 2{125 8. All lhc grouls [email protected] noEnal @rtrolw€re
oD dr'mate day
conwlsive dose of PTZ i e., 50 rng Ag subc{bneouslv onca
be1w€en
9J0
'
llr00 en.
The
mmat contol
and drug control grouPs rcceived
(0 5 mL of
daily intnperitoneal dose of saline
0
9v" Nscl)
mg&g) r.s?.4tively Likewise, lhe te't Sroup
isoryliton€s mixture (30 m8/k&
i,)
wd
dd
diazeplrn (? 5
adsitri$eRn w
h
the
onc! dailv On the dav of PIz
3040
diazcpam or isoxvlilon€s w€re Siven
ndrninhEation, the treatment of saline'
ninutes bcfor€ tlE PTZ
obse.varion chambN
for
Aft(
I
€ach PTZ injectioi! aninab
hou' dd
behavioral
{@
seitlr! activitv thcy show seiarc Pattlrns doriry
1be
behsviosl stage
ldndling tt€ cl4sifi€d into five disinct
calculated andfie
Cumularive kindling score was
n
*izure acliYity wd ral.d
for the
to
a pre-valid'ted scoritrg sclle
accolding
scored
were
Animals
rhc
Phc€a
swaitv of
g'adual ddelopnrmt
as
of
sbom in the Table
€xplinents w@
td
l'
tated
29
E$ and faciallwilchinS
Conwhive $ave througl the body
rnro sidt posirion
clonicaonic conwhions rum ovtr
Cen ralizcd clonic'tonic s'!zuFs'
pcruo!
Trble
l:
Beh.vionl 6tirg 3"1' for PTz'irduceil 'Pil'ptog'msis'
l0
0.5
mlof0 s%
l0 me^s
PIZ
50 mBAs
?.5
mt/rg
grouPs ot scPTZltrduced
Cbenic Kindling
Model or
Epile ogendis
lt
FEurc
3: A i.Pra'dltiY'
.I.nicrt |(hdnry Doild
of
protognDh of Nrl|RI
'd'?r.l'r64
iie $'d h tb"todv of
once
tle
P
crntlol Eoup reached the soorc 5. The b.ain salnples were collegted
and proclssed
for n
nunodiaining and RT-rcR ealyscs
of e/or,
and
imBuostajiing fo! BDNF protlin 6xpGsion.
2.1.4.2.
Eleclricil KiEdling Model of Epiteptogeresi!:
Mllc sD nE *eigbiag
200-250 g
!t lhc lim. ofsutgqy *!rc uscd tuirn ls wcrc
ana!,rth.rizd wilh Kcinninenomilo (4:l) cmbbatio! (i.p.) 3od
two bipol& stimulating
/
idplet
d with
recordhg el€otrodes bilalemlly in lhe basolat rul
,mygd.le *ith ltrc following coo.dind6: 2.56 om pos&rior to BE€84 4 8 run
laLnl to midlin ed
E.0
tm vde.l (Pdiros a
WarsoL l99E). The elccltode
were constructed of two twisted stands of 0.127-mm diameter Dimel-ilsulated
Nichrome wire (LEICO
Anphc|ol pi!s. All lhc
lt€rilized prior
ws
held
b $c
ir tle
intrMqa
*quircd fc sdg.rv ilcluding elc.lrodcs
wd
tb€ bste of
rn. st.@taxic ianrum{t
& waBon, 1998) Two err
bars wcre inser€d into the
sklll is PaEllcl lo
m$tii
of the rat to sulpod the lrop€r plac€ment of the rat in
had holder of the slcrcotaxic i6Euincol Thc teth w@
tooth reslraining devicc, without
up and
offic aninal
xic itrEumcnt ro hold rr ngidly in a firen horiz,ntal
(Swanson, lJ93; Paxinos
extemat auditory
male
Canada)
lroc?dure to .nsur. $cptic surgcrv Th. head
slereot
posirioD so lhat thc
ard w€re attached io
tnduttia! Inc.,
doM in a v€nical
&c
then position€d
$c
h he
over-tidtoitrg to avoid €sry rolatior ofthe skull
A dro! ofsleril€ saline solution into
each evc wa,s
pla!€d ro prevot
clded $,ilh
it fiom drln.ss duing
the Pc-€dure
disinf€ctanl of a combination of
St!t1 Povidociodine,
ud
ed tho
incision aft3 wrs
fircc diffd€dt solutioN (Baoti'
70% .lcohoD The incisior was made doM tb.
midline of the scalp in a shgle shoke lsing a [email protected] scalP.l The hola, for the
el€.lrodes wde then driled do*T thlough the skuu bas€d on th€ coordilates as
descdbed above. Thc
hols for thc
Sround
wi.. ed jewelcr
[email protected] Tfte ele-clrod6 w.rc implantcd into
skull wilh
head€p
jwel.r's
s$ews. Th.
c{Ddor dd
scrcws
lh. anygdala ed
w€r
also
s€cuted to lhc
dlhcnol lins wse caretully iis€n d inlo
lhe [email protected] assembly w&5 6xed to
ihe
th. skull by iledbl
acrylic cem€nt (Kelly, 1998).
The mls wde allowcd 10-12 days postopdative recc{ery
bcin. Ihc .dmls werc hous.d singly
during lh€ catirc
b.fd€ Ktrdling th€ir
lqiod of th. studv lo
avoid dmage to thc h€adcap. The el€ctioal kindling studies were releat.d twice.
The
fnt expdmsll
the ssond
st
was se1 to condlcl1b€ €lectoPh]siological shdies,
whel$
wa! run for qRT-PCR analysis of BDNF followitrg the treaheni
with isoxyliton€s *here the "Tr.{t€d GrouP" r€ceiv.d isoxvlitonc 30 d8/kg
l€arl 40-50 min bcfore cl.ctricrl stimulation was done.
folLowcd for both scts of€xpedmeds arc highliSllcd
i
Tll. tatllent
sec
at
rcgimer
Table 3.
rhBhold (A.DT) was delemi!€d in Bch
delivqing a 2-3
i+
arnygdala bv
60-Hz siG wave sLibulw of lrogressively inBeaing
34
iniensity (25,50, 75, 100, 150,200,250, 300
ADT
ra,
hou!€d in
triggqed (Mclntyr. &
!
Pld!
ed
500
!A) of
lhe qnftnt
util
an
Duing [email protected] the Bte *crc
1993).
olea. pl€xiglass ch4mber and the eleatrodes wer. coNected tbrcugh a
comulalor (model SL3q Phrtis Oft) to
a Modcl
lsRX Physioddi Anplificr
system {Crass tn6Fuments. Astro-Med Inc.,
wdicL
RD N depict.d in Fi8lre 4
Thc mts w€rE stimulated onc. a dsy cvcry dly until six gcqer.lizld st!8c
5
coNdsions w€re elicited. Thc procedu! took 11 + 2 days for €l€ctrical khdlins
in $e .ats to reach inilial stag€ 5 seizu.. After hrce @$€outive d.ailv staS!
s€izur€s havc occuned, lhe animals were crnsider.d
ed duation
Seirue sever;ty
For eah stmulation,
tuly
5
G€rmanen v) kirdhn.
were r€cordcd daily durins the
afts dischtree dulation (ADD) war
kidling ac4uisilion
also [email protected] in thc
form of EEC reco.dings. The dala werc digitized and rocordcd usins PoIvVIEW
Data Acquisition
&
Analysis Systm
soft{@
(Grass lnstro$enls; AstrGMed,
Inc.) 10 motilor the lrosession of th. e?ilePtcBe!€s:s. TI|e b€hlvid of tha
minals was also monitorcd on tle five ?oinis mtrng scale
as
dscrib€d bv F"acin€
(R!cine,1972b).
Thc
b6h sanpls
th. s@nd scl
for qRT-PCR for BDNF expr*sion were coll@ted al the
oftle
exlelimcnt. TlE
einds
were eesthenred
4d of
wifi ketanine-
domitor combiMtion as desmb€d above ajld then pertuled tltrouCb he herrt wiIn
60 mL an ioecold
lrtificial CSF (ACSF) solution in which the sodiun ion
rcplaced by choline ion [dE
Acs[
@nlained (in
is
mM: cnolinc cl, I l0; NaHrPO.
35
Elecuical Stimulat ion in Anlgdala
Stimulation in
l0 mgAe
Llcct.ical KindlinS
(B)
Table
ror i,
3: Two sels of el.clric.l kidling . n ood.Lt of t.ts w.rc develop'd
riD rtudies or botylilorcs. A; conrrcl and kindled gmrps dcleloped lbr
vohagc-gared $dium channeh inhibition and dosc{esponsc slud} ofisoxvliton.s
f;;D. A conlrcl Eroup (sbam) of rals ws inplanled bur never kindled and an
.apcimmot Eroup $as kindled l0 days after the sugery. B; lhc aninal CrouPs
developed ro srudy lhc cllecis oiisoxylibnes on BDNF mRNA exprcsion in lhe
of
tr@tcd with 30 nSAg
cor1ical re8ion in {hich the lhird grouP
isor\lilones40 minutcs pnor to Siving fte eledrical $imutus for kindlins.
t
ss
ip
.16
1.2;
KCl, 2.5; Nat{CO3, 25; Mgclr, 7i Caclr, 0.5; Na p)ovater 2.4i D-Glucose,
20; L-scorbnte, 1.31 (as prwiously described in Mclngre et
dl,
2002). 1rl€ brain
sdplcs rcrc removed hom fte admals ald immedlaicly !)aocd in pre-coold (at
80 oC) isopcnbne solution to .void
dy
Tle sarnplB wer€ thm storcd al -80
oC for
studies, rhe brain
isolate-d i.e,
supls
nucl.ase rclei!€ and RNA desEd.tion.
n'iher proc.ssing. For pa..rt chmpinB
6om lhe fiBt set of
qpdinols (fablc 3-A) ww
tom lhe sham .a!s or ftom lhose which
aUowed ,o recover for a minimum
had beeD tully kindled
of 2 weexs afr€r the lslt seiare in order.o
rccovlr.d tom the acute eflccts of
assure that ihc kindlcd rats had
ald
scirc.
oD
lhe day of recordin& mls wEr. d@ply aaacstheti?ld wilh Ketamine-domilor
conbimrioa and Den psfured $rcugh rhe hend witr 60 Dl
e iFclld artifcid
CsI solution (ACSF) solution containins sM€ conlosition a,
Afrer pe.tusion, thc bBin
lru
d€scribed above.
rapidy €moved and sliced @onally lsing a
cC for 30 Ein
Viblooome (400-pm-thick s€ctims).Ihc slices wd€ incubated at 37
ed rhd
sltEequentty hoved lo th.
roon-tqn?dlhft
(22 oC) blirr for
!t L$r
45
minutcs. Slicitrg. incubation tud storage we{e all pqfomod in the choliGACSF
solut'on. Thc Riryer's solulion used during €lectrical recordings
wd similar to the
choline-AscF solunon except that asoorbate md lyruvare were renoved,
equimold NaCl rcplaced the cholinc Cl
mcrnFatiolL CaCl, w.s also
!ns{i
inhibilory post-sFaptic cunent
(n
at
I
dd
MgSO. was used
in
I
ttlM
mM in order to slow lhc Dirianre
PSC) frequcmy
All $Iutions werc maintliftd
31
Fig re ,l: Th. Spr.gu. Dawl€y (SD) nls (CbtrtA River' Canid.) uscd for
electricd kindlibg bod.l of €pileptog€trBis. Thc dimah \rerc implamed silh
r\\o bipolar
slifrulatine,/ r€co.ding elcdrodes bilaterally
in he
bNolatcral
anr\edalo and holscd individually in cages lo avoid dama8e to lhc headcap For
clccrical nimulalion and .ecordinSs. lhc rals sere housed
chlmbcr ond lhc elcclrodcs$crc con.ecrcd thlough
a
i"
a clcar plexiSla$
commutarorro an AmPlifier
i8
at
!H
7-4 ald bubbled
$,ifl
5o/o
CO2/95% 02 (ca'bogea) a. all tim€s duirs th€
Id0unohistochembtry GUC):
2.1.5.
Imuohistochemistr/ oHC)
canied
ou1 by 1he
ed inasc analyses for
cl$
ed
BDNF
ww
method described b€]os.
2.1.5.1,IHC for c-Fos rnd BDNF:
Bmin
sddq toln chemic.3lly kindlcd mi€ (as d€s.rib.d abov.) w€tE cluected
inmediately !ft€r the last lr€dmc||! of eimals with PTZ as describ€d in
d/., 201
l. Mic.
50 mL solutioD
were deeply
@ ainiry
dcsth.riad
and
Sinje
tr.ts@dially perfined with
pnosphrte bufi€r s.linc (PBS)
ad he?din
[1
ar
i@ld
dL
(5000
l.U.) of hepdiD added for 500 mL of PBSI. Bmins wcrc r€noved fiom c?nial
€vity dd imedinely stoed at -80 'C for latcr RT-PCR
edys
For IHC
earysq, the bl"io smpls wcrE gcndy ri$cd in cold PBS beforc fixins rhm itr
ice cold 4 % p@formaldehydc solution for 24 l)I at 4 "C. Thse suPles *ere
thd llac€d itr a cryoprotecrsl i.c.
30% su$ose in PBS
util
th€y sank io the
bottom of the corlliner. The sa$llcs wer€ subs.quently ltor€d al -80 "C unlil
Cryosbr st8itlal sections were preparen by using stedard techniques, as dercribed
beforc (Scharfinan, et a1.,2002i
ksek, er at, 2004). Using
cryosi.at (Thermo
39
Electron Corloratio4 UK), ftozen brain sections of3o-Fn thiclmes were cut al
-20'C and couelted dir€ctiy
otr
poly-lysine coated slides
ud
stor€d ar
-80'C until
tudher procesing. At the tine ofFoccssing, the clyosections eere k.pt ovmiSht
in a humid chmbd at rcom tempemture contaidrg PBS buffo. C@ w.s talcn
so that thc slid€
havirg cttosecdoN do6
lhc following day, the sections
*.r!
noa
comc in di@t @Dtacl
ryirge filte. of
0.45
PBS.
Or
re-hydden by rising lhree timas
mntrinse) widr PBS buffer, follow€d by incubation
filtered wiih
*itl
tM
i!
(5
blockirs solution (pre-
sizo, co$isting
of 2% bovine
serum
albunin (BSA), 2% normal goat serum and 0.1% T$een'20) fo.30 nin at 37 cC.
For c-Fos IHC, lhe s€ctions were incubated ov.night at 4'C with the c-Fos
primary etibody se52 rabbir tDlyclonal IgC (l:700 dilution in blocking solution)
hom Sania Cruz Biore.hnolos lnc. (CA USA).
Follwils oveBisht
incubation
in thc primary dtibody, seclions werc wabed tluec tin€s in PBS and lhen wc.€
iocubal:d with s@ndary stibody, i.c.
s€.ondary anlibody
Aleu
Fluo.@ 546 goal
(trl00 dilution) from Invitos$ (Life
stirabbit IgC
Technolosies, NY,
USA) for 30 min a! 37'C in lhe da!k, followed by a fnal wdhin8 step with PBS.
Negalile conliol slides werc !rc!a!!d without primary utibody to rule oul the
nonlpecific tissue binding ofantibodier. The slaiffd s@tioB
wft ohw€d ud6
fluoresc€nl mj.aoscope o\likon ECLIPSE TE2000-S, Japa!). The iMses lver€
epturcd
dd ptl)c$ed
by
uing popricLly softw&e supplied by
Nii@n- Similtr
proccs w6 cdi€d out for BDNF IHC cxcept dal lhe p.inary antibody ucd wes
40
BDNF (N-20) prim&y
etiMy
sc-546
nbbil IgG purohls€d fiom Ssda
Cruz
Biotechnology lnc. (CA, USA).
2.1,5.2.
Inage Amlysi!:
'Ilte schematic diagrans of bratu s€ctioff ldlpkn fion thc mous. bnin ad6
(F.akrin ud Paxinos, 199?)
wft
used as
. vitual g
de
fd
dclcrmia,ng the sub-
neion bouddies. The image lroc.ssing P.ogram Inag€J (Nrtional Instibtes of
He.al$, MD, USA) was used ro analyze the
nuuiple imaSirg
s)5td
dala comparisoos,
im8s.
This softwrE helps in
tlkirg de$ity
(ddEitomer.v) in
coBiddariotr (Collins, 200?). For €ach ima€e, backgoud
detemined
ad
dsitv
war
subtnct€d; the rEmaining particles were considered lo represenl c-
Fos or BDNF .xpr€ssion. Data werc obtahed Aom $vo seclioB P€r ral (n=12
uitrtals
pd
Srou!) and
pMted
as
m€4 +
S.E
M.
irnunor€aclivity in $e amygdal4 conex, dorsal hi!!o.3mpu
ced€r€d approximately
hippocampu r.gior!
sub'Egio6 CA
c_Fos
or
BDNF
and thalamus w€re
doud 3 6 mm Posterio. to bngrna Vitlrin fte
matllmsts we
p.rfomed over the laver eximding fiom
l{A3.
2.1,6. Reverse Trrnscriptase-Polymerr!€ Chsin R€.ction (RT-PCR)
Analysis for c-/or nRNA Expre$ior:
For
c-l6 mRNA aoalys4
latrtl
tb€ rc8ions of intdest GOD i €. Basol.! ..1
division of lhc c€nt"l nuclcus of anygdala
ed
dvgdal4
mcdial divisi@ of $e
4l
ccntd luclcus of amygdrt., cxicod.d !€giotr frdu CAI-CA3
hip!o..mpu5, cort
x
too
thc
ard do6sl hlani g.dcdalc Nclcus of thdrnus,
ccnrtomcdid uclcus of rh.alamus md p0rNedrricrnar noclcu of rhallmos, was
diss.crcd out from
rhc PcR
och soup ofnicc (six
'n;id. fro6.{ch
Eoup)
!!dysi!.
Thc stbpl€s ecE
bomogcnizcd
by usirg
ULTnA-TURX
homos.oiz.r (Nc€gc.a IKA@WER(q G.rbrry). Totrl RNA
nom
rh6.
ac{arding to
r.sioDs by usirg RNc.slO
XO
w$
tissuo
isolatcd
Miri Kii (Qissca Hildcq c.tlnrny)
fic monufsonltds ilsrrilctioos. 'ftc isohtld RNA srnples 0-2 lll,)
wcrc dilsolvcd
i! RNse-t!.
}Jat r
b a ntio of l:200
.d rr.r
|[c conccnhtioD and purity by takhg thc sbsort8m. !. 260
Uvikon spectrophotom.rcr (Shilnadzu, Kyo.o, hp!n).
260
ud usld fo!
uscd io mclrur€
!d
280
Ar .!6orbanc, of I
ffi
unit
d
lrn con6ponds to 40 pg of RNA pcr mL (A260 = I = 40 llg n[).'nrc
con@Eltion of th. RNA srmplc $,at calouLied by nultiplying the .t6oftec.
260
on
[m wirh th. dilution fa.tor
i.c. 40 lrg
I mL. Ncxt,
rh€
!t
tobl RNA yicld w!!
c.icllla(d by rnultiplyilg lbc comcrlltioD of ihc RNA with thc volume of
the
smpl6 in miUilitls. Th. purity of rotal RNA l[!s cdcuhted wi r lfc rlrio of
,4.260:A260. Thc
smpl. wa m.sid.r.d
0.15 was obbitrcd;
Ie elo tu 4250/A280 tltio of 2.0 +
vrddio[s ouilide thi! tugE w€i€ g€n€r"Iy colsidcrld
cooraniori.d. Tbc rcmaininS srmllcc
cpp.odorf
n$6 ud
of
ro bc
isolarcd RNA wcr6 aliquot inlo
storcd rt -80"C for laalr !se.
42
For
fillt
st?nd oDNA synthesis, rtre lorat RNA of 0.8-1.0 pg was ratln fiorn each
g.oup .nd
wd r4.$.-transqibed into fi$l sred
CDNA using supcrsc&lm
II
Fisl Sr&d S)n$€ss KiL &om trvitrogen (LiIe Telhnologics, uSA), otigo{dl)
lrine$
and Moloney Murine If,ukernia Virus
(MMLU RT (200 uirs) ac.ddi,s
to the mdufactur€r's irstructios. A ncgdivc coulrol
16
also pr.pared for e3ch
iotal RNA snlnplc in whioh dte reve6€ rranscriptase enzyme
of|Ie
ws
dd
resl
stcp for PCR anplificalim
dd
omitred
procedure was same.
Otr@ the CDNA wa! P|lpde4
lfc nen
qualtificrtion was crded o!t. The RT-PCR was perfom.d ushg Umnal cyctq
rh$ mplryhg thc cDNA
rernplale in a rcactiotr
sixrue conr.ining lx PcR
butrer (codaining dirhiorjrcitol DTT), dNIPs, Msct2, priners (sere
atrtiscc)
ed
laq DNA polynensc io PCR 02-mL thin-wall.d tubes. The
sequde for c-fos
noN
National Cenler
for
gene specifio
usinS th.
lriates
16
sedch.-d by Dsing the
Biotechnology Inlormation
Ottp/'w.ncbi.nlmnih.gov). Ibe found
priod
ed
!rin..3
CNCBD
sequeoce was u!€d
ry.o4.0)
datsbase
for desigDirg lhe
$ft*.rc proge
(http:/,$w.nodo.wi.mil.edq opj,right of whith€d Isrirutc for Bionedical
Resealch). The prime.s were syfthesized by Bio Basic Inc. (Carada). A
laft of
gycedldehyde3-phosphat€ d€hydrogenale (GAPDID primers (Integrated DNA
T..bnology, Inc., USA) yis Lsed
a e irrebal st nd,ald.
T!€ scqudc€s of @ch
p.imd / oligooulcotide !r€ list€d in Table 4. Ut to 40 cyctes werc run for ech
43
5:AAGTACTCjCACCCCCCACTA.]'
5'-CCAGTCAACACCATCAGCAA.S'
s'-GGAAAGCTGTCGCGTCATCG.3'
5'-GTAOCCCATCAGGTCCACCA-3'
Trble 4: Prine. sequeN.! used for cy'o6 ERNA t.rlysis. F. FoNdd pnmer:
readioD mixturo. Optimi?alion
of c-lor ed
prind
cAPDH-sp€cific
wss
p€rfom€d with setdate runs by varying magnesium chloride and priDer
concentndonsi
moul of cDNA template dd
p.imdB. TIe prcpa&d PCR products
elecLrophoresis. Ethidium
ealyzrd
or
1%
lg!re
W
udc.
liglt. DNA sbndard (Ccn RderTM
DNA Ladder, F€nnen|as Life Scien@s. N(rlyland, USA) and
products wele loadcd in
visualial
8el
bronde (1.5 FL) was added nto de gel for 6e
dctcction of spe.ific bands of DNA
100 bp
wft
anoealin8 lenp€ratuF for the
qch well. Afle! conplctc
M,
i0-r[
PCR
&c gel @3 remoaed and
uds tlv trrclMinq@@ hd phologmlhed
uring Gcl-Ds systm
(Alpha Imolech, CA, USA). Al1er el@lrolhoresis, the densiry of each band was
quetified using Spot Density Tools of lhe C€l-D@ system ior @nparison
purpces. The inlegrated
dsity
nomalized to thal of GA?DH lroduct.
by taljng
.
two
diD$ional
Lhough the coEesponding
of c-fos lroduot for ach sdple ws
valuc
fte
ar@ of e{ch baud. The ddsiq, \€luc
w6
obtahed
lael ifiersity.
2.1.1. volt^ge-gated Sodium Chatrnel
Study oI Isorylitor€s
deruiry of each bdd was qudlilied
I't
I
ibitiotr 3nd Dff€-Response
ivo:
Brain dices colteoted after the first set of electric kindling experineDt
d€scnb€d above
h
(d
Tabie 3A) were $scd !o evaluale the elleds of isorylitoncs on
voltagogat d sodiun
cl@els ed to
deldin
the dos&repoN
(ipsiLateral & conlralateral) and coDtrol oeils Dsing the voltage clam!
io kindlcd
protocol.
.-
To study thc eff@ts of isoxylitones on
patch electrode,
w@ pulled from
mmbme exoitability dd lM inhibilio!,
borosilicate glass aPill&ies usirg a Suttq
(Novato, CA) P-97 puller and were hea!-polished b€fole use lhe pipcttes wa€
filed wirh CsCl el@t
odc solution having a
mPES, loi Na,-EDTA, I
comlGition (ir !lM): CsCl,
145; Na_
and Glucose, 29 (295-305 mosm, pH 7 3-7 4).
All lhe
solutions used in patch olampine and ehrtJophysiology studi€s w€re prepar€d
H,O having
Bistsce of 18 MA.d-
Thc
aistalce of lhc el@trodes |lled t"s
n
5
8 MO. Recordinss ftom cortical neuones (pyamidal and intemeurons) wde
pdfortDe{l both in @!Eol rnd kildled brain slices with
wifi
e
EPC-9I2 eplilie.
datn acquisition and amlysis
w@
Elektlonik, LmbrechrPfalz,
Gemdy) In lhe kindled
p€rfonned
od
Pulsc and Pulscfit Greka
rats, rcordings wde
(CLS)
!€rform.d in the conex of both th€ ipsila@ral (IPS) ,nd @trFalaleral
henislberes rclativo lo the uygdala which
wa kindlcd ln aI @rdin8!, s.tis
fesistance compesation was perfom€d. The acc€ss resistance wa! < 20 MO
@dpensarcd by
dd
75 80%. All the dPerimmts wee p.rfoded.t thc @ rolled
t€mpemtur€ of32'C and the patch clmP rig setuP is shovt in Figue 5
visud idcniification of individual
corkdl oplis (Dod!
ncutons
Zeiss, J€na,
wd
done bv
uiry
G€rndy) otr a modified
differ.nthl Phale
Zeiss AxioscoPe
nicroscope in m uprigh! position. Volt&ge-clam! protocol wa! used
fte
volrage-gated
slored
cune
a! l0nM srock in
i
oDd lhe excilability
100%
1o
moniior
oflhc cells lhe isoxvlilons
DMso d 4'c md w.s diluted 6 required
was
Figurc 5: Th. prach chnP rig s.ftrp ut.d for .l..trcPtFloloA/ sludi.r
,t
The conirol recordings wcre
dsired
t$t
(codlosition
d
tle
before thc slices werc p€rfts.d with
compound ooncenLntion prepded
in the oxGmal Rrnger solulion
ddqibed above). At leNt 5-8 rlin w4 allowed to set up the
equilibriun afrer perfiEion
c€ll. The cffects ofrhe
the peak
!.dorned
t*r
ed
the
r€.!rdi4s were performed
again otr
$e
same
compound isoxylilotrG wqc cilcolalcd by mnualizing
culMt dplitudc during a blief depolariarion in tlc ptl:me of
conpoud wilh the larSest inwed curot in the control
responsc.
llle
the
dos€-
rslonse crrve w4 delemined by obsedilg tle lerccnlage bhibition oflNr by
isoxylitones at
ditrerqt
dosage levols
r.sporse relationshils werc fined
b
a
uing
tc
same proto.ol. Conc€ntrarion-
togistic filnction ro catcutale $c
IC!
vatu€s
ofisoxTlitones bolh in cortol md kildled eimah. Data fitrir8 was perfomed by
using Orisin 6.0 sralhin8
ud
dara anatysis
softwde (Origintab, MA, USA).
2.1.8, Morphology RecotrltrucrioD and
To sludy
C€
Image Analysi!:
ed vqiry ite tyle of celb from which tE recdduigs wqe odaine4
the
mo.!holo$/ and rhe l@tion of ine c€lls in the slices were dc&rmircd for ach
rccordng using confocal micloscopy. This w&s ac@mplisheij
by hcluding 0.2%
Eioqlin (Signa-Ald.ich, Oakville, Ceada) in the porch
b€ir
0.
sli@s wqe fixed in ldafomsldebyde solution (4
clecEode solution. The
9/o
pdafomaldehy.lc in
I % pnosphale bDffo) for 5-7 dnys. .Ite seclions were then
washen for
PBS foiiowed by a 30
nin rinlc ir PBS-TX ard
90
15
min in
nin incubarion h strEravidin_
48
conjDSated
lemperatuc.
Alep
An
r rinsing in PB-TX for 30 min, lhe stics
ror vicwins on a @nfocal nicros{rpe with
were acquircd
in
20X (N.A.
-
al,
0.50) obje.riv€.
od rt. imagq
2.1.9. Qusntitrtive Real
rnasa
ed
.surpaes
rhen
mode"
pnbtished ncriodotos/
2010). Backgrcud &orn each chann€t
contuast enhmemctrt
room
nounren o! slidq
Fneenl Tl@. .Eary 3D" nodulc in
Zrich, Seirzdlbd) eordiag to rbc
(Calrilovici er
ChaiD
a
wft
Volociry soft"@ (Inprovisioa LexinSton, MA)
process€d with Imaris
(Bitplane,
at
Fler-594 (5rgml; Mole.uld ?robes)
ws
subrracted for
wcrc brighrened while avoiding saruarion.
Tiee Reverse
Traoscriptase-polymere!€
R$ctior (qRT-pCR) Aftlysis for BDNI Erpreslion;
The bEin $mples @Uccl€d an
.
(a sho'u in Table 38) werc
pro@sed for RNA jsolarion
rhe sccotrd set of cl@&icat kindling
ed
qperimerls
qRT-pCR fo.
BDNF nRNA exp.ession_ The RNA isolat'on for toral BDNF ard iodividuat
BDNF &lscrilrs qRT-pCR was psfomed uinS a @mbilalion of Trialo
Eod
Qiagen column neftods. The c-orricat region ofeach bmin ssmpte
|nc
prcsq€ of dly ice ro lrevor rte
wirh T.izolo
(tDI ler
isolated with RN€asyo
1|s dissecr.d in
tissue liom rhawjng. The iissues werc lysed
50-100 mg of tissue) from rnvilrogen
Slin
columns (eiag.n, Ontdio, cana&).
dd
RNA wa
.fte procdw
lbr RNA isolation with Tnzolo a:rd RNeasyo spir corumns
was perrormed
specified by Qiago. On-.otumn DNase
t
ean1lenl for RNA puificerion
ws
pertonned using RNase-Fre€ DNas€
sero f.om eiagen (onraidng 1500
as
aiso
Kuitz
49
unils
of lyophilizd
concenlration
DNas€
l,
Buffer RDD
dd
RNdelreo water). RNA
and purity was conlrned wiL\
i
Nano-Drop 2000
sp€ctophobn€ter (Thrmo Scientific, Wilnilgtoq DE, USA)
ed
thc integrity was
visurliz€d by running lh€ sampls otr l% agarose geh as shom in Fig!rc 6.
fte
yicld of hishly puified RNA obtaincd (426014280 n1io of 2.0 + 0.1)
was
calctlated
&
be b€tweetr 0.5-
I !g
p€r mg of tissue. The samples wcre nored at -
80'C fof fi6t stred oDNA synihesis
The isolat€d RNA
(ltg)
for Supersqiptfl
III
ed
BDNF qPCR nalysis.
was revdse rrmcribcd using rhe prorocol and r€agena
RT (Lifc T€chologi€s, Budington, Cdada).
volme of 20 tll ofcDNA roixtue, conrainhg
dNT?s (0.5 mm
0.05
Im
@h of dAT?, dTT?,
DTT, 2 U ofRNae OL|Io,
w6 Ned for mplification ofDNA.
usins a G€neAmp PCR Sys&m
5 min @ 25
the
'C folowed by
50
dCT?,
ed
300 ng ofrandom p.ime6, 0.5
dd
200 U ot
dCT?),
l
r fr$-st dd
The following themal prcfitc
nin incub.tion @
15 min.
Im
buffer,
Slpdsc.ilt ]]]o (MMLV RT),
ao (Apllied Bios'slcms)
rsction by heating @ ?0C for
TI. lnal
50
'C
w6
followed
machine; incubanon for
and finally inactivaring
I !g ofRNA ws trsled
ac.ording
10
Oe same protocol with the addirio! of water instead of the RT enzyme (.no RT"
control). The final concenFation
of the CDNA was 50 ng of rotal
RNA
€quivalcrl/ul-. RBI rim€ PCR for tolal BDNF and individuat BDNF rznscrilis
wai pe.fomed
h
the Straragerc tD(3000p Oa Joll4 CA) using
rc
DNA biod'ng
dye SYBR c.€en (Platinm SYBR cr@n qpCR SulerMix_UDCo, Invilrogo)
50
which is a r€dy-tcuse cockail containing
mpliicalior dd
detection
of DNA
n
al compdcnts,
exc€pt
prim6,
for the
real-nme qPCR The prim€s for lotal
BDNF were desisned usins Primer 3 software (],,ICBI) from th€ rat BDNI coding
sequence
(*on txi
Acc€$ion Numbds NM_012513.3). Sinilely, for
anplificalion of individual Ft BDNF traridiprs, rhe !eve6. pdnd (.a@on for
all lhe individual Irmcripts exalnined) from lhe BDNF coding rcsion was use4
ed, fo. fodtud
prime6, rhe sequcnce
ws
tsken
fton rie
upstr€@
sy
coEeslonding exon of lhe hanlcript. The primes wcre ch@ked for
crcs-
reactivity prior to use by using lhe BLAST lool ofNCBl. Rat !-aclin was us€d
a rctercnce siandard
no1
to
rcmdire
tno BDNF
valu6 h all smpleq
6
irs
s
laels do
chmge wiih kindling.
Tlc
p.iEs
ud
Oligo SFthesis Facilily at McMaltd Univdsity, HMilton ON, Ceada).
wq€ syntheiad and puct 5€d tom MOBIX Lab @NA Segucnciry
The p.iners used for BDNF ealysis are lisled in Table
5. The prim€r
sequer@s
for P-aclin were ued as followsr fonard priner, 5'AGc CAT GTA CCT AGC
CAT CC 3'; rwe6e
prind, 5' CTC TCA GCT CTC OTC
size. 228 bp. The final volume
300 nM eacit
fovdd
GTG AA 3;
lrodrct
of20 ul PCR mix @ntained lX qPCR SupeiMii,
and rcve$e primc.s fof all tdgets, 30 nM ROX reference
dye (Sh.bgene), and CDNA from 50 ng of RNA. Cdc was ral(en to ninimize the
exposuo of SIIBR Gr€en
ud ROX to dir€ct light to avoid the los of
sigral inlcnsity. Levels of BDNI
ud
Iluorcs@nr
tsacrin ye.e detemined using absotute
5l
quantification. Slandards
fot BDNF and Factin
qPCR were prepared from
puifi€d PCR products obtahcd by nonnal PCR using fte GercAmP ?CR Svsl€n
(Applied Biosyst ms). The PCR prcducts for st Dd,rd deation werc
':am
1.8
M
on
% agarose seL (Figurc 68) and ficn €xtractei and purified uting th€ Minflulc
Cel E{traction Kit (Qiagdr) according to lh. manufactucr's ?rolocol'
Tle
purified PCR Product! wor. qu4tificd using thc
_80'C for
sp@trophoto6.Gr and storcd in lo8/Fl aliquols at
For
quotifi€tion by qPC&
irth€!
Nam_drop
u'ec
a "no tcmtlatc" contol, ehich consisrcd
in qPCR
ofal
lhc
@g€nts lisred abovc for r€d-timc PcR cxcept lh€ CDNA k|nplat4 r€Plac€d with
wlter, wd dso
we@ run
ad<ted.
All untm*h
in t iplicatc.
run in trilliet€ with six lGfold
I
odv experimdts with
ed a PcR cfrcidcy
p.ofil€
ws
,td 'llo t'!o!late" cottrols
Standards wcre also
dilutions i-e. starling frotrl I pg lo
0.990
samPles, "oo R1"',
us€d for BDNF
ag. For analvsis,
bctwc.n 9G100
!!d Fadin:2
vo
'nia
Perc
s'd
-R
'>
Th' foucfling lhelnd
at 50oC' 2 min at 95'C followed bv
cuve
40 cyclcs of95"C for 30 s, 58'C for 30 s, and ?2"C f0.45 s. A dissociation
atur PCR was ldded to vcnry
**
expiess.d
s
tu!
flo s.xondatv Ploducls htd tomed Rdults
oopi4 / 50 nanoSrdns of lotal RNA Copv nmbcr for I pg of
each slarded was calculated as follows:
Copy
number=(l x
l0-r? / 660 x Product siz!) x 6.022
'
lo:l
(A)
(a)
b'od* (Al
8eb sbo*itrg RNA '!d DNA
ila;$se vl$arted to ch(r ne mr(grrr) roror Forarcd
''"r]i"Jrtre"'".ample. on ld. agarose Seh lB) Punfied D\A 'tan{tard
nr.ln r,r runninl
cc{and sepanad on r'E"" acar*e ceh rhe
ilned to be used 6 a standsd to qwti! uk'o{n
.innlcs h' rcdh'mc qPCR
Fisure 6r Rep.etrlrdve
.g.l@
i'rii"^
;;,:;;;;i"ild"suru
i;N;'.;";;;"iJ *i
Tn!|c pt
BDNF
hesqipt
Pdn.r S.qo.Ec.
I[
(F) 5' ATG CTT CAT TCA GCC CAG TT
(R) 5'
BDNF t1,3cript
Iv
Pmducl (bp)
ATI
3'
180
CAC GCT CIC CAC ACT CC 3'
(F) 5'AGA GCA C'CT CCC TTC ATc TT
3'
209
(R) 5' ATT CAC GCT CTC CAG AGT CC 3'
BDNF Lroscript VI (F) 5' AC,C AGC CTG ACA ACA ATG TC
(R)
BDNT
tdtic.ipt IX
5 ATI
(F) 5'
3
224
CAC GCI CIC CAG AOT CC 3'
ccc cCA CAT AAA AAG
ACT Gc
3'
238
(R) 5' GCC ACC CAA TrC TCr TTT TC 3'
Factitr
(F)5'AGCCATGTACGTAGCCATCC3,
228
(R) 5'CTC TCA GCT CTG GTC GTG AA 3'
Trblc 5r rcR pdn.r ..qrcm.!
rld
producr !116 ur.d for ro.rl BDNF, BDNF
lnBcripll. t 0-.cti. DRNA.lrlytir h nt cor!.r F, Fo
ud prirn€r; R,
ffi
54
2.2.1'
},',
2,2.1. CeI
STUDIES
Culturc oIRat Corticll Neurors:
R@dy to Use prinary nelllonal cells (El8; Cryocelh Ra.
Cryoplffi€d
gdmu
Conex)
w@
a
culturod
h
Im
35
Bnin
gifr of QBM Ccll Scicr@, Ottaw, Camda. Cells werc
c€ll cultue dishes coated with loly-D-Lysine (100 pe / r'1) of
noleculu weighl 70,000J50,000. Cells wcre grown at 37"C ia 5 % | 95% COll
O, in Neurobsal medim (lnvitrogen Life Techologi$, Buli!$on, cdtda)
sultlenented with 2 % 827 supplement,
and 100
2
rrM l-Clutamine onvitrogeq Canada)
U/dl Pdicillin-Strcptomyoin (lnvitlog€rr
twice a week. To incrcae ceU
thc nedia for the
swival
Canada). M€dia replenisbed
and reduce debris, 5 % FBS
wd
added to
fiFt 4 hom.
2.2.2. Patch Clamping and Electrophysiology Studi€s:
dd
Palch
cldp dd
action
ofisorfliiones were perforned using cultu.d rat brain @rtical neuo6.
electrolbysiolos/ sludi€ for dose-response
mehanism
of
2.2.2.1. VoltaCe-e red Sodium Chrnnel IDhibition 8nd Dose-Respo'se
Study of hoxylitones .lr viLo:
To study tne Na- cbannel inhibition and dose-respo$e
cultued cortical
Bing
rcum,
volag€ldp
cwe ol
whole cell palch-clep r@orditrgs
p.otocol
ed
AJ(opaeh-2008
dplifid
isoxyliiones in
wft
pedomed
(Axon LEEunents,
55
CA, USA). Cclls wqe groM for 10-14 days before boing plac€d
invcrted nicrcs@pe (Olympus IX70,
h
a stag€
of aD
Olymlu, Cdada Inc.). Onlinc ed omino
6ing pclmp Suit4 of
acquisitio! and analysis was perfomcd
prcgraG
(Moleculd Devices, lnc. UsA).
Parch pipettes were pulled and fue
lolished ftom thin-walled borosilicale gl4s
epilldis (wmd tstrunenis uitrg pipeft Pullq (Model
P_9?, Suncr
lnsirumml Co., USA) ihat had a resislans of 5-8 Mdr whon filled with KCI
piteoc soludon contajnins (in mNO
od
Mg-ATP
I
Kcl
145,
cacIr 0.3, Na,'EDTA 3, HEPES l0'
(pH = ?.3). Thc exlemal solution
fd
voltage
cldP r@rdings
contained (in nl\lt) NaCl 145, KCI 5, Cactz 2, MgCl, 2, Nd-tlEPES 10, elucoso
was kept in lhe @ge of295'300
10. TIIe osmolarity of
lhs€ solutiom
uing vapor plesue
osmomete! VAPRO 5520 (WESCOR Inc ).
sampled
al l0 KHz
sd
filtored at 5 KHz for dose-!€slonsc
vrir.o cleclrophysiology studies. TIE acclss
dd
reco.dings with
R
clamp
ai
dols
the
uing
a lag
of
100
sometimes ptoduced sodium
th€y would be €x!4te<l to
subsoquently depolarized by 10
It'gst
inward cment
ued
all subsequent
Series
t
resistde $as
rs. DdPito lhis @nPensation
sPace
cuents al membrane potentiab small€r
ndimal (mund '40 m\4
wqe idtially depolarizd to -40nV fom
Cure s were
rsislrn@ (R ) r4ged fiom 8-20 M!}
more than 25 lv{tt were nol
compensaled uP 1o 80 %
ed
nosm/tg
a
For this reaon ceus
holding Poldtial of-60 mV
ed $cn
mv !o mdinum of_20 mV The step causing ihe
ws Uet
used
6
the conLol sponso md all eponses
56
nomalizd to this rcspoNe for
were
be
les when the sodium cunent is
th€s€ lalios
will
a given recording. As
clmpinS enof would
suppressed in the presence of the
underestimate lhe pcrc€nlblock.
comlou4
All recordings were lerforned at
roon tenlelatu.e (23 + 2q).
Tle desired concotlation of lhe compoud w6 prepd€d jn the o!:temal solunon
dd
added
to the culbrc dish by p.!6l3ion. Al learr 5 min were allowed for
cquilibriu lrior
sde
to recordil8s.
All
conLrcl
nc slllemen(s
w6e pelfmed in the
cell prior ro the addilion of the compound. Ttc comlourd €trects wde
c6lculated by nomalizing the peak
cuddt dplitude dudng a b.iefdepoldiarior
in the presen@ of the compoud wi$ thc larg€sl inward cuneDt in rhe control
r6ponse. The ave.aged dal! w€re curve fined
equatior to dcremine the dosFicspoNe
Pnsm 5
(Grapfad Softwdc Inc.
b $e sbnded dose-respoce
cwe ed ICi of isoxytiroD* 6ine
La Jolla, USA) in tlle cultued conicrt
neuoN.
22.2.2. Efie.tt of Iloxylitor€3 on Sodium Charnet Rccovery fron
Cultued co.tical neurons i.e. pymidal
ed
intem€ljtoN
(d
were used to study rhe effeck of isoxyliror.s on recovcry
frcm inactivation ltate. To block $€ lotalsium cumnts
clrenl
(1NJa
EDTA I,
ed
described above)
oi sodi@ chmels
dd
isolare the sodium
pi!€tte solution containins (in mM) CaCl 145, Na-HETES lO, Nar
gluoose 29 (295-300 mosm/kg, pH = 7.3,?.4). To
btek
th€
calcim
57
owents the dish
ws
s
same conposition
continuously p€rfused with m extemal solution having
described above for
d utd
dose-mPonse sludy exoept
2 mM CaCl, was replaccd by 0.5 mM Niclr. A
(ICi
isoxylitones
of
200 NM
value in ctrltuted newons) was used in thse expdimcnts.
Two weks old cultued
d*nbed
concenbarion
ells w@
palched
i!
rle
voltag€
dmp
modc as
above- The lollowing iDactivationiecovery lulse prol&ol was used
which consisted of step depoluianon (3 ms) from -100 mV to -40 mv lo obiain
the maximum leak 1Nr cur.€nl (AmpJ
was done
step
rt
i
eNals
ed
next dother rest d€polarizalion stop
ofz,4,8, 16,20,30,40,50odll0mecafleftheiniiial
(AnpJ. TIE tactio. of thc 1N. @ov@d !t veious line points (AnpJ ws
cnlcdaM
as lhe
dio ofArpr/
Anp" bcforc and after tle conpoud applicalion.
This nUo was converted to lqcenrage using the following fomula:
% Reovery = (Amp, /
An!.) x
100
The data were averaged and % recovery was plotted oD y-axis against lhe
rcspecli!€ liDe on
x-dis ed
curve fired with a single dporendal equation
% Reoovcry =
The fining
!6
done BinS U€
46P'
s
"'-
soft"lre plckage
caued Origin 6.0 (Origir[ab,
MA. USA),
58
2.2.2.3. Effect!
of Isoxyliton€s on DevelopDent of Sodium Chatrnel
The study of actions
of norrlitones on $e develolment of
chm.l
sodium
inactivation was canied out in the sarne typ€ of cultur€d neumnal cc s and using
d
ll)€ smo physiological solurioG
dcsc.ibed abovc for rb€ srudy
of sodim
chal)llel inactivation-remvery.
The develolm.nl of
sodiu
inactivarion before (onrrol)
@lls witb 200 nM isoxTlitones (tr@rcd)
&d aftq pertusilg
ws dir@ily nearutld
the
by Ning a slow
voltage nmp inacl'vation-development pulse protocol in which celh were
hitially
hcld at "60 mV and $en the holding polenrial was slowly cheged by a
seri* of
vollage.omps (lating 240
the
N) ralgirg
nn! n tst pulsc of3 m
sodiu
fiom 100
nV to
-25 mV. At
to 0 mV was used !o d€t€minc the anplitude
sodiM cweot
@plitude
Po
.lN,
i.c.
for eeh sre! (PJ
@
P. forcontrol and
b fic
wd
ed
trsted curents Pr werc nmalized ro r*pcctlve
po
wa
of
oflie
wa
inwed
normalized to the r€spective !@k currmr
rol ()ljlMr mplitudes Pr werc nomalized ro fte
cell recordings Th€ percent P" /
po
Epetivc
tirr beated
catcutated, avaaged and rlara wero curve
funcrion of BoIzmaD €quation showing rhe rclalionshil betleem
volt ge (independdt vdiablo md
MimMl
end
cun€nt that could be &nvated. Tl€ leak inward sodim current (p,)
n€dured bolh for conlioi and reated rccordings independently,
fined
tie
clftnr (d€p6dor
vatirblc) drio 6ing ihe
Origin 6.0 software as follows;
59
P/Po = P! +
0'o+J / (l + exp (V" - Vr)
toPl-
lnitial amtlitude ofth€ sodium cunenr
v! =
cenler of tbe
The
/l)
ampftude for each Vn
cwe
.Ment amtlitude
values
4
for eaoh lost-dsg rrclred celt r€.ordirgs were
also nomalizcd to lhe respective pr€drug
o.der to show the % inhibitio! of IN.
subj€cted 10
t\e soc
IMiDum p€k curenr anltirude
comled lo conlrcl md
signoi.lal Boltzmd
fit lo obswc
po in
rhe dala w€rc
the effe.ls of
isoxylitones onthe dwclopmentof inacrivalion.
2.2.3. Qurntitative R€al Time Reven€ TnNcriDtss€-polymerase
Chah Reaction (qRT-PCR) Alalysis for Sodium chaDnel Atpha
Subunits:
The quanlilative RT-PCR for sodiun ion
]lE
chmels alpha subutriis was caried our
qRT-PCR a8lysis for rclarive abunda@
of various Na'
channet atpha
subuils w8s perfomed in culrured neuronal @lls. Fou diffuenr balchs of
cultured dishcs (tud
fou dishe Aoo
each batch) wcre sel@1ed for RNA isolation
and stored at -80qC iirm€diately afrer the el@trophysiological rccordings in rb€
cclls
wft
done.
Triale (lnvir.oge!)
I
oll
djsh was added
ed
altowed to sit for 5
60
ninutes prior to ph.se sepdation with cblorofom by @nldtugatron. Tlre
aqueous layer
wd $d
ronovcd caEtully
!!!d
&d RNA e?s p.ecilitated by
isoprcpaftl. The prccipitat€d pellet of RNA was washed twic€ ]riih cold 75%
alcohol. The pellor was ficD
fiilly dded using voouln to renove all lhe al@holic
@ntonts and re-suspmded
in
10-20
d of DE?c H1o. Th€ tolal RNA
conenkarion was d€termined usinS the NdGDrcp Sp.ctropholomcler ND-1000
(Nmodrc! Technologis Inc., Wilmitrglon, DE, USA). 'fte Opticzl Dssity 6tio
260/280 ofall smples
For CDNA sldnesis,
wa greter thd l
tle initial
9.
total RNA conc€ntrario! of 2 Fg of ach srm?le
was l]sed for .evo$e hanscription. The
liBl strdd
using the protocols tud rea€enls for Supe$cript
lI
CDNA
synthcsis
w6 sy
hesized by
Kt fton Invilrogen
Inc. (Lif€ Tehnolosies, Bllllingron, Camda). 'nle RNA
Carlada
reverse
trarscriplion wa! p€rformed using oliSo (dt) p.ime$ ard Superscriprn II RT (200
Dnib) according to the
contol)
w&s
'bufactlmt
.l!o lrepded 6
rhe .E&rion
mixrw
prcviously d€scribed. The
conraincd
tbc @nMtrarion
equival€.t/Fl of the templar€ which
20ngl FL
*ith
instructioDs. N€gative conlrol (No
wd
RI
fMl volMe of20 !l of
of
dilured ro the
100 ng total PNA
fn.l
cor@trarion of
Nuclease free water.
For qlantadvc PC& the
prim*
scB
wqe dsigrcd
b
produe
e
80,1t0 b!
mplicons !5ing the P.ima'BLAST primcr deigning iool ofNCBI darabde. The
6l
gcne-specific Fimers
ued *er. sy heizd by SiSrna-Gdosys (Sigha Lifc
Scjences, Celada). Trlc gndienl PCR analysis for all Prime$ dct
M.alng
remperat@
of 55
dined dlnt lhc
oltitdutr' Primc6 cfficiencv wd
oC was
uirg lhc std.l$d
cDNA at five lo'fold serial
s6sed
at thls tmlemhrc
dilutions
(100,10,l,01,001ns) and
@ing
on 2 % agdos. gel electroPhoBb 10 confutd thc ProdEt
prim6 wiih efficioci€s otly
analysis. MyiQ SYBR
reslted PcR producl w6 aisulized bv
re
betw@n 9G100% wcrc
Grea Supermi,{ (Bio-Rad) wa!
sid
The
scd for qu,'litalivc
used 10 make lhc PcR mix
200 nM of lhe
that contained the fina1 concenrdiotr of 20 ng of oDNA and
set.
lhcn
pnm"
mPlry DNA
Bio-R d MyiQ quantilative PCR (qPCR) aPpantus wd used lo
uing tlc folowing ihermal ptofilc:
3
Bb
at 95
'c
followed bv 40 cvclet of 5 s at
onlv one prodct had
95'C, 55qC for 30 s (two'slep protocol) To confiIm lhat
bv
fomed, ! dissociation plofile of tie PCR lroducls wd obtained
gradient runmng fiom 60 'C 10 95
All
samples were
6
qc
the
cros thc [Bhold (excf,ais backgoud level bv 20)
is
quantiiv of the
C, (cycle hrqhold)- C, is inverselv prolonional to the
targel nucleic acid in the smPle (rhe
loetr the C, level th€ grcater the qumtitv of
de
slrong Posrlve
ed indi€live of abundaot nRNA expression TlIe q
vahes for the
target nucleic acid in thc
readions
lcmpelatue
run in du9licates Tl|e numb€' of cvcles rcquircd fo'
fluorescent signal ro
defined
a
sanlle) The
samples with C' < 20
to nomalire
rofdence genc, synaptoPhvlin (A synaptic vesicL€ protein) were used
62
fic ex!rcssior of
the gens of
iniect. The s.quences of lhe priners u*d
enlisted in the Table 6. The data
Systcm Software 2.0
value,,
ed
ws
anelysed
cs
lsing the BiGRld MyiQ Optical
lhc cxlression lcv€ls st€ pfts.nied as nomaliz.i
}6
(CJ of the mXNA to !ha. of synaptophysitr. Tlis
diffcrcnce betw@n the C. of nf.rctrce gene
s
nomalizrd
q (CJ
for fie ref€r€nce gen. is
dd
the
c, of
gene
of inleftst rhat
values. T16 Cb is usuatly n%a.ivc becaus. th€ tht shold
uully
higler lhd the cycle fr.shold for lho genes of
r€.son for thk prsentation style is to better ilustrate the
ohdels
2.3. QoaDtitative and
q
cilculated as ihe
intcres!. NumbN 1hat are positive or less neg tivc indicaie higher exPrcssion.
abundmce of Oe Na'
arc
*Prsion
fte
and rclalivc
Present in the culhued rat brain codioal neuoDs
Statisticil Aralysis:
Dat! of seiaues acrivitv (seiauEs score) werE attdved bv noDlanmelric MamWhilney U tcsls. The dcaresponse dala of isoxylitotrs aad statislical analvsis
wclc p€rfomrcd by standdd dos€ response equdons using Microcal Origin 60
md GFphPad Prisn 5 softwet- The
study
of isoxylitones eff€ct!
cwe fitthg &
on stendy'state iMclivation of
perfom€d by singl€ exlonential equation md
Origitr 6.0
statistical analvt6 for lhe
Boltmm
sodim chmels wde
cquation usilg Microcal
$ft\r@. Tle crbr mRNA l4el5 in drhGnt Eearosl goups
analysed by
were
studmfs .-!est and ANOVA (using Bonfenont Por, ioc teso The
immuosrainirg data and BDNF mRNA analyses wcrc dorc bv onFwav ANOVA
63
Nrme
Producr(bp)
Prinersequotrce
N&l.l (SCNIA) (F)5
3
cGG CTC GGC ACA TGT TGT TCC TTA
ll0
(R) 5' GCT CCA TCT TGT CAT CCT C'cA CA 3'
Nal.2 (SCN2A) (F) 5' AAC CTG CAC TGGAGA CTG CTA cA
3'
95
(R) 5' ACC TCC TCC CGT AAG AAA GTG C 3'
N&1.3 (SCN3A) (F)
5 CTcAGAACACGAACCGGAGCCAT3
84
(R) 5' TCC CCC TTG CTT TCT CTG TGG AC 3'
Ns.t.6 (SCN8A) (F) 5. TCG ACA CICC GTA TTG CCG AGA G
(R) 5' CAG GTC ACI GTT TCG
Cfi
3.
IO4
GGG C 3'
N&I.? (SCNgA) (F) 5 cAG TCC TAC CCG TGA ACG GGA A
3
96
(R) 5'CATTGC OGA OCA TCA GC]G CIG A 3'
of volt'gegtted todium clrrrel
--rth
dphr ruburits nRNA studi€d itr crltorcd rtt corh"l retrrcN oltd for pltch chnP
i.d eleclroptysiolog/ sludis tt ,bo. F, Forwad pdner; R, revede !'iner
r, rcn pti*. *qu"..* f* lb. *'lv!i5
r-........--
wih rort ioc Tllcy ed
grsuF wih cot'ob).
Ddr drl$b coqili|ds t dr (ro coqa! thc
Pm A!4tb
od llllng Powe! !$d lrr.oidod
!o0er!
' 0mog lh. ncer w.(c o.Loldcd
15.
A[ d.L wa! ory.6!.d 8
fu BDlG.t !r..i!a Itr & IV s!.! c.ttid
rn
r
thc
(Biost t, USA). S.Strdi.l dlfer.occs
lrd
ofP < 0.05 ujry lS!
*lls vcrd6
+ S"B.llr.
65
CHAPTER3
RESALTS
66
3.1.
ln
3.1.1.
yivo STUDIES
Subcutlneo8 Pertylenotetrrzotelrduced Sein.€ Test (scPTzr
Iduced Acur€ Seinres Model):
'IlE 16r r!frpoljld isoxylitons cxhibitcd docerclated !rct@tion no4| ditremr
seiaue lanems of Plz-itrduced seizu.es
generalired seirue,
in the eimal
i... twitch6,
body
jqks,
clontrs rnd
group tr€ated with isoxylitones prior
administration of PTZ. Th€ E/Z isomcrio mixtulc of
1o
jsoxflitotrs w4 obsded io
eifeclivoly pr€ven! PTz-induced myoclonic twilches when tested at dl€ dose of t5
and 20
ne^& dd
howevq, it
incr€ating
ws uable
tie
latency to
fi$t
of seires threshold;
ro prcvidc complet. protection nom
ttr€shold (Table 7). Nevenhel$, rhc dose of 30
myocloDic
episode
twitchs but
also provid€d
PTZind@d
$izw
ng^g trot orly potected
rhe
crnpleie (l00yo) prote.tim aon mondity
&d PTzindu@d lo$ of ridling rcfld wiii bnic -forelimb dd rmic hitdlimb
seizures, which
wft
conpdable to that of the dia"lpam (7.5 nglgltrealed
g.oup. We also obseaed 100% morirlity in soPTZ cont ol grcu!,
Leated
with
15
wh€l4 dimals
ng/kg od 20 mg/tg of isoxylitonq exhibi,ted 33.30 bd
mortality, respeclively
(Iisue
20.8o/r
7).
3.1.2.1r viro Mod€ls of Epilep.ogenesi!:
The results of isoxylitones in bolh chcmicrl atd 6le.t
icil
models
ofkirdliry de
67
8
3
'V;
'::
E Fi
E
ei9
.id
?
go9
: N:
.- .:
i
.9\
:
i
E
I
499
.
aE
S
E
*
E
E
-Ft
EX@
g;E:
*:=i
;.!!,-g
F
E;
rP?($ na,ld
.El) ldtrd
!F? l.|'|m
. Gltr
bortrm
[5
r{rd + F?
ttid . FTI
(ll ii|lrd . PrZ
@
!
:
s
ft'imr
Ficurt ?: Mort litv
ti""i r"i"r,,t
tcut€ scPTZ
rccovins iso\vliton.r 15 and 20 mras
n
momlitv where$ st rrre dN ol ]0 mp4s
t.rli4 of isorylirotr'3 fo[o*itrg
ti."
*';ts
m.t *
"'i**u"'ji:
""0
""
r'ated Sroup'
exhibiled 0 % (i e.. 100 % prol€cdon) in lho
69
of EPilePtogencsis:
3.1J.1. scPTzlnduced Chenicsl Kirdling Modet
r€achi4 a tcore of 5 lfrer
A sndual increase in the seizur€ score 1|!s displavcn
mimals with d av'rage
l8 ireatneDts by the unlEaled scPTZ coNol grcup
seizure score
of49.
The
dieepm realed
grouP compded
contol grolP did not exhilit sny seizure pattern
proto{ol. Bded on
lh. lcslllr of
oory a 30 mgAg dos€
complele
lill
io the ?Tzkindled
lhc €nd of $o kindlllg
our Preaios exp'rimenls ir
{4
decid'd to
u*
of isoxllitones At lhis rest dose' isoxylitones exhibil€d
ifibition in the
development
of
kindling induc€d
grouPs
administntion (Fi8ue 8). Within th' Edmetn
te
'
bY
a
scPTZ
lhe isoxYlitoncs (EZ)
diffe'ence wa! obseded
and diazlpam-treated animals, no
mnnak ftom develoling fte s€'zur€s'
3.1,2.2,
The
Electricil lcndling Model of EpileptogeDsis:
dinsls in $e
kiDdted goup show'd Progresqilc
discharge duration (ADD)
s
shom in the Figue 9'
The fi$t fe{
(ADT)
as the lroc€ss of kindliry eroste$ed'
thr€shold
discharg€
ary behavioml and cleclical c'nsequencrs
srisulatrons wd€ gendsllv wilhour
iPsilate6l 10 the kindlisg eledrode
the
fusr
stimulatioE,
of
coupl€
Ana
'v'li'l
Tbe resgose lard on ws
alPlicalio!
stinularion
lhe
duing
began to closc
of the
movemcnts' and the lrogrersion
hobbing
head
ed
ch€wing
by
followed
tllat progres'iivelv became
ki.dling Provok d bilatdal forelinb clonus
$onger
70
+ FAtq*r@'dto.Yn
|-'./.
'-./LL
..-...?r-
t.,.'-L
//,1
Ur||$.r
of PtlZ
r--'r--r-f--r'1
T.l-m.!!
r. --1
kildllog The kindlinE
Figtrre 8: Effecl of isotyliloNs on scPT?itrdfted
eifimetic m€an I SEM The
$ores ofn = 12 / treatnent Sroup are expr€ssed as
oflhe kindling cxperjmenr'
isoxyliton.s did not exiibit s€irue score unlil th€ end
the bar undor the fi8uru- The rals
The imeline of fte .xpe.iments is represented bv
in rhe contol
\erc Siven PTZ G saline reatmcd on dldBte days Tlrc animals
pe'iod The
aller 18 doses *ere given during the 34-davs
Crorip sere fully kitdled
siEnificstlv hiSlEr aveGge se'z'iie scores
pcilive control kindled nts exhibn€d
rP < 0 05: sie'ilicantlv hider tbd
sbning fron the 5th injetion of PTZ onward
'll'e dimals
U l$ts
normal cotuiol relealed bv nonpanmetdc Mann-Mihev
\sc $crificed aner 14 dlvs and blnin $mples wcre colle'led for inmunosbinng
.nd
Rt-PcR.
1r
(A)
--."f nnfiritntrfrtffl nf r}ttiif||Ff^+-
tB)
(c)
f,EG
FigrR 9; Pmgr.*riv. d.Y'lopn'nt of
$iz
rc
r'livitv in iFnl'r'r'l dd'
rirdtlts' The amvsdal" -^ -t"Y :"':
*"*
o*t
-,
""tdd!wa5 Gcor'kd A i aner{i{hlrec tn8gereo o} i
"r,i ed
resporse
sfterdisch!rye
3
rs
Gponse $ar
nO,t"tt"tt) amvgdsl' NoG the lo* fte4uency
a.
of
",*rt "*. *O
tiigg'red ! inore complex rsponsa
stinulation
,"*"u ,- ,-* "*
r2u stimuraton
"t "txlh t'
respons' trisa'Ed bv
,u'u
;;;;;;;'"^
"o 'n'Note lhat the afiordisch! se w's conrnueo
'".
*"-sion
,n*"- ,i. 0's, **-t
tb
atur stlmuurons.veral $conds (56 25 s€')
12
wi 1 redins dd fallins. The animal!
aner
13
iD th€ kindle-d Broup
+ 2 el€ctri@l mygdala stimulations.
3.1.3. c-Fos lmmuDohistochenistry
ThN
b€lme tully kindled
0HC):
was lirde lo no c-Fos iromunorcativity in the
gloup wilrout
nlmal crdrol
group i.e.
my kindling- ltunuohistochdnical edys6 qealed that therc
was signifioant increase in the c-Fos proiein elpr€ssior in the bEin setions
Plz'kindled lositive conlrol
hippocanpal
miq
which
CAI ed CA2 .egiom (3.6
thalamu!, as compaled
1o
wd
'm
in
ccnts€d, larticulely,
pctdior to the
the cor€sponding ar€is of the nomal
of
the
breelna) and
bEi! (Iigure
104
b). Morcova, a relalively unifonn distrihution of c-Fos lrolein was fo'ind acros!
lll
oftbe @nical
lay6 wilhin
thc concx in this group, Howev6,
regions 1.8 mn loslerior io lhe b.egm! exhibiLd rclativdy
€xprcssion
bregrna.
whd compasd to the cortical sub-ngions
th€.oniol
las qFos
locared iD the 3.6
prot in
m
In conh"sl .he di4lam lre3ted goup (?.5 ng&e p < 0.05)
isoxylii,ones-tr€aied aninals (30 mg/kg,
p < 0.03) showed
in the cFos protein exprcssion in all of fiese aftas which
sob-
!o
and
a sisnificant reduction
wa alnost
@mparablc
!o ihe notudi coltrol grcup. Int€restin8ly, the hoxylitonestqted bnin s@rions
shoved far l€ss c-Fs expre$ion ar conlaren to the khdled group
Figw
d shoM
in the
104 b.
13
3,1,4, Reverse Transcriptase-Polymerase Chafu R€action ET_PCR)
Analysis for c-lor nRNA ErPre$ion:
in 0le
Thc scPTzinduc.d chemical kindling in mic. cased a IMked incrasc
/or
fie
mRNA expression Amongst lhe various regioff leski'
conchttariotr of
dd anygd.l4
.-rr
and
mRNA
wd
found in the cortex' followld bv the
c-rr ldNA
in the anvgdala
('
< 0005) who @mp&ed *ith the PTZ@ntol stoup
expression level
hiShest
thaluus
fimllv in the hipp@anlus (Fielre lla" b) The isoxvliimes
tleatment sigDifi.intly inhibited the
codex (a
c_
of c'A also
showed marked redudion
in thc
< 0 01) and
lte
mRNA
thalamus as
group The featment of diazepam was also
compafed to the PTz'control kindled
fouod to redu@ the levels of '-las
compared ro the PTz-conrrol
mrNA in tl€ conq!
$alus
and amvsdal'
gorp(p<O02'p<o042'p < 0 05 fo!
lhe conex'
'fte cy'os ?CR prcduct (238 bp) and
amvgdal4
and
6ala$us
'espectivelv)
producls o!
md visualird bv olnils the PCR
GA?DH (al4 bP) were sepdated
agenl
ethidiurD bromid€ ss a stairttrS
l% agarose gel eleclrophoresis oontaining
lE
expre$ion lea'Is of the housck@ping
gct'
GAPDH 6RNA were tror
e/os exP'€ssion fd all
the goups 4tt the values for
among
diff@nt
sipificantlv
GAPDH nRNA levels h al
conespondhg
to
$e
regions wcrc normalized
i c normal
cT nPtrd !o $e concweat mnttols'
expeiments. The bands were then
in
m.l PTz-cofirol 8!oDps. The % ch68c
ftatnent
groups is shown in Table 8
o'r
mRNA dp$sions amoDg ue
rigure
reprscnblive photoDicrogr.ph ofc-r6 imDurorerctiyiay ir
controh .trd isorytitor€s tEnted grcup. (!)i Notc lle iDcrease
in
,muo0uoiescsce in the pTz@ntrol bmin sectioDs (B). AMG,
CTX .nd HIp
represenl fte ahygdala, codex ad hipocampus,
rspecively. .rhe c-Fos
inmuo.eactiviry was stread in rhe enriE conicat regio.s
ofplz_control gloup.
in cont asg the c-Fos immorcactivity in eimats tilated with
isoxytitons ws
.fte
m&kedly reduced (C).
diaeparn_rEalcd uimals .xtibited significe!
reduc$on in cFos inmundelcrivity s comp.red
io mAco .ot group (D).
10r Th€
However, the c-Fos immu.oreadivity was comp@lle
ro thar of isoxyliton€s
acabd 8roup.
(b)i
cmphicat represenbton
of rhe lwels of
c_Fc
inmuorcacivjty in a1l {our group brab sections ualyzed
by ImageJ soolare. Ir
compdson to be romal @nuol gtow
Q9.41+3.73), rle pTzconrot g.oup
showed a sisnifiqmt inorede (, < 0_02a)
in lt)e cFos iinmurostahilg inreffity
(74.69 + 17 3). ln contrast, c-Fos qpression
declin€d significanfly *p < 0 05 in
lle isoxylirones-rrealed group (44.94 + 5.t9).
75
.c.o brr6E oo6,to+@
€r
i
:
E.
Figure 1r:
(i); Efie.t,
or
borylton.. .!d pTZ o!
ctr
Total RNA isolated ftom under invesrigarion brain .egions
subje.bd to RT-PCR aralyses,
visualizcd on
normal,
l% .gdose got
ad
I
ofall
fou, goups was
finally, fie pCR produch were sepamred md
€t€ctrophorcsis. cets
PTzonrol, isoxylibne-r.arcd and
Bpeclively- l,afts
DRNA elprc$io..
A, B, C ed D
r€prcsenl
diazep@-lreared groups,
7 rcprcs€nr
DNA moteutar weighl markcr, cApDH (414
bp), RT nesativ€ and c-rs exliersion in $€ hippo.ampus, thalamus,
cortex ed
amygdala .egions, resp€clively. The
cdied
qwlificarion of rte pCR
products was
ou1 by
dmsitomery anatlsis. The house keeping gene CAIDH ws ,lso
analyzed for each treatttrent grcup. The pCR producrs
for cApDH from each
tretnent group ed of ech rcgion of lhe brain arc snowtr bctow
$en respecdvc
gel. The nRNAs values for expcsion lev.ts
of c/o, w@ nom.lizcd r,o
their
respective GAPDH
nnNA
levels. (b); Effecls
of isoxyliiones on c_/a nRNA
expression levels. Followins the selararion of
bandr by agafose gel
el€cEolhorcsis, the quanlificarion of the bands
was lerforrned by densiionerry.
Each bat relsen& tbe Dean a S.EM. TIE pTzkindled
losinve conEol grcu!
exnibitcd significedy incrssen lcvels of c/or
expressroD n rlc @nex (., <
0.0olr. dralmus {.? < 0.005), mycdals fp < 0
02,4d hjppo@mpu f:p < 0.0,
regioDs when com!.red to rhe DonDal
controt group. rhe isoxylirones-tr€ared
mimals showcd a significant reduction in the €xlression
ofclor triRNA in allthe
*p
four reeio's exardned
< 0.005,
< u.ol and p < 0.0j for rhe
Cp < 0.0t,
amygdal4 cor!s{, hippocanlus and 6alarnus,
resp€crivety)
rt
when compared to rhe
PTz-@nirol group.
Btm
the isoxylil,ones-t ealed and diaz.pan-kearcd grcups
werc com!&€d wirh ihe nomat_crnrol grorp,
no significant dificmc€s of e6r
nRNA €xliession were obseRed arnong ttesc groups.
17
78
3
2
t.
.E
5
r:
ZFE
.EE
4t.:
;6;
E
:E9
dr
E
-
463.
i s3
3.1,5. BDNF ImmuDohi!tocheEtsrry
BDNT IHC was pqfomed in thc
erhibited vcry littlc to no
?TZ
bEiB sas!16 of@rtrob
in Table 2 (Methodolo$/
as described
(mC):
section).
lte
and
groups
nomal conrrol grou!
imunoMctivity in all rte bnin
administrarion significanfy enlBncld
tc5!n.d
rc8iotrs t6red. The
a noEogo.oB BDNF
imnuo.€activity in tle polymorlh iMcr layd (the stratum mdiatus of the
CA3/CA4 rcgioN) of lhe hilpocaDpu!, ald
lay.s Itr, V ed \al of the coii,ex
'p <
r€gion as compd€d to normal controls with
respcciively.
In Mysdal4 kiodled animals
exnibited
0.002 and
slidt
*p <
incr€ase
0.03,
in
lhc
immuoreaclivity; howcver il did not differ significnnuy nom @d.ols (p > 0.05)
and lhe levels remined omparable to controls in lhalamus and hwothalarnus.
Th€ pE.treaunoL wiLh isoxylito!€s (30 oeike)
normal levels
sp@tively as
in
hippocampus and c"nex
compa.red
rc
med tlE BDNF
with 'p < 0.03,
fte
ro PTZ khdled group. The diazelam treatn€nr nlso
levels in the treatnent g.oups (isoxylitores
obscrved compaDbl€ to the
romd contols
,r
ud "p <
ed di4pm)
were
in all thc rcgions cxdined.
3.1.6, Voltlgegated SodiuB Chardel
Study of Isoxyliton€s
ro
ed '? < 0.01,
n&k€dly reduc.d th. imnnor€activitl in fiesc r€eions Cp < 0.001,
0.02).
l*ek
I
ibitior rnd
Dose-Respotrs€
vr'vr:
The effocts ofisoxytitones on Na' CEont (/NJ inhibniotr in vottagegat€d sodium
EO
trigBe 12: Ef.cs of boiy'itorq or BDNF pm&ir .rpr.nio! fonowilg !cPTziduccd ki!dn!9. (A); tlE lorml @nnol gbup shc{r.d vcry little to tro
BDNF imunorcallivib/. @); PIZ kindling si8nific.5n y inore.ased the BDNI
inmunor-activity in hippocaEpus ard clrt€x r€gio$ C? < 0.002 and -" < 0.03,
resp€cliwlr. (C): thc diazepaD .tmql r.ducld the lcveb to crtrtok C" <
t
0.001,
ed ? < 0.(D). (D); isorylitond Eah@t rciM.d lh.
€nhanced BDNF
immuorerctivity tom I|FZ kindling to rhc nomal coltrol lcvels in hilpocampus
('p < 0.03) ind conex
('?<
0.01).
Cralhical rcprorontdion of cuDurarivc BDNF ilDuorcacaivity analysed by
IbageJ
softs"l! in all fou gmups is shoh
at the bo$om of thc fieure. PTZ
kindling rnarkedly incrcssed BDNT protein expresrion as compsr€d ro cont ols
< 0.02.
fte
'/
isoxylilones and diazcpan ir€atnots signific$tly suppressed PTZ
kindling induced uplegulalion
ofBDNI inmunor€acrivity wilh "p <
0.03
dd
?
8l
rildttilds(X4,'lq) + lrz
t
8:
chmels (VGSC' of kindlcd
uing
@lls
mV
the volta8e
(, -
3
-
cld!
studied
!.or@ol bolh in con&ol dd kindlcd Et bmin slic€s. The
5) wde patchcd in
dd deloldized
re
ad co rol (non-kindlod) nuos
votlac clmp mode d
a
holding lolential of-60
by stcps of l0 mV. Isoxylilones sienificantly biocked the.IN,
in lne cells of control brain dic€s at a lest concentration of 100 rM. I1 w6,
therefole, decided 1o ure a large ol highcr to lowq coucentlatiotr to study the
concqbation-deFndeDt inhibirion
The subsequot
dd
dclermine the dore-reslorue rclationshi!.
oncolralioN of isoxyliton* wse lrepa.ed ,nd
&sted by making
six l0 fold serial dihtions stardng fiom the me\imurn conc€nt ation ulst (100
pI4) i.e. 100, 10, 1,0.1, 0.01 and 0.001
depmdmr $pprcssion of
.1N..
rM.Iso.flitoffs
The surprcssion of /N. tor
deimined by calcul.ting tnc ratio of lhc ruxind
drug perf$ion. Thesc ratios
{erc
The suppression of .lN, bolh
exhibit€d
ed
then avcngcd
cl)]ut
sch @rding w6
beforc
13. The per@ni
dd
aRd the
ploned.
in control ed kindhn neu$ts wde compmble
having no significet ditrerencrs al the differenl conccntratiors usod
Figue
@cmt ation-
s
dolicled in
block of 1& Mplirdde at 1 pM md 100 nM corcettdtions
ofisoxylilones ale iliustaled in Figure
14. The
IC$ values for control and kindled
conical neurons were calculated ind€p€ndently by fitting th€ data !o a standard
dose'reslonse equanon
rqloNe
dd wing
data demotrtrated
kndled rats, B!@tively,
6
IC!
the Microcal OriSin 6.0 softwde. The dose-
values
of
185
!M
and 200 nM
fd
@n1rol
dd
showl in $€ Figure 15.
8l
90
80
'0
60
4tr
t0
:0
IO
l00
tAI
ll'II
l0$l
100'rt\I
t
l0
0Il
I
dvl
Isor$ lilone Coocentation
glg't'{
3odiuu chrDrck
coDtml rdnll
ri' bhir corticd
Figon 13: Gr.phi..r r.Pit.rtrdor of volt
i
iDitiotr by isorylliotrB In kil(tl.d
r.d
keL tt tim' The blcrtade of/N' betws lx€
&d ditTcrcne of suPPrcssion ws obsed
!.urons d v.rious co!@ r.tiotr
rso Sroup!
s6
compmblc
insignificant al all conc€ntution l.vols of iloxvlitones $udi€d'
84
()
(B)
Flgur. 14: Etr.t of borylltons on volt ge g.ted .odiu ci'!!Gk (VGSC!)
in.ddt ttudLd nt bdin onior reo t (holt py|lrnid.l.||t irt'E orc!$
r = !9 BitrC votr.Ce.LmP Pna@L Ai CqcenndiodeFdert block of
'N.
by iroxylitd$ showing 57 1 + l ?% i.tibitiM at I pM corcent$lior E; Al 100
!
.otr!€otltioA isotylnltF blcted 'l'l
+
2j% ofsoiltu cun nl'
E5
_t
8io
t61 tErt o!,t ql
Onrld{
rqr@1sir
i
o
to
r|tur f5: L!ry|b.. [.b 4r b.a h bru -d .et!.I (rn'
fb$ ..rL..l r-r- L r sE|tlrbi.?.tdot trru tt!
.h.ri .qud .dft|cy ,t rdre, 1[. [!c wi6 flha orcbs llFlret
corclrrptid..ntoio slvc h cOdol !q!0! tlst vr, c{cia.d to bo 185
nlr. ft, onvc wi&i,tib dtllr.bo bubidd of{r ir6etirillE l ELur
(200D!i).
6
3.1.7. Morphology Recorstruction aDd Cell
lmrgo ADalysis:
Thc @U tocation, Dorpholog/ md dcnddnc a$onzaion w@ studicd by
includhg 0.2 % biocytin
i!
the patch el.cEode fo. every p!&h. The
norlholory
of the cells was reconstructed by confocal microscoty and images were anatysed
a3 describ€d
patchcd
in tbe methodolo$i secrion. Ttis lroce$ conlim.d tlar lhe cclls
ww
l@aliz.d in llle conex rcgion
A relreser@ive
dd wqe cithq !)Iei.lal
o.
photoniclograpn of a pyramidal conical ieuron
'nterneuons.
palchcd fo. patch clamp srudies is shown in the Figue 16.
3.1.8. Quantitative Real
Tine
RGv€Ne Transcript !€-PolyDersse
CbaiD Reaction (qRT-PCR) Amlysts for BDNT Expressior:
Thc lcvels
ofBDM niRNA
(ipsilatcEl
dd
werc quar ified and conpar.d in lhe cortex region
conralateml to the
ki
hn side) of the brain
sepls
couelcd
from drce groups (a5 dcscrib€d in the m€lhodology s€ciion) i.e. Contol
Kindled
(r = 6) &d
isoxylilones; tr
:
trat€d (ldndled bur trsted with the
tst
(, =
5),
@mpoud
5). One-way ANovA (GraphPad prism 5) rcsults showcn
sign'ficant ditrerctrc€ in ,ol2l BDNF leveh betw@ the $rcc grouls,
(Iigurc l7). fte porl ,oc Tukey's
!e.sl ISPSS veBioD 13 softwa.e]
kindhn anim.ls exhibilcd high* total BDNF levels ftan controls
whcreas BDNF l€vels in lhe
!
p < 001
slnsen lhat
('p = 0 02E),
trated animals were significan{y lower than in
kildlcd diDals (.ap = 0.033) ud did not differ tod contrck (p - 0.996).
87
16: A tlpMr.iiv. proroolqlenDh obl.ln.d bv @fad
nic|1)dpy rldilng tr. |@DEscthn of Dotpborog/ .trd .tborl.lion of r
.oricd prnnld.l rantr prtch.d h . rra brlh sli@ for do.. sPo e.tudv
Ftoe
88
The cffects of isoxylitoDs on the expression of iodividual BDNF transcripls
IV
and
vI
we.e lhen studi€d. Oneway ANOVA for BDNF truscript
III,
III ard IV
did not show significdl dlffercnces in expression leveb mong the ftrce groups
wiih
p>
incr.€s€d
0.08 and
p>
trdsoilt| m
0.09, respectivcly. Howwer, therc was a lrcnd for
and
M€twccn kindhn od @ntlol grculs dd
decrcated
aDNF b€tw.en kirdled and ire{ted groups as shoun in Fi$!e lE & Figuft 19.
The Powe. Analysis
lho samlle siz! for
fd trdscripts III & IV *ere caEied out io order to deremin.
trascrilt III
and
IV (Powc!
and Precjsion software veGion 4,
Biostat, USA) 10 rach the statistjoal ligrilicuce. Pooled Steddd Deviation
(SDembd
wse calculated &om SD ofe.ach group and Smple Size was daennined
by bking the delta of2.8
po\rer ro be 0.E.
fto
ed
data
corlridcring thc alpha (2 tailed) to be 0.05 and th€
sealcd that,t =
conlrols io rach lhe statistical
would rced one
Sroup
mor tuinal in
signifio@
ahe
7 would be needed for
b€tw€etr
ki
lcd vs
th. goups. lt m.us
we
kjndled group and two animals in $e cotrtrol
lo achieve the sienincantly diffshl exprersion l€vels botween thesc two
grouF. Similarly, i1w6 cal@laled that $€ sampl.
sie,
be n€€ded to reach th€ statistical significance betwem
=
ll dd,
kirdled
dd
= 12 would
ue.ted
glups
fof lranscripts III ard IV, r6!€ctiyely.
Intaetingly. BDNF aa$cript
VI dpBsid lwels
difference anotrg th€ s.oups with
Dwctt's t-t6t
showed a
exhibited
a
significant
.p < o.lx (One-$"y ANovA). A po,rr /,oc
sisnifice! inc.6e
itr &e
kidled uinals
as compared
69
!o coalrols
('"
= 0.03). Tle exprcssion ofBDNF traNript VI retumcd to control
values with isoxylitones tre3tnent and did noi diffcr
ond ireet€d groups with p = 0.731 as
dopiotd ir FiSure 20.
ahc cxpKioD of Facti! arnong th.
ANOVA wilh? > 0.3).
l}E
gro|lps
ft€ mrltiplc clnp.risoo
BDNF 8nd t&script \aI by
/orr
significdrly bet{een conrrol
ra
w3 cmlollblc
(on -way
anal's€s anoDs dE Eouls for
TuLcy's ald
Dwttt
t-t6f rqlcctivcly,
Thc rclresentalive Figures 21, 22, and 23 lhow the alrllification llots, stsndld
cude with R1, €xterimenl ef[ciency & slo!6 valu€s,
PCR producl
aDd dissociarion curve
of$€
Bp@tiv.ty.
90
I
I
I
t5000
00
o
az
0g
!.9
2
10000
Conrol
Kirdld
Trcatd
5000
o
Conml
Kiilrd
Tr€atd
Trcarnem goups
Figuri
lold BDNtr DRNA dptaio! in
l grcups ttated sitb isorvlitotrG!. Ibial BDNF h
lt: M6or.n. rd oEpirito!
.onlrol, kidled groupt
r
ot
$ignifiornlly increased in the kindled SrouP as compeed 1o contfol dd treated
g(,ups {i1h *p < 0.02 and **p < 0.03 for kindled vs contrcl and kindled vs
lleateil. respelively. T0la1 BDNF leveh bctw€€n
co rcl and tr.ald
groups w're
compaEble with p > 0.9.
9l
2000
b0
o
iiz
1000
s.9
z
Treated
Kindled
Treauneot goups
Fifure 18:
M..!urcm'!'
d
of BDNI
l
$tpl III nRNA
'omFrilor
the
levels
kiodled rod rerted grcups Tho
'mons
,""t. """-t
"il""t"'-."
> 00E ((hF{av ANovA).
sienincant wirb P
obsened
;;;
aninah
'U.*'... "",
t *p*ssion levels betwe€n Linilled & conaol
,"
,n"
otf,".-*
wc.e close ro significanco
{itb p > 0 06 (Dnn'n
s
Gtesr)
92
15000
00
o
iiz
'10000
5000
A
Kindld
Connol
Treatd
Treament goups
Figurt 19: Mour.m.D. .Dd comp.rilor of BDNF an!!.ript Iv nRNA
etptsiotr Lv.lr itr .otr(hl trndlcd .d lrcrl.d group3. Thc onsway ANOVA
showed insignificant diflercnce of exprcssion of BDNF lresripl IV with p >
0.09 among rhe three groups studied.
9l
q0
aztl
'7
(J:l
2etom
TF6bd
Kindled
Tmamctt golps
VI nfiNA
Figor. 20: M.$ur.nenl .!d conP.risn of BDNF tnns'ript
grcrp& BDNF lra$cripi Vl
erpre$ion lcv.h h conarol, ld!dl..t . l
'r'ited
io conml silh "p <
inc€sed itr 1he kindted gmuP as
was sigtificanlly
'ompded
bets€en kindled and
0.01. lloweld. the levels were not signiiicardv diff€rerl
compnrable bc$een
rcated Broups (1'P > 014)- TmnscriPl Vl levels rmained
conlrol and rrd.d groups with P > 0 7E
94
-r055.8666?
1E4.85848
.041
-26E.60000
401.97158
.786
1055.86567
.184.85848
n1_26661
184.858,l8
.l4l
268.60000
4{l.97!
58
.786
.187_2661
384.E5848
.l4l
-6125.13.11.1
2075.812t2
.028
HSD
BDNF
HSD
(2sid€d)
-
184.00000 216E. | 1505
6t25.11331
2075.Et2t2
.aa
s%l.lllll
2075,81212
.0.r.1
184.00000
2168.t 1505
_996
-5941.31331
20?5.81212
.0tl
6r25_lll3l
2075.81212
.021
184.00000
2168.1t505
.995
Tibl€ 9: Multipl. coopsrbons anto.8lhe grcups for tottl BDNI.trd BDNF
inn$ript vI. Th. mulliPle conparisds of $e expNion of BDNF ald its
r8scriD$ wre carried ou1 by on+*!y ANOVA witt Por, ,@ Tukevt ed
95
Amplification Plots
Total BDNFiNp
Flguir 2l: A r.pEna.!iv. ttgor. ol .npltfl.ttion plot! of DNA prodlcl3
of ulknoivr DNA 3.mples.
obtiioed tt the.[d of emb 4{
96
Shndad Curue
Tonl&Dlff.nq)
R.pi.*ntrdv. ngrn of. tn.d.id .r|nc obblned .o qumdfo .ne
h lnboro r.EpL..tmthg P, tlop..!d.tFnn. cfrchtrcv vrlld.
Flgorc 22:
DNA
97
Dissociation curve
figure 23: A
vcrify
disiltion
rht !o 3.cotrd.ry
!ft.r ..ch PCR thcro.l
piodoct! l.d fotn.d.
curae
Prolil.
trt
rdded to
98
3.2. 1',
tltru STUDmS
3.2.1. Voltage-glted Sodium Chnnnel Inhibition
patch clmped
ii
Dose-RespoNe
ft uto:
Study of Isoxylitore€
To dtimatc th€
rld
vtto
lcr
of iso,glitons, cultu.ed mt codical
in voltage dmp modc al a holding
Potcadal
roqls
wqe
of -60 mV ed
depol&ized by sleps of 10mv. The solutjon codaining difl.ring conc€trtnttons
isoxylitones (lhe same dosage lattom
10, l0l) nM
& 1, 10, r00 !M ad
r]uougb lhe dish. After
iatio of lhe
Iwimal
6 $ed
,
for m
vto
of
dos€_rcslonse study i-e 1'
= 3 - 5) was thm ontinuouslv p..tued
l0 minuts the voltage clam! p.otocol *rs r€lealed. Tb€
cunent b€fore md afte. drug
wd
calculated
for eeh
rc.ordin& avemS€d and llott€d. Figure 24 (A)' (B) & (C) shows tlur ar l0 trM
and
lpM thc curent wd
ll)e highest concentralion
supprcss.d br 36
ut.i
(100
r
I
oA,59"J
!M) tle cwent ws
+ l5%' rdp@tivclv- Al
suppress€d bv 73 + 5 6
0/o
(c). Fittins the cude to 6 sttn.led dosc inhibidon cwc (GnPhPad Pris'n 5)
sbowed the calolate{t
aflplirudc
w4
lcs
io be I E5 dM (Figurc 25) Panial reveBibiliry of the 1
'
also obscrvcd both at high ald low mcentrations of isoxvlilon's
used after washout with the en€ma! solunon.
3.2,2. Effects
of Isoxylitones on Sodiun Charnel Recovery from
Inactiwtior:
To asses d€ eff.cls of the tcst @mposd on sodim clumcl iDactivalionneulons w4 used'
recovery, tle lcr0 concenlalioD of boxvlitons in oultured
99
Figure 24: Effccas
of isoryliton.! otr voliqesrl.d sodirD
ch.rDel
r[d prnirl p.nibility .fl.r *$ho!l rl v$iou3 conceotr.tior
l.v.ls of istylitotr.s i! cohund nt conic.l mrreN tt vrtro. (Ai , = 4). (B;
supp.erioo
,
n
5)
+
I.5o/0, and
& (Ci
= 4) show educrior in sodium
?l 1 5.6 % al isoxylibn€s
$M. respeclively. I]je cunents
N
cur.e mplitudeby161I %.59.25
concentmlioDs
of I0 nM. IFM
dd
nonnalized to lhe same curent sale for
100
e6)
cohpfiiso.. Ihe wavefom prcviw of the lolraSe clmP Prolo.ol wed is sho*n
100
5
a
o
qc0d)
tdr.dd ef v.&.0rgrid
dd da tAoD .ndt b
talru .tlrA rl |lh
*..d-.
cilEd .orl&d 86. lb lcr €f lovlid.. h ft... dl! r|t c.lad&d
Ftur.
to
b.
25: Crrpilcd
1E5
l.p|Iof.d.r
ot l}e %
trM.
l0l
The
tim
@6lant . for both pre- and posl-d g irea@d condrnoas was de&rmincd
ll€
independeNly by measuring
poinli tuging &om 2 to
ftac,iion
ofthe cDrrent rccovered al variou! time
ll0 bs (Figurc 26) as desdibed in ihc nerhodolos/
section. FiniDg a single exponential
cwe
to the data obtaio€d fiom l4 recordings
(sirgle exponential relationship betwem time and re.overy) showed $at lhe
rccovery Aom imctiv.{otr
w6
much slowd
in lh. presocc of dse lhan
controls i.e- l8.7ms ve6us 9.4 es, respectively with
3.2.3. xflect3 of Iloxylirooes
or
lp < 0.001 (Iisure
i,
27).
Dev€topnert of Sodium Chsmel
InactivatioD:
To
w
if isoxylitores alt€.
a puls€
puls
rhe voltagc dep€odenr inactivatior
ofsodiM
currenrs,
protocol thai prcduc€d ditrerirg levets of inactivarion foltowed by a
test
!6 ed
This prolo@t
ws .
series of votage
lups
ny
to _25
of6e
ramp
Aon -100
mV (lasting 240 ms) rhsr was ch&ged +5 mV incr€ments ar the end
&d Oe volaSc wd clrlted ro omv b actirate rbc chmels 0Er my lot
inactivated by lhe vollase mm! (Fig!re
presetr@
of200 nM isorylitones
we show
d
€xample of
ti.
i!
28). thh was
the sat,e
Mording.
be
done in ihe absoce and
In FiSur€ 29 & Figurc 30,
one rccording before and after the applicalio, of 200
nM isorflitoncs rnd thc fincd Bolral)m cuwe dqivcd tom all data (6 dsoiibed
!x lie Metho&),
respectively. Specifically,
t]e
p.rcenl nomallzed cunenr
arnplitud€s (% Pr / PJ wcre llotted on y-&xis against the res!@tive voltages
on x-
axh
ed
dala
ws
obtaiDed
bofi in t\e absoe or prescrce of isoxytitooe (, = l3).
ra2
Amp 2m 4ns
tm
l6nr 10ro {0m
50
ns
ll0nr
t
:.^L_
lt
.1.
Figure26: Rep.s.rritlo! of fr.ctioo of lodiuD
crrrcrt(
.) r.cove.ed frcD
i!.ctivaaio. (idiet.d by .rws) .t ditT.rcnt rioe poinb usiry prk.
pmtocol for sodium chrtrnel irrctlvrliotr-ncov.ry. The cunenrs were
nomalized lo their.especrive p€€k values (Amp.) in the
isoxllitond lo olcularc rhe re@very from inacrivarion
wavefom previes oflhe probcol used is shoM
absce or D6ence of
ar qch rime poinr' The
at the bouom
oflhe li8ure.
103
€20
1
E40
\
F60
80
100
20
40
60
(ms)
t
80
100
120
80
100
120
lB)
t20
E40
tr60
80
'|
00
0
20
40 60
t (ms)
FiSure 27: tsorylitond slow€d dowtr sodiun ch.onel recovery frcn
inrclivrtior. Tle time coNtanl . of sod'um channels .€cove.r frcm inacrivadon
in $c absen@ (A) or pr.$na (B) of 20O nM i$xyhones (, = t4)_ cuNc finins
oi the data with a singlc exponential cquation yielded tim. constanl valu. in the
presence of isoxylilones almost doubl€d (r
9.4 ms) wilh
,p <
=
I
8.7
0.001. Tte blact line shNs
sho$s the exponddol fil of lhe
cwe
m)
0r
as
compNd ro control (r =
acrusl dara md the red line
by l|si.e tte soRwsE
(Miq@l
OriSin 6.0)_
104
The
prao@ of 200 DM (IC' value) of isor/litones nor only
amplitude of.tN. at lho vdious voltago l€vcls studi€d
(Figw
suplressed r\e
29) but also cawcd a
rcgrlive shifi in the voltage-dQedenoe of sodium charDel inacdvation
cwe wa si8nifi@tly
sEady-srab inactiyation
dhectio4
4
shined
h
in tIe Figurc 30. TIF voltage
illustrated
i.e.
lhe hlTgrloldizing
required
for 50
%
dcvclopDenr of iracnvarior Vro for posr drug rrEalDcnr .emrdulgs was calculared
ro be J9.15
nV (SEM + 0.48, , =
?rcdtug re.ordings witn V$ to be
13,
rieue 308) 6 compd€d
48 mV (SEM +
0.45,
10
, = 13, Iigm
Th*e lndings demonsrlate $at isoxytnones lignifioantly shift.d rle
inaclivalion of.tn by
-Il
15
mV
(."
the nornal
30A).
steady-sral€
< 0.05).
The isoxylilones treated data nomalized ro the respective control (pred$g) p€nk
currnt mplitudes
Po
w6
also fitrcd lo rhc sme
aoltzrm
jn the Fisu€ 30(C) !o show the sn4r€ssio! of1N.
er
fie
equaton
a
d?icred
coEesponding vollas€
3.2.4. QulDtitafive R€al Time Revers€ Transcriptase-polymerase
Chain Reaction (qRT-PCR) Amlysis for Sodium ChaDnel Atpha
Subutrits:
To
Imw
tha. which rype of VGSCS in $c culfurcd mrrical
ftuonJ srre inhibircd
by isoxflitones, qPCR for sodim chonnel aDha subunils commonly qpressed in
the rodelt CNS
wB cmied out to study their extssion ad rclalivc abudece_
105
Figure 2E: Th. fignr. r.pr.serls
.r dillretrt volr.ge
lle iodinn curr€rls
eliciled in 3 single cell
r sld votlge r.drp pmlocol G[owD tb.
.lTecb of isorylitotre or lh. development of sodirn
levels NiDg
botton) ro nudy rhe
I06
(A)
(B)
i! .
lsirg rt. slos vol4c
ramp pub. protocol showirg th. lnlibldor of lodirn c|Irent .nplthd. it
Figrrc 29: Sodim cot'crtl cticitcd
dlff€r€Dt voltrye leyels
riDglc cou
!r th. ci.rdy-rtrto
iMctivation d€v€lop! lb
tl.
rrl conicd rcurors At the trac$ show sodiun cuots iD the absence
of isorrylilon$ (coDt!ol). Bi the !ftscnc€ of 200 nM (Ic, val@ in oulturd
ncuroru) of iexylitod rot only Bufftress€d the amplitude ofsodiun cuErnts by
cultured
50 % but also dter th6 voltagc dep€odcnce ofsteady-stab
Sat d sodiun
in orturrion in vol6gc-
cnmds.
107
i
cliv'tioo rld shilb volt4e
fils
dep€ldeace of iirctivltlo! to nore bvperPoldi4d poteotitls Ilte bst
values to llr€ Bolumam tuncnon are shoM at the botlom' The Percent
Figure 30: Isoiylitors
elh.rcq sledv s&t€
mV to '25 mV (with
development of in&dvalion at cach vollage levcl Aom '100
+t mV incrcmenrs) was calculated by lormalung thc curlnls P' lo lhe r€spedive
pst cMent values Po in the absde or presence of ierylilones Thc dotted lines
lines represenl lhe besr fil of rno
show lhe aciual vslu* of lrac€s ed co itDous
BollztDatr tucdon ro lhe
dau lo the BolunM ircuon (A)l Best fils wirh a
value of -48 3 mv
compound yi€lded
control data i.e. in the absen@ ofthe test
to lhe data of isoxvlibn€s at
+ 0.45 (SEM). (B)i lhe best fit *ith the snme fi$ction
v{
and
con@tadon sbin'd hc 4rve ro more ht?eryoldizd PoEnuals
(SEN' wift a o€cenve shift of-11 15 nV
yield€d Vro value of-5915 mV * 0 47
aflplitudes in lhe pres€nce
(*p < 0.05) as compared to the co rol (C); $€ cunEni
contol peak Nent valu's do
of isoxylitones wse nomnlized 10 the respeotive
tlE same fucliot of Boltzntm
the data was sub.jecled 1o the bst fit with
cue s as well as alterarion ol voltage'
equatiotr to sbow rh€ % blo'k of sodiun
200 nM lC$
deleqdenceof iftdivationtomorehyperyolariz€ddirection'
l0E
r
goltne
Fit A
-B.l6sFilB
P,0, = P. + (P.-PJ /
(l
+ cxp
((v.
0.t69t3
0.360u
o9964
v,)/l)
0t845
098t
\aluc sbnd.d Etur
95.9.@5
0.lt'
I
0.66219
P.
48,31506
tl
?.
c
5.4&91
0-28059
95.0r79,
r.tJ90l
-l,lt7l9
Lm8C'
-59-ttl74
0.4?682
5.06l16
0.1821
16.46416
0.5920?
4.64lf,
0.t0420
-59.242/1
t.l6912
109
Thercfore,
$e
alpha subunit! of the followilg sodium chmncl sub&es wele
sel€.led for qPCR
st!di6; Na,l.l, N41.2, Na"l.3, Nel.6 Nat.7. Figw 3l
shows the expression levels
of ftese sodium channel subtypes rclarive to
a
rcfaence g6De (synaptophysin; as descnbcd in ihe mcthodolos, sc.lion) in l€rets
of Cb vdlues.
lt
was obsencd that sodim
clmd
subuit
alpha
1.3 (Na"1.3)
mRNA with normdizad cyolc thrc.rhold Cb valu€ of +3.7 (S-E.M. 0.6a) w8s lhe
nost abud@l subtFe p.esetrt in these oell followed by subt
q
vahc +2.2 (S.E.M. 0.4). Tle
l6t
".
€xp.ecsed
nighest negaiive C6 value (S.E.M. 0.1).
alpha
subuit s btypes lesGd is
1.7
lte
O.l4l.7) with
suble vas N&l.l with the
order of er"r€ssion of the vGSc
as follows; 1.3
>
data showed thar the cultued enbryonic
> l.l.
Thus lhe
neuos uled for
i, vlo
1.7
>
1.6
>
1.2
electrophysiolo$t studies compos.d mainly of subtypc Na{1.3
Dafa wa! subj€otcd to ,re-ray ANOVA Nir'll, past hoc Tukcv for goup
@mp,ri!o!s. Resulls |ot post hoc gto.tp @mParisoa
t6t
showiag
tlE M€ar
Difiererce in Cb values among th€ groups wifi P €lu€s @ prcsented in Table l0
0
5
3
2
I
0
=
.l
Q
-2
-l
-5
voLage-gared Sodiun Channel SubBTes
lt: Tbe SnPhicrl EPr4rt tton of C! trli6 oI voltts?€rt'd
pH'n'e tnd
iodlum .hr el tubttp€ tlPbr rubuoic mRl\a 'ltryed tor lh€
lor
rclrdve !bt!d.Dc. h th. ollur.d nt 'ortol De||re o!'d
Figure
ele.troph'siologl .tldler The positive lhe Cr v|luc de h'Bhtr rs the 'rpEsiotr
subrt?e
of nRNA dd vic€ vesa. Nlrl.l was obs.ded 10 b' rhe Dosl sbunddi
whclle Na"l.t
l6n .xF.$.d The muliple onpddsos dong ine
ANOVA eilh Posr /tr. Tutev) vith absolule p valucs 4d
to be &e
g.ows (Oneway
siditic0nt difte€iB
are shown in the
uble below'
|ll
Tlblc 10: Mrltiple conparieoI! (Oo.-w.y ANOYA lrd Prrt l@ Tulcy'3
t€st) of tne erpr$sion of sodiun chaDnel rlph sub!tria ttdied itr cultured
|2
\lu ltille Cobp.nrobt lulc'
lllo
M-!
srhin! (l)
Dlfi. (r-
Ern
8tO
J)
(J)
st-@d.q)
.589{l
-5,92500C)
.58C42
.58942
1.2
5 625001')
.539,12
02500{)
.53942
4
FGiJ
"
irr q: "".ontjlcn'c
lli
CHAPTER4
Discussion
ll4
Epilepsy rcrn in n dajor nedicnl challenSc
cuable and nore
the
dd
30 % palients wo.ldwide
tiU to datc
it is
no1 complelcly
ae still living wih
rcAaclory
elilepsy. In an effod to discover lie potmtial of a lewly discov€red, paieDcd
dticonwlsanl agent to be developed
betler efflcacy
ed
as a
tux!€ cudidale for n€w AlD with a
safery profile, we start€d investigating isoxylitmes [E/Z] to
dplorc its m@hdism ofadio!, its pNible anti-cpileplogtuic chamd..isliq and
froleculd effects
on the
expresior of?ilepsy
ist
ndkm
in
kilded rodol
b.ains.
lcsred in tho acule subcul4@us
Pentyldelet@le Gq
PTZ) itrduced seizue model ofNMRl ni@ to evaluate its
dticoovdsdt properlv
The compould was
dd
ilereby the dose to be used in fie cbrcnic seiau. model (kindlins) for
nol.culd
srudies.
administered
Ior ihis plrposc, aste coawlsut
dose
ofPTZ (90 m8&g) *as
in the @nttol grcup anin ls. We obswed tbar Isoxvlitodq at 30
acute
seiaes.It
also exhibite'd
mg/kg
dse effectively iDhibiled lhe Plz-induced
100 %
no
!.olcction fron the nodaliiy s@n in the PTZ cont ol grouP receiving
olher tr@tment thm acule conwlsive dose of
lentyloetetrmle B6cd
on tlese
findings, we sel@lld 30 m8&g dosc to b€ used io the Kndling expdinenls.
Since rhe (El/Z) isomdic mixture
dperime !
as
lotst
of
isoxylitodes
wd
idertificd itr our initill
anticonwls&r agentsi therefore, it w6 decided
1o
ovaludc
its action on the epileptog€n€sis procss in lhe nodel ofohenical kindling induced
in mice.
Ou
dala d€mostaled a Potent
hliopileptogsic activitv of isoxvliloncs
l15
id the patho?hysiology of both lMilial dd .cquir€d elil.psy (Mcldne &
Rosawski, 2007; Z\)liani, et at.,2012). Mary
develoled in the
pst
dlielileptic druss have
b€e')
two d.cadq $at modulate the activity of thes€ chmels
(Rosa*ski & Loschq, 2004) In the prcscnt s.udy, isoxrlitonet w4, lh@f@
srudied
t
news
ofembryoDic origin, uidg voltage-clan! configuations and whole cell
palch
We
rir.o to
cldp
foud
se€ lhe effect5 on VCSCS
el.ctrophysioloey. Bolh
and iniemeuons *erc
sed lor
thar isoxylitone blocked sodium cuFetri (1NJ in a concentalion-
dependent manncr Nith dre
(Ic,)
ly@idal
of primary cullurcd mt @nical
minimm iDnibitory concmtrations for
inhibilion
500/0
value of lE5 nM (we round offrh€ concdtration !o 200 nM for subsequor
ele.rroph,siology studiet, while the porrssiuar cMent remaincd uncheged (dara
not sbosn). Tle panial rcveBibility in the amllinide of inhibited
after wshout rviih lhc extemal solulion
in the
bsi.h
1N.
sd
ai both hiel and low
concentalions studied. The Ic5o valu$ of vafions dogs havc blen
linNty @relate
it
obseNed
rcloftd lo
lo the drug lipolhilicity i.e. tb€ mor€ lipopbilic the diug is, morc
blocks the.1N. Q,e*ey, et
al.,20lli
Dsaphy, er
dl,
2012).
Th6,
thc
lipoph'licily of isoxyliton$ (it is oil in Mtue) may bc one of lie uderlying
factoB Nsociated
*ilh
its low ICs value,
in@mplote wshout &om |te
lC,
value
i
nrumal
icale! the polenl
ed prnial reveEibility
oflN.b€cause
of
mcmbmn€s. Moreover, lhe potennaly low
sodib chanel
blockiag activity of thc
@mloud
llE
i.
scPTz-hduc€d kindling model.
isoxyiitones
significdty rctaded
It lvas
the
obseryed that a 30 tngl(g dose
developne of seizues
as
of
comldcd to the
tindled conEol group. ?entyl€ne@t"zole (gIZ) most likely produces seizus by
inhibithg the samma ahinoburyric acid (GABA) nculoFaIsnission (De Sano, er
ar,
2000).
Canfla aminobulyric is a mjor inhibitory neuotrmniner iu
brain, and lhe
rhe
hhibitio! of GABAergic nc@trarsmision
1tre
h3s been thoueht to b€
najo. ud€rlining factor in lhc developnent of ePil€Psy (Amabeoku, €, ar,
1998).
Th. onhanc€nent of the GABAagic newt"smilsim hd alreadv
been
leloned to dta8onize seiz!fts, whiLe ih inhibition prollotes seizur€s (Gale' 1992;
LeaM4
2003).
In ovr study, we have
used diazepm (7
prot€ction of mice againsl
s mg^g) ,s
PTz'iducid seizues
t
refereo@
dlug The
observcd in dia?epam'teated
kindled mi.6 was cxpected sincc veioqs 6utho6 heve shom tha! di&epam
its artjconwlsdl aolivity by
Amab@ku, €r
ol,
Eelid studia
1998;
have
gen€mlized lonic
enlecirg CABA-mediated inhibilion (Olsen' l9Eli
Lm.ad,2003; R n&./ 41, 2003; Shaur
shou ilEt the svsrcoic
tlonio
*"ts
seizures
a
adDinistrati@ of
aftagoniz€s the €ffecls
er
al'
PIZ
2004)
leads ro
of tle GABA
(Failgold. 198?; BlodeFunke €r 41 1996). The suggestcd @duction ofslnapnc
inhibition
@
contribute ro the
lg17ik*t^'ti, et
et
a1., 1982;
@nidsiv. cEets ofPIZ (M&Dotald dd Ba't@'
simonds,
1982; If,weke,
.141
1990; tridenheimer'
aL.,l99l,Klee, et dl., l992t Mavsay. et al 1994) In tle liglt ofthese repons
l16
and oui
obsmtims,
i.€. rclsdlriotr ofPTz-ioduc€d kiDdling by isoxyliion4, rve
suggdt tha. the anti-seizurc efl@l oflhe isoxylilmes may b€" in !a.t, due to their
ability to attclualc PTz-induen seizuns by int rfqing wilh GABA.€ic
t"nsnission. Howcvq, unlikc dia"cpam, we are not yet cle,r rc8alding thc
mechrnism of isoxylitones slecifically on GABA ft@Ptors.
once the mticotrrolsdl and anti-epileptogaic activilies
oflle
isorfliton€s
wa
coofimi€d, n€xt w€ were, intcrcsl€d to €xplor€ the m€chmism of actton ofthis
novel tuticonwls.nt compoud a1 L\e l€vel of ion chaiiels. Isoxylitot€s was
orisi,aly nohtod nom medioinal pter Dekhi"itn denudatuh
'lle 6eu.n
te@ of our @llaboraloF had €arliei rcloned Uut thG aqueous extrad of
DelphiniM detudabM
polmtials itr cultuEd
t
tibitcd the sutained relelitive
hipp@lal
@ncentration-dep€ndent
Pyranidal
mmer E!ze,
er
ftltront
4r,
fliog ofsodiu
both in a
action
ltedepod.rn dd
2003). The.efore'
vc
decided to
conducl cl@t ophrsiolosical studiG in ordq to see the effects of isoxvliton€s on
volrage-gat€d sodium chaDels (VGSCS). Many dtuss exen their effe.ts bv
impai.inS the
mduction of Na* tluouen vollgegaled sodim chmds whioh
includes local dacsthdics, class
dli@mtsants (Cosford,
er
4t,
I
anti-lri},itunic agenrs, and
2002; Liu, 4i a/, 2003; Fukuda et
somc
al 2lllr''Iltc
VCSCS responsib!€ for the gcneratio! of action pobnnal in ccnFdl neurDns arc
viral tdgets for rhe actions
ofAlDs (Canfiall,
1999). Itr recmt
vds,
tlere have
been growing €vidences suggesting the involvemml of alnormal VCSCS activiry
ll?
in the pathophysiology of bolh familial md ..quired €lilepsv (Meldrun &
Rosawski, 2007; Zttia
developed in tbc
(Rogawski
nudied
&
\, e!
a1., 2012).
Mmy anti€pjl€ptic drugs have
p6t tro d.qdes that modujate lhe activiry of these channeh
Loscher, 2004). Itr lhe presst
i, v,t
been
studt isoxylitone
10 see the effecls on VGSCS
nou.ons of €mbryonic
re.
therefoc
of P.ina'a cultued nt coiical
and whole cell
origiL us'ng volrag@lamp configumtions
patch clsmp elecnophysiology. Both plranidal md
intmdons
we foud that isor'flitonB blocked sodium curent
(1NJ
w€rc us€d tbr
in a conce ratiotr'
depedent manner wiih tho minimum inlibitory concenl'.tios for 50% inhibition
(ICJ0) valu€
of lE5 nM (we roud otrlhe concstration io 200 nM for subsequenl
el€ctrolhysioloSy studies), whilc the pot
not shown). T1Ie partial r€va4ibility
afrer sashout
lsiM clrent remaiftd
h te amllitude of inhibiled
uocbdgcd (d.ta
,IN.
wd obs€ded
wilh thc €xt€ful solution in the bath at both higl and low
conmtmlioN stridied. The
lC50
valud of vdiou! drugs have b€en reporild to
lin€.rly correlale to thc druS lipophilicity i.c. the more lipoPhilic the ddg is' norc
ir
blocks
t!.
-lNr (Let1k
y, et al.,20ll; Detaphv, el ar,
lipophilicity of hoxylitones
(il is oil in natue) nav bc
one
2012).
TlB, $c
of ihe ude'lving
faclols asociated with its low ICJDvalu€, md pattial revcnibilitv of.lN.be&use
of
incomplde *tshout Aon the neuronal nembmes Moreover' lbc potedally low
lC!
value indicales the lol€nt sodiun channel blocking a.tivitv of the
c'mlomd
It8
wh.rc most of fic other ag6ts having IC$ valucs
iI
tbe onge of micronolG
idchdins phenfoin, carbm@pine, oxcarbazepinc md larnoligine (Lccs &
L@h, 1993:H!t g
A vGsC
[a
et a1.. 2008i Sheeb, .r
al, 2008. Fantmi,
?r 41, 2009).
tbr€. t}?6 of 3rst s i.e. close (d€ctivatcd), open (.divaid), and
inelivalcd (closen). Afrer d€polariation fie chamel rcnails inaclivared for
nillise.!
s (ms) duing
the ce]] medbrane
dd
d
tlroud
a
few
&tion polential whqe no ion travcls in or ou! acrN
Lhese
chainels. Then membtuc porcnlial depolalizes
in&nvation is removed followitrg the faUinS pha$ of tbe actiotr poential.
This allows the channeb to be activaled again for lhe next aclion pot€ftialInactivated VGSCS
hst Etus
to the d@livat€d or closed slae
be activated again. This process is called
beforc
rerovdt ftom inaclivalion
cy
cn!
and requne!
hnerpobilzarion ofthe neuonal c€ll mcmbme Ga€tic dissse, altqiDg VGSC
iddctivation could rcsult in epileltic seizues due 10 s so-call€d
widow cundt,
duing *hich VGSCS are tonically activc, resulting the nervc cells to
Iyper €xcited. Carbamazeline had
vGSCs (Granger, e,
ar,
bm
become
shown to stabilia tl'is inadivated sble
of
1995) which is sss@ia&d !o its eti-epileptic adivity.
Isoxylitones
ss
inactivarioa
stac sing thc inactiaalion-@dy pul$ protocol in whcl
sludied for ils possibl. cflects on
nalimM inwdd
subsequcna
IN!
ws ftst
fie
recov€ry ofVGSCs from
reordcd by d€polalizitrg ih€ c€ll followed by
delob.isltions at .lifferent timc intflals to se the tlction of sodim
cuftnt rccovded
as described in rhe methodology seotion. The rccovery
of/Nral
a
119
certain time
int.Nal coEeponds to th€ availalility of VGSCS for suhequ.nt
opcning.t lhat timc point. Tbe lC, oonc.ntration of 200 nM of isorylirones sts
us€d
i.
the cnohal solution whil€ CsCl was used iD thp pipetle solution due !o irs
prcperty to sele.tively block
K'cuEals.
The dara wls
cwe
fined to the single
exponmtial €q'islion a! describ€d edlier to calcdate the time constant for %
recovery.
I'/e found rhar rhc pllhcc of 200 !M iloxyliton s signifi@lty
enhanced the stcady slate ;nactivalion by delaying
with almost doubling the time constant
i tom
fie abiliry ol
These lesulis suggested
p.omote thc inactivaftd star.
ad
rle r€.overy trom inactivarion
conEol vatuc of 9.4 bs to 18.7
G,
iloxylitones ro preferabty bind to
henc€ calns
dom the
ed
neurotral hlTcr
excilability ald ma.kes the broio cels less qcitable. These chMcterisns @
similar !o @bsmrzepine, phenyoin and latnohisine. Carbdn zepine" a welt
prescribed
AID dso stabilizcs the jnacrivaied
state
isoxylilones s@B! to be morc portlt wirh Duch sEall.!
cdbamazepine and othei
klotllr
of VcSCs;
however,
IC, wluc thd
rhdi
of
sodium chamel blookcrs srongly srlggests
ih
nor€ pole] eti-conwlsant activily which @uld
be
very Gfrective in $e tre3tlDcnt
of epilcpsy in tutue. we }ave also denonstrated thar the presence of isoxfhones
al
IC!
corcenlralion of200 nM sigificantly altered
fi€
voltage
d.ped6ce of
inacnvado by shifrilg !h€ steady-state inactivation curve !o Inoc hyterlolarized
potcntials, slowing
fie
delay
ir
the development
of
sleady-state inactivarion.
Thu!, in addition to tlE suppression of1N. mplitud€, isoxylitotrq not
o
y slo-ed
124
doM th€ re@very from iDclivation bul also delayed the develolmcol of
staie ioactiwtion
in
VGSCS, making
it a uique
st€ady-
lgent posdsing all th6.
rcmarkable prclerties- These resulls suggest tbat isoxylitotr€s, likely reslorsible
fo. inhibiting the repotitive fuing (a ch@cleristic of sprad of seizure activity),
hls clinical inplications for potential therapeutic ue to Lrat intactabl. epilepsi.s
whcre controlling
$e
A@ording to rhc cldsification of IDicmarional Unioo
Phm&olory 0UPHAR),
thele @
farnily (Canerall, et al., 2005).
VGSCS
effeci
pesdt
of
dft
OM
chmel, we
isoxylitone on sodiun
u
of
a serious clinical
Basic and Clinic.l
knour membels of the sodiu chmd
wc ob$Ned ltie ilhibitory activity of
were inlerested to find oul
in lhc cultued @rtical
isoxylitones
i!
hneFexcitability of nerve cclls
ncNB
vito. For this
which
purpose,
wtr
fle
us€d for
subtypes
of
sMying tlte
we comparcd the mRNA
disriburion of variou sodiurn clanel alpha subuils l$own !o bc expr€sred in
th€ rar cortical regioN
ed
capable of supportile 1N. (i.e. N&1.1, N&1.2, N&1.3,
Na"l.6, and Na,l.?), by quaditative RT-PCR dalysis in order io s€e then
prcsmoe and rolativc abmducc
in thes. neuons. Our
analysis revealed that
nRNA @ding for N41.3 displayed th€ higle$ level of dp.ession
sodium chrluel
dog
the
subbes studied wltereas t]r$^A fo. Na'l.l aDha subuil beiog
the le$t o'?rerscd with the followhg order of qpressioD; Naal.3 > N41.7 >
N&1.6 > N41.2 > N41.1. Thee obseflltioN suggcsi &at thc sodiu cMen(
l2\
mainly resuLed Aom Na"l.3 ex!rcssion iD $ese neuoN. Ns"1.3 (fom€rly knoM
as
bEin tyle Itr), rapidly recoveF ftom inaclivalion and gendate a letodoloxin
(TTX) s€nsitive, pecistont
adim poential,
rlu
(Becftb
hid
er
It depolrnzes in
slose
inqeasing ihc .xcftability of
(Curmi6 & $/lMa!,
relalively
1N..
1997; Cu[mins, er
d,
els
2001).
to a slow stimuli for as
itr which
it is €xpBcd
Explsiotr of Na,l.3
in the mt elnbryos nervore systcm bur is hardly detectable
4r, 1989i wman,
et o!., t994t FelE, et at.,
ir
is
adulls
t997). On lh€ ofier hed,
sodiM chm€ls N41.2 abha subuit mRNAs de er?resed in neurom ftom all
thr€e
layss of @rebral coriex of conEol lduh rat brain i.e., moleculd
layer
gmule cells and Purkirje cclls, wh€rea! N41.3 riRNAs were
foul)d
n€urons,
absent
in ihese einals (Battolomci, .r
rcpon€d lhal Navl.2
dl,
1997). Fulihemore,
a subuit nRNA expressio! laels |emin
it h6
been
unarieren in
ce.ebral neocortex afr€r kainate-inducld (KA) seizures in adull ra,r braiD, whercas
a
Mk€d indwe i! Nav1.3 mRNA
cortex, dentate
glns gnnul€
levcls had been observed iD somo
@a of
cells atld hilar pol)morphic neurons CAI and CA3
of tie hippocmpu which was slill p.|sistenl 24h afler KA injection (casraldi,
E
al,
k
1997; Bartolonei, et
prindily rdlonsible
al.,
1997). Thercforc, we conside.ed i.\at N&1.2
for the genearion of sodium acrion potenrial
h
control adull
ral ncuons in cortex. However, llle aotion potenlial in the kindled aduh neuors i,l
tle cortex maidy
6uls eithr ton
Naa
t.2 or Na"l.3, or bolh.
Ba$d on thcsc observatios, we decided to invetigate tbe 6ffe.ts of i$xyliton4
t22
in corlrol (naiv.)
inl€r€sl€d to see
dd
llccldcally ki(lled adull rat conical neuoB we were
if isoxylitones
q?s of Deurons, dd if it
was alle to supprcss sodium curent in thes€ two
dc
deteminc it3 poteacy in lhae
so,
would be th€
rcmB u
Dawley (SD) ratt were divid€d in
kiadling
'tat
1o
IC! valus in order to
vno. Fd this snrdy, adull SpEgue
two grculs El€clrjcal melhod of anygdala
wd u.d to kindle $. minalt b@uc el@rioal kindling is .xtrEnelv
contollablc
dd dlos
siimDlatio! patmete6 to
lF !@isly adainistered in
dis@le uniis. Moreover, the kildlirg occuis b€st in
mygdala and hippocmpus
e
the nost
comot
tr.sllastic
4d
al.8s,
loci for el€cti@l kindling. Tl'e
progesion of seiatre b.haviour is buch morc evidmt in amygdala kildling
(Aoddtd,
et
al., 1969i Racine, 1978i Mclrt)'re & K€lly, 2000i Morimoto,
er aa,
2004).
The animal receivins el€clrical stimdalions b€.3mo tullv kindled after 13 + 2
sdmulalions. Once tully kindled, lhe animals wer€ scrificed
studies.
Th. voltnge clamp study denonshlod compdblc
and 200 nM
IC50
lor
Patch
valu6 of
clmP
185
nM
in contol 4d kitrdlcd conical leuro$, respectivelv. Therc wa no
,ignifomt differen@
observed in the suPpression
of sodiu
cune
at vdious
conc€ffmtioN studied suggsting i.\at isoxylitones is equdlv effeotive in both 0le
groDps.
It slso sugAsts thal isoxylitons inhibitcd sodium cutr€It in N&1 2
N41.3 wi$ equl poloncy
ed
efiicacy both
t/ vi'o dd i, vd/o B6ed
on
ud
th*
findings, we also suggest $at isoxylilones could prove €ffeclive olinically, in
$e
123
uqtme
of dillcult-to-tre.t neombl scizues such
ofto
which is
rreatmenr
rcsisLt!
beEodiazepines which are us€d
s
weu
6
as
Imox
castaut slrdrone
iD adult ePilepsis Unlike
a, fi$t line dnr8s in the heatnent of Lmox
sFdrone, isoxylitones laoks scdalive sId addiotive side effects associaled with
Among other proqses that
epilepsy, the
dc
Flid ed tlaffie
thought to contibule to the dweloPmenl of
inc.€ase in the c-los expression is an exl€Dsively
repoded lhenomenon that mderlines the
mol.cule cheg6 oclGilg duilg de
qrs
*prcssion in
detcnM h lhe m€lhodolos/
s€ctioD) were
!rcces of epilepros€nqk. Th. .ff@ts of i-goxylilond on
various regiois of rodent brain (as
studi€d iD scPTzitrduced chenical kindling model ofmic€- IrE exprcssion
,r
has b€€n shotrn to b€ incres€d in various roded
adninistraL,on of PTZ
(Mo.8d,
ofG
bnin reSioN folowing the
ol.
199
lb, Morean aod
1998; Edttrunn-VourlioG, er
al,
1998, Simj@ €r
et al
,
1987: Schreiber. er
CtrEa4
l99l; Vouliotis, .l at,
41., 20 I
l)- In asreem€nt wi$ thesc reporis, our daia showcd drat PIZ (50 mg/ke)
increased
lre
the hiehest
ctr
gene l€vel in all four r€gions studicd of Ihe moso braia
wit]
qpresion fosd in l$e rhslamus. The prc-teatnot with isoxylitorcs
conpletely inhibited
crr
level
i,
the mygdala end oonex. In the th&ldus, th€
ievel of c-lo' exp.ession was found to be mdkedly r€duc€d as compared to lhe
conhol
kidled srou!.
Th€ deorease in
c-rtr
gcno cxpre$ion
midt sinply
be due
to th€ suplression of seiaires by iso)\alitoncs. Th€ PTZ has bee! reloned io evoke
124
seizu€s dependinS otr th€ stiNlalion ofcxciiabry
.rdt,
1990i Schroder, e,
al,
1993; Schr(dcr,
which also @ntribute in lhe iduction
KacM€lq
1997;
dino
acid reoeptors (V€lisek,
eral, 1994;Scbroder, erar,
of c-tr both
l99E),
it vito (FiSiel ed
IAttitzt\ et a1., 1997; Griffiihs, et d1-, 1991\ aud ia tiro
(Benetra, ct al., 1992; Mitsikoslas, e, 41, 1998; Hatto.i, €t
al,
2001; Hussain,
,l
ar, 2001). ltrduction of cy'os expression Diehi play !n iDPort nt role in lhc
development
of
seizures as
neurotoxicity (Yoshihis4
well as in the cxcilatory amino acid
,/ ar,
2000). Bsed on lh6e r.Ports ,nd
also suggest that the sup!ression
isoxylitones might underlic
of o'A
gene er".cssion
inducad
oe dat4 we
in the brain bv
its a iconvulsivc ctr4ts through blo.kirg
the
excibrory nc@t"ansn$sron
Il vrrs
also observed tbrt e! compaftd !o Ue isoxylitonc Eeamen! the diazepam
Eeattnetrr did not complercly inhibil $e exPre$ion of
and amygdala.
lt
has b€€tr reloried that th€ PTZ
crr i! the corlex' llaldug
admidstalion in $e fullv kindl€d
dimals produced benzodiazepine-binding dewsse in lrle arnvSdaloid nucl€i and
thalMic nuclei, rhercby del@ing th€ binding clpacitv of tb€ benadi@lin*
(Squna, el ar, 1984i Rocha, er
.1,
19961
Crmer, et 41, 2009) In fte Lishl of
these reporb, we hypothcsired thai lhe decr€as€
rcgi@ nieht be the
reasoD
why ir
in diazepam binding in l'\ese
{s mblc io @mPldelv d@rcase thc
125
Seizue-induced plasliciry has beer reporled to have an €normou impacl on
rcgioml dcit bility in brain by
moiphorogy (Causing,
of
neurons
dd
Kitiyar.n! et
et al-, r997t ve.p.lli, dr dl, 2010). BEin{.rived
(BDNI) is
neurotrophic factor
@ing cheg6 in teutoch.nisry or c.Uular
necessary for th€
trolhic srDlon and development
irs l€v€ls @relale with crgnitive status
al,
20t2). BDNF is
!
(Fahne.rtoclq
potert morphorcgDlato. hvolved
controlling axo8al sprouting and slmptic plasticity (Cab€Ui, €r
€r
4l.
|
4t,
ir
1995; tlorch,
999. N&da & Mack, .U 0001 Ch!o, 2003). BDNF is botJr r€gdaled b) and a
regdaior of epileprogddis tud hr5 bccr
vadous rcgions of rodcnt
I
20lli
999; Notyre & Appl€gat€,
bnir follow'rg
2003twai5,
et
wcl
repon4d tc! be uprcgulat€d in
seizure activity (Ka1oh-Semba, €l
dl,
al., 20\2).
Duiitrg PTz-irduced khdlitrg, BDNF tas bear shown !o contdbutc in daic oxido
depcndent llasric modificatio6 in neuonal exciiabiljty and
el
,l , 2000)
suggesting its eliological role in kindled s€jrues and elileptogen€sis
(Bind€r, .r
zl,
have been
stoM
200
t; LAhl€i!€4
et ol., 2oo2i He
mice. MI,P-9.
nli&,
et al., 201
l). PTZ seiru€s
!o incrcasclhe expression &d actMty ofexec.ellDld p.ot€lscs,
particulmly natrix melallo!rctena!€-9
BDNF
lpilcliosmesis (Han,
(MW-9) in tle hiFocampus of
kindled
in tum, is involved in lhc convdioD of pro-BDNF to nahuc
sulting in TrkB
activariotr (Mizoguchi,
"r
at, 20ll). Th4e &n\€l!!
TrkB recepbs oreale hypddoitable ddtate circuits by induci!8
bra&hitrg (Koyama, er
ol,
2004).
BDNI
has
axonal
recdtly b€.n kno,rn to resrlat.
t26
NMDA le@ptor lcvels via CAMP
dly
al-,
rcspod.se
elddt
ed
binding p.o&in (CREB)
sro*th eponse faclo. 3 (Esr3) sisnaling in cnrtical neuons (Sedoval,
20lli Kjo.
",
et ol., 2012\.
Keping ir nind $e rol€ ofBDNT in elilellogenesis, we also .vallat4d th. efr@t
of isoxylilones on th€ extrsion level of mature BDNF p.otcin h veious brain
regiotr following PTzinduccd kindlitrg. We havc obs@.d that the kindled
animal! sxhibited sisnificanlly hider BDNI imunoreactivity in hippocamlus,
mygdal4
ir"eared
ed
corl€x regions as @Dpar.d to controls.
aninals show€d mdked rcduotion
hitpocanpus and mrtex regioB
d
i!
How4s,
isoxylilooes-
BDNT imunoreacliviry in lhe
@Bpared to PTz.kindled
lnioals md it
ws
alnost comparable to the Dormal oontroh. Based on ou observations, we suggesls
that
pntE3tnent with isoxyliton€s miSbt inhibil PTzinduced MMP_9 expr€ssio
and aclivity.
'nfs inhibition
in tum caus€s reduced NMDAR sclivitv leadinS to
fie
inhibition ofepil€ptogasis and BDNF prctein qlr€ssion in lhc bnin reSions ln
addilion, reduced
BDNI
expre,rrion might cdse dowuegulation of NMDARS
lbrclgh CREB ad Egr3 siSnaling.
We conclude that isoxylirofts
nislt cxln ib
effccts €ilher bv moditinS thc
signaling patbways of MMP-9 €xprssion o. by dowttr€gulaiing NMDAR levels
lhrough BDNF sigbaling, or bolh. Howcver, tunh.r studid at€ required to validale
rhis h}?ot]lesis. Morcovq,
it
wouL<l be
intesting to inve$igate the &nos or
t27
isoxylitoncs on rcuonal NMDAR-meniated CaF flux and cilcium
Long-tm
s)'naptic
th*
lrol€ins for pldticitv
c€[ bodi.r. Howev€t, scvcal othq kcy
BDN!
ar€ deliver€d at
are produced in
syMlsq in thc fom of silcnt nRNA
Tongiorgi, 2008). Borh in
vtto
arld
tt uto
wltere thcv
al
e
1993;
studies havc sbovn that siong
€pil€ptogcnic slimuli €.g. kainate, piloca$ine,
BDNF nRNA l€Yels
neuonal
lDolecules such as n'RNAi €ncoding
t"nslalcd locally in rdponse to sp.cific stinuli (Draguow. e,
inclsed
chatmels.
modilietiom rEquire dolivqy of ncwlv svnllFsired lro@ins
to alfecled synalsq. Most of
for
ior
md
eleot
ical kindling
@use
a! various subcelular sit€s Gom4 &ndrites'
iftrasc in BDNF
DRNA
oxpssion is mediated llroud NMDA ed !,kB recePtors activaliotr that
leads to
dos) in hippocmPal
inqensed
caf itriux
and @rtic!.I neutons. This
(Tongiorgi, et
al,
2004; chianuini, el
al, 2008)'
In fte presenr *udy, w. also studied thc cff@t of isoxvlitones on $e BDN!
mRNA exprcssioD in
$c
cortex lollowi!8 eleotrical kindling Tll€ rcasor for
seteting lhit rcgiotr speifically nds blsed ob the studi€s reponing spont4eoa
laine, higl excilability and eelv etivation of the conical neuroN in reslonse ro
el€.tical or chenical basolateral dvgdala kindlitrg (Mclntrc & Planl,
Aviym.-
et dl., 1989; Molngrc, er
ar,
1993; Litscber
1989;
& Ebcrl 1996) Ou dala
dmoslrated highe. exlr.$ion of tolsl BDNF in ki^dled eimals lttm conL{ls'
Isoxylilctrd tr€atmtul result€d in significrant redoctiot of totzl BDNI levels
i!
kindled anilnals
dd
lhd
did trot differ ftom controls128
BDNF gene contrhs len unique 5' utmnslar€d exons, each of which can be
individualy splic.d
to
IX thar conaais c.ding
lrproBDNF protein (Pruunsild,
exons with
?r
al,
2007). Alte.native sllicing of 5lnoncoding
qon lX rdulls ir differeot BDNF transcripls wiich
regulated in a t'ssuc s!@ific marner (TimmusL er
2005i WoDg, et
in l]lc
rl,
sequcocc for
2009). SiDce all BDNF
ri,
1994;
arc
ditr€re ialy
Panabime, r, at,
tr4oiPls contah
er(on Dq
preseni siudy, mRNA levels for lotal BDNF we|€ quanlified
th*fote,
uing
the
primen from son IX @ding s€quene. Thc difrerential oprc$ion of tanscripts
is associated with differeni BDNF leveh in fistinct bFin resions we exmined
the cxprasion of tlv€e imporbnt
BDNI taIscrilis (IIL lv,
and
\4)
it
order !0
fnd ou! if isoxylitoncs sullrcsser sme specific transcrip(s), tlercbv $!!less,ng
the roid BDNF mRNA levels in the @dex
We found rhal there
khdled
ud
wd
control
a trend for incrcased transcfilb
diMts
m
and
Metwem
and dseased BDNF betw.en kinded md
isoxylii,ons-tr€ated Sroups. However, the ovenll difference of€xpress'on w6s noi
si8nificant
fd
these trdlscriPls
morg thc
tls
groups.
Nevcrlh.l*, kindlcd
dimals exhibited a sienificant increNe in t sscript \al laels as
@nrrols.
Iae isoxyli.orcs tr€atnent did not significanalv lower
onped
lo
trdnscriPt VI
levels. Th€se findings suggest that isoxf,lii,ones did not affed individDal trescript
levels and
nay r€du@ tolal BDNF mRNA levels bv iterfsing sone underlvilg
noleould changcs ofBDNF sene expr€ssion o.g phosPhorylation ofCREB'
e1c'
129
FurL\ef studid investigating koxyliloD€s actions on
may plovid€ bener udersianding
isoxylitones reduces toi0l
of
BDM
signaling pathwa,s
underlying mechdisms
by
which
BDNI m?rNA levels.
Conclusion:
In conclEion, the cunenr srudy showcd that boxylibnes pose$ powqtui
uli-
epileptosenic activiry and itrhibil sodium chfinels
in
nmer.
steady-slate inactivatiotr by
Isoxylitonos stabiliz.s tbc
so.lim chmel
conc€ntlation-d€p.nd€nt
prolonging the develolnenl of ira.dvalion as well as recovcry fiom inacti'"lion
strre. Thur
he !.esent studies offe. a
isoxyliiones
botl
amut
it titro afi
reasomble mcchanism
of
expNion in vdiou! rcd.nt bnin rcsioN following kindling .l|d
'nolecula
BDNF and c-Fos studies suggcst
chanSca that
tlE n is lkely
lle
dd qF6
also afiecIs
induced duing
seim.
to posr€ss additional largets or
m*hatu5os. l-unhd srudres arc required !o valdar. rhe prcpGed
action at
of
in vivo. Hovevei, lhis melhanism may partiatly
for its etiepilcpic €ffecls. lsoxyliton4 supprsss BDNF
sme of d€ uderlirilg
actioD
rcc.lror lcvels i.c. CABA ard NMDA rec.!1o6 which
m*hdisN of
e
thought to
play a livotal .ole in etilepsy. Studi€s are ongoing to delermine $e refined
efficacy of this nov€l adiconvulsant compound, along with
bncity iqling
on
130
FUTURE STIIDIES:
o! ou iodings, it is suggdl€d di! iloxyliroDs hd s g@r pot@tiat to
B.s€d
d€v€loped a, a tutule AXD. How€ver, at
lhh
stage we
re
be
inlerested to fiLdler
explore ils phmacokinetic profile which may, in pa4 contlibule in raking tnis
novel
dticonwhot toqard! clinical triah.
Bsed on
(be elecliophysiological fitrdings, we atso sugg€st
liiat isoxytitones
prove eiticlive clini@Uy,
such a!
aduL
i!
rhe
colld
trearnsl of difficulcto_keat rconatat seirues
Lemox Cdtaul syDdrome whioh is ofren r."€atn€trt resisrj4
elilepsis. Unlikc benzodiazepincs which
e
used
tratnent of lamox sFdrome, iloxyliiones lacks
as
well
s
in
s fi6t line drDgs in the
sedarive and addictive side
etrecrs as@ialed with lhal class of drugs. Fuarc studie, &e requned
to prcve rhis
dd iherefoe
ir is also includcd in
N€x! we @ inrerested ro evatuale
Ca4
qtf
ed
on
qlciM
ou
tuture ptm
ofwork
rhe €ff€cts of isoxylitones otr NMDA_nedjan?d
ion ctEnn€ts. Moreover, the eff@rs of isxylironc al
recQtor levels specifically on CABA and NMDA receptoB are still unclee.
Iutue studics involving signaling pattvay of IfI4p_9
sigraling lalhways via CREB
ed
expression snd BDNF
Egr3 may provid€ valuable infomation for
additionai t rgeb ofisoxylitones ar molecut0r tevels. Furthq, we ae also
llming
to study ils €trects on clusrer differentiation mot€cules €specialty
which is
iDvolved
i!
Clt4
epileptogeDsis.
tJ1
REFERENCES
Aiken
SP,
Brom wM.
(2000) Trentnent ofQilepsy: existitrg therapis
3d
inte
de\el'rprr.eLts. F.oht Biosci. 5t 8124-52.
Akiyma K, Yanada N, Olsuki S (1989) Lasting inoreae in exoitatory mino
acid reccptor-nediatcd lollThosphoinositide hvdrolysi3 in the amySdala/Plriform
crrtex of mySdala-kindlcd lal,|.
,rri,
Xet 485(l):
95' 101.
CI, Leng MI, Syce JA. (1998) Altinicrcbial ed mticonnlsdr
activities ofviscum calense. J Bh'adwnacol 6l(3)t 237 4r '
A'nabeokD
Anneges JF, Roc.3 WA, Hause!
of$e Rochestu aidemiolosy
AvMini
G,
lreceschetli
VA
(1996), Causs of epil€Fv: cottribunors
prciecr. Moro Clin
Ptoc Tl(5r' 570-5'
S. (2003) Prosp.cts for Dovel
dtiepileptic drugs Cur
Opit Investis Dru8s A(nt 805't4.
N€won2(6)t 1525'34
Barde YA. (1989) Trophic faotoB md neronal survival
S' Cau P (199?)
Banolomei F, Gastaldi M, Mdsacrier A. Pleells R, Nicolas
I sodirm chmel alptE subunits
Ch&ses io nRNAs scoding sub0?es I,lI
ed
following kaiiate'itrdDced
ia fttbltr-jd J Nesocltol 26(10,t
seiz$
667
-14'
M, Lnbbert H, Numa S 0989) Differe isl reeulation of duee
during
sodiun chamel mesoger RNAS in li]le rat @tral nervoN s,stem
dovelopmeni ,n4ro J 8(12):3611'6.
B€ckh S, Nod4
Bmezon J, Kokaia z, EmIoF P' Kokaia M,
ncuronophin and ltk,A, tlkB and
Leda G
lrkc tvrosi'e
et al (1993) Rcgulation
ki6e
oi
'
rec€ptor m€sscngc' RNA
cxpssioo h kindiing [euosci s3(2)r 43346
Berkovic SF, Mullev
Jc' schctrs IE
inl€nctioD of smelic md
acq
'rired
Pedou
faatos Tle'h
S
(2006) Huma epilepsies:
N'tosci zg0\:
39t-1
'
132
B.msd C, And.Bon A, Becker A
Poolos NP,
Betk H, Ioblslon
D
(2004)
Acquir€d dmd.itic chainelopathy in tempoml lotc elilepsy. Science 305. 532535.
Benetta S, Rob€nson HA, Claybiel AM. (1992) Dopa$be atrd slulamate asotrists
srimulatc newn-specific op.4siotr
of F*like prctein in thc stristu$. J
Newoplt siol. 5At 767-777.
Benil H. (2001) lon Channels ofExcitable Membrar€s (3'dedi'non)
Mart:
Snd'
and,
SiwLW.73J.
Bialer M, Johann$sen SI, Kulferbers HJ, Levv RH' Pcruc@ E, Tomson Tl
(200?) Proer6s r€port on n€w aniielil?lic drugsr a sudnarv of lhe EiSlh Eilat
Confercnce (EILAT VIII). EP ilePsy Res. 13. L-52
Bialer M. (2006) New
dlielileplic
drugs lhat are
seco
gaoration to exisnng
63747
anticpileplic drugs. ErP€tt OPtz lwestg Dtrgs 13(6)t
'
Proppurg
Bierved C, schrocder BC, Kubisch C, Bc*ovic SF
P
'r "l '
(1998)
A
@ 279(5349)1403'6'
potdsium chmel mulation i{ neonatd human ?ilcPsv Sc&
lnd epilePsv: ioo
Bindd DK Croll SD, Gall clt4 Scharhm m (2001) BDNF
uruch ofa sood rhing? rr.ds N.vos.i 24(r\t 47'53'
GD, McNanua JO (1999)
Binder DK, Roulbort MJ, Rvan TE, Yanclpoulos
admiDistranon of
Sclcctiyc inhibilion of kindling d.vetolmed bv intravenEiculd
TlkB rec€ptorbody. "t. ?uorci l9(4Jt 1424'36'
Bindd DK, schstod HE (2004) Bdin-ddived neuotroPhic
Factorc 2Z(3)t 123'3t.
f^dil
Cto'th
P, Madeia M, MuBhoff U, SPeoknann EJ (1996) Etrects of
laevjs:
pcntylen.tctrMl on GABA rcc€ptos cxPr€ss€d in oocvtd of XenopN
1r5 ll8
ext a- and intlacellul€r sites of erior. Neltosci lztt zls:
Bloms-Funke
r33
Bossis G, Mahou CE,
Fal6
R, And€rma.lhq
DoM-rcgulation of cFoVqJu
API
g
Hipskjnd
R
er 41, (2005)
dimer aclivity by sn!j,oyl^n6. Mol Cell
Riol- 25(L6lt 6964-79.
K Pollad H, Chanon C, Mor€u J, Ben"Ari Y, Khreslchatisky l'1 0994)
dIGI, bFCF ald flg mRNAr show distinct paBehs of iniuction h the
Busm
hippoculus followinskainatc-induceds€izur€!.dJrve,ror., 6(1): 5E-66.
cabelli RJ, Hohn A, Sharz CL (1995) lnhibidon of oculd dominece col'lm
fomafion by infirion ofNT-415
'iBDIIF
Saie@e267(5204)t 1662'6.
catleBll WA, coldin Al, wame SC. (2005) lntmational Union
Phma@logy. )al-vll. Nom.nclaarc ed struohre-fucnoD relatioffhils
voftasegated sodium ohadets. ?ha,nocol Rer 57(4)t 397409
Caileral WA. ( 1999) Moladat prolc.ti.s of brain sodim chm€ls:
u
import Dt
r!.?er lor dticoDwharr dru8s. AA Newol.79t 441-56.
ches E. e, ar, (197) SluPtic
iMqvation dst.sity is regulatcd by ndron-.lqived BDNF. lv€tor $(2).25'1'67 .
cdsilg cG, closte. A Alolz & Bdji
SX,
Ch& MV. (2003) Neuotrophins
sd lh.ir rcceptors: a @lveigpre poid fd
nuy
Newotci 4t 299 -309
signallitrg larhways lvd|
Rev
E (2008) BDNI ERNA
tsrgeting to distinct hiPpocanpal
Chiafluitri C, Soneso I'4 Baj G, SimoMlo lvt ToDgiorgi
spli@
vdiors
lsiFq
disPlay acliviry-dcpendcnt
Mol cell Newosc| 31(l)t t t-9
M. (1990) Thc diffsential i!fllence of prc1ein
kinde inhibito.s on relinal dbor morphology dd eye-specific stdpes i! the ftog
Cline HT, Constuline-Paton
retinotectal system. ,ryruon 4(6): 899'908.
F.6q SE. (1995) Eff@1s of brain-ddived n@otrophic fetor o!
olric don brdnching ed remodelln} iLriw. Nawe 378(6553)t 192-6.
Cohen-Cory S,
B4
Collns TJ. (20071 tmageJ for [j.i,ctosc/Jpy. Biotecl$rtus 43(Suppl | ): 25J0.
ocitri
convetsi D,
by
s'st€o
C, Cabib S. (2004) Distinct
paftN
ofFos e.YFession induc€d
mphelrmine ir tie strirtd complq ofC5TBU6IICo ald DBATJTCo
c
iDbred strains of mice.
,ran
Xer. 1025(1-2): 59-66.
cosford ND, Meinle PT, Stauderman XA,
Hs
SD. (2002) Recenl
advdes in
the modulatiotr of voltage-gated ion channols for th€ lreatment of €pileFy.
bu*
Taryets CIIS Neuot Dkotd.
Cp.
L(l)t 8l-104.
Covmis A" Gupla AK, Jeavons PM. (1982) Sodium vnlproatei monol}emly and
poiy.]lqnpy. Epiteps ia 23(6): 693-720.
Cdgg GE,
dd
Newd
DJ, Sander KM. (1997) Natural lroducts in drug discovely
development. ./ir'at Prod 50: 52-60.
Cremer CM, Palomero-Gollagler N. Bidmon H-J, Scbleichtr A,
Spell'lm
Zilles K. (2009) Pdtyh.t6Fazoleinduc6d seizures all€ct binding sit€
fo. GABA5 glDtanate ard adenosine receplo$
h
lhe Er
E-J.
dtritis
bnir. NetBci 163(l)l
490499.
Cmnpton
Fdilial
Dq
Sclefier lE, Taylor I, Cook MJ, McKclvi€ PA, er
mesial tempoml lobc .pilepsy:
complexinheritdce.
cumiff
!
zl,
(2010)
benign €pilepsy slBdrome showing
B/at 133(ll): 322l-31.
IR" Aglieoo F, Rensanalhan M, Herzlg RI, Dib-Hajj SD,
wa]lM
SG.
(2001) Navl.3 sodiDrn cheuels: rapid rcpriming and slow closed-st
re
iDaclivalion display qumtitative differences aner expression in a mannalian cell
line
dd
id slinal setrory neuns, J Neurotci. 2l(16)t 5952-61
ClllmiB T&
w'sd
.
SG. (199?) Dornregulation of tetrodotoxinjdstanl
sodim cMmts md upregularion of a ratidly r€lriming tetrodotoxin s$itive
sodiDm curent in small spinal seruory neuons afrer
lerye lnjwy. J Netotcirl,
3503-3514.
135
Day HE, Kryskow
E\4 Nyhuis
TJ, H.rlihy
fea. bhibits efos bRNA dpression in th.
L, Carnlcau
@trrl
S. (200E) Conditioned
extended amygd^la. Brain Res.
l2z9t 13746.
de Bo€r Ht\4 Mula
epilepsy.
Epilew
M
Behav-
Sande!
JW {2008) The slob&l burd{ ad stisna of
l2(4), 540.6.
de Pasquet EG, GhiggiDo CW, Tol€do S, Tenze. SM. (1973) Hcmostlsis in
epileltic p5li€nb tr€ated wilh eticoanlsant dru8s. ,{cl4I€rtol Latinoan
l9(l-
1'tt 67-77.
De sano G, Palma E, costa N, l,'Iana
&
cratteri S. er dr, (2100) Efic.ls of
compoulds actiD8 on GABA(B) receltors in lhe !€nryleneletrazole
model ofepilepsy io mice. N, oophattucol
D€rDison
Z
dd
litrg
2141-61-
T€sk€y GC, Cain DP. (1995) Persistcnce ofkindling:
kindling, rcrenlion inteival, kindling site,
,Rer.
39(llr,
ki
ell.'t ofpartial
ltimulation Paledrlatdts EpilePt,
(3)r l?t-82.
A, Coatilza T, csboaara R' Dinddo MM. et al-' Q0t2)
Moteculd imigbls inlo the local esth€tic rec€ptor within voltase-gated sodrm
chmels using hydroxylated analogc off'ila'j]Lr,llLe. tuont Phamrcol 3t r'7 '
Dqalhy
JF, Dipalma
Drdgunow M, Beilharz E, Meson B, Lawlor P,
Abmh'll
Bnin-dcriv.d neuotropbic factor *lr€ssion
Netosci L.tt. 160(2)t 232'6
aier
q
Glucknatr P 0993)
long_t€m polmtiltion
Dnsuow M, Fall R (1989) Ite use of c-fos as a hetrbolic ma*er io leuronal
p6tv^! t^ci^E. J New^ci Metho.lr 290rt 261-5
Dragunow M, Robertson HA, Robedlon GS (1988) Anvgdala kindling
ed
c-fos
ptobtt(s). Exp Netot. ro2e)t 26t-3.
Duncin Is, Sander Jw' Sisodiya Slvt, walker MC. (2006) Adull ePilepdv ,arce'
367(9515):
1087100.
t36
Ernfors P, Bcngzon J, Kokaia
messmgq RNAS
for
Z
Lildvall O. (1991) Ilqe{scn
Pdsson H,
n€uot ophic factoB
l€vels
of
iD the b6iD duing kirdling
epileptosmsis. 1{.don 7(r): 165-76.
M. BDNI: (2011) Tl.link
F"tve Newol 6(rt 627-639.
Fahnestock
bctw€en beta-myloid md nemory loss.
Faingold CL. (1987) S€irues rduced by
corwiset
IE Gn, NevorNnXtqs
Huea
Fatini
N4 Rjvda
and
rpile/ry.
drugs. Inr Jobes PC, Laird
Pre$, Cfinolr pp 215-2?6.
M, Zuliei v, Kalnd cL, Vacondio F. el al., (2009)
diarylimidazole, as inhibitoG
2,4(5)-
of bNavl.2 sodiun clatlncls: l!'!ma6logi@l
evaluation and srruclure-pfoletty rcl^ti,or,lhi,ps. Bioorg Med Cheh. l7(10)t3642-8.
Imswo.th NR. (1994) Elhnophanracology ed drug developoqi'- Ciba Found
Sydp. 1E5.42-51.
Fehe PA, Yokoyma S, Dib-Hajj
s, Black JA, waman SG. (1997) sodium
ch&n€l alpha'submit mRNAs I, n, IIL NaG, Na6
ud
hNE (PNl): different
dprcssiotr panems in developing na nervou! system. 3.aitt R4 Mol
bai"
Res.
45(l):71-82.
Fisicl I,
Kacmek L.
evoked neDronal
dentarc
wN.
lrd*lin
San
(199?) Celluld ard molecular oonclates of glutmate-
progr{ued
cell death in tle itr vitro culturcs
ofnl hippo(mlal
Neuochen ltu. 3Lt 229-?40.
KBJ, Paxinos G. (1991
fte
Mouse Brah in Ste.otlxic Coordhat€s.
Dieso: Academic Press.
Fukuda K, \vat nabe J, Yasi T.
Walatma y, Nakdo lvl
er
al., (201 l) A sodiun
chMel blGkcr, pilsicainide, produc€s arial Pos!-reloldiatim rcftacto.incss
lbrcugh the rcducfion of sodiw chlmel^lajl ili'ty.TohokuJEPMed 225(lrl
3542.
Gal€
K. (1992) Role of GABA in the geiesis of cheEoconelset
Toxicol
ktt.
64-65t 411-za.
Gall CM, Berschder
growt
i€!
seiz!rcs'
IsackoD PJ (1994) S€izures bcre3se b6ic fibrobl4t
&
factor mRNA in adult rar foEbrah
ftrrons ed glia. Brub
Ret Mol
B'aln
2l(3-4): 19&205.
cal Cl,4Ieckor
P.| (19s9) Linbic
sdrc
incr6e
neurcnal production
mess€nger RNA for nerv€ sro1lth farjLot. Scierce245(49r9\t
Gall cM, Lautedom Jc, Gufirie KM, Stinis
cT
of
758'6t
(1997)
Scirc
and
!h'
Egulation ofneurolrcPhic faclor GxPressioD: associaliotrs witb slrudumr Phtticiry
b.pilepsy. Adt'
Netol
72t 9'24,
call cM.
(1993) Sei@itrducd chtnsd
irllicotioN
for epilepsy
in
rcurot'oPhin exprcsion:
Er" Nctol L2a(l')t 150'66
n
Gall CM. (1996) Cellular locakation of BDNF lrorein afld recundt $izues
EPilepsia 37
€vid€nc€ for uonal tssporl of the rcwly slDthesizld faax''
rat
(S!ppl. 5): 47.
C,ardiner 14
L.hdjoki AE
(2000) G.nctics of the epil€psie
ctr
optu Newol'
r3(2)t \51-64
cds
P, Fleischnam A, Hvalbv O, Jes€n
fta-l knock-in
l€mitrs
ifii
and normal
v'
Zaohq
C
"
4t'
(2004) Mice with a
th€ c-fos locus show inlan€d sPatial but regular
@ rrlual
LTP B.ah Ru Mol R'oin Res r30(l'2Jt L6-22
Gstddi M, Badolomei F, Massacier A, Planelb & Robaglia-Schlupp A' Cau P(1997) Increas. in trnNAs €nc.dins neonatal II ed III sodim chalT tcl slPliisofom dring tainate'ilduced scia€s in adult
rat
hippocanpls R'oia
Ret
Mol
Bruin R6. 44(2)t r79-g1-
G.uilovici
C,
D'ArfoBo
S, Poulter
MO. (2010) Divqse intdleuloo PoPulatioN
llE
have highly speoiflc
int't@m@tivity in the rc. pitifom conex. J Cottp 1'/€ool
518(9):1570-88.
Cmaro E, VcSgiolti P, Malace€ I!4 Madia F, cccconi M .t a|, Q003)
Fuitial severe myelonic epilelsy of infucy: tnrncition of Navl l and smtic
hetqoa.nerty. Epileptic Disd.l. 5ll),
AL Jr. (2004)
Georgc
2l'5
Inhe-rit€d Chann€lQathics Associated
lrilh EpilQsv
Epitepsy Cwt. 4Qr. 65-70.
Gifben ME. (199a) The phoomdolos/ of libbic kindling.
10(+tr
Iaicol Ld H.alh
343-58.
Gilbe.t ME. (2001) Do€s the kindling model of elilclsv contnbute to our
undeBlsding of nultiPl. ch€mi c l sEnsin.Lity'! Ant N r Acad Sc/: 9331 68-91Glausef T, Ben"Mmachem E, Bous@is B, cnaatl
A chadwi.kD
el dt.' (2006)
ILAE trlahcnt guidelitrc: evi&oc€-bud analysis of anti€pilQtic druS 'ffcacy
and effectiveness a, initial nmnotherapy for Aileptic seizws ond svn&orne!'
Epitepsia
qA.
Goddard
Gv, Mchryre DC, Lccch
n94-120.
cK
(1969)
A
Permanenl
function rsDlnDg from daily electrical stimulaiion ,&?
terol. 250): 295-330
cokl€n.sobn Es, Porter PJ, Schwadzhoin PA. (1997)
Society:
u
hktoric ldspective on 50
ycd
chuse in brain
'fte Amdi@ Epilelsv
of advanccs in rcse,ic\' Epilepsia
38(l):124-50.
Goodhan CS, Shalz CI. (1993) Developmdal mecheims that 8eD@le pr@is€
patteru ofneuronal conn€otivitr.
Gtugd
Ce
TZ
StppL TT-98.
P, Biton B, Fsure C, Vige X, DQoon re H, Gmhan D,
I{84
SZ'
S€llon B, Av.net P. (1995) Modulaiion of the gamma_nminobubdc acid t.f€ A
r€.eptor by the antiepilcPtic dlllgs carbmazepinc
47(O:
1189-96.
dd Pheovloitt
Mol
PhttMol
B9
cBvq rD.
(2006) lon chMels
od
epilcpsy.
OJ^l 99(4): 20117.
Crifilhs R, Malcolm C. Rilchie L. Irandsen A, Schousboe A. d/ al., (1997)
AssociarioD of c-fo6 DRNA ud exciloncity in prina.y coltures of mouse
nl:,Mrticrl and cercbclld neNns. J Newosci Rer. 15. 53342.
Hm D, Yanada K, so"rki K, Xong E Nawa H, Nabethina T. (2000)
Involwment of nitric oxide in p€nlylmctehzoloinducod kinuing in tnls J
Netoched. 74. 792-98.
Hattori K, Yagi T, Maekawa l"4 Salo T, Yuaa
s
(2001)
N'melhv]].spddare
induced c-Fos qpr€ssion b enhanced in the forcbrain structues related 10 enotion
in
tT-dcficiot mic.. ar4tr
Xer. 905 (1-2): l8E-9E
Hawklns NA, Madin MS, Frankel wN, Keam€v JA, Escavg A. (201 1) Neuroral
volrage-8ated ion clBonels are g€netic modifids of Soeraliz'n epilepsv l{itr
febrile leizurs !1u5.
Head
Xeuoriol Dir 4rG): 655-60
C, Gddiftr M. (2003) Pa$xvsms of exciieneni
sodium channel
dysfimdion in hein and bmin . BioE'savs 25t 9Er43
Heidch
C, Lrhteitren s, suzuki
I, Ane_Mdie
L, Huber S e,41, (2011)Incrcde
itr BDNF-me{tialed TrkB siSnaling Prcmotcs epil€ptogenesis in a mouse nod€l
m€sial lemlornl lob€
of
elilepsy Newobiol Dis 42(l), 35'41 '
Hill EL, Hosie S, Mt lige RS, Richedr KL, D'vi6 Pt et al''
(2011)
Temp€rature elevation increases GABA(A)-medialcd conical inhibition
mouse model of gcn€tic elilepsv . FailePtia
in
a
52(l)t 119-84'
currcnt
Hod8kin AI-, Huxt€y AF. (1952) A qua'titativ€ desodption of membree
ud iis applic4tion fo corduction ad excitdtion h nerve' J Phtsiol' ll7 | 50044'
J Hosp Pharn
Holrnes GL. (1993) Critical issucs itr the Eeatrnot of epilelsv Am
12
(Suppl5): 55-16.
140
Horch HW, Kriittgcn A, Portburl SD, Karz LC. 0999) Destabiliation of @nicat
dendrits
Huang
ed
slines by BDNI . Neuor 23(2)t 353-64.
cW, Huang cC, Lin Mw, Tsai IJ, Wu SN. (2008) 'Ihe
synersistic
ed
potassiun
intibilory actiotrs of oxcarbazepin€ on voltage-gat€d sodium
cun€nls
in diffe.entialed NC108-15
Newopsyc hophamtcol I
l(r,
neuronal
(rlls
and model
neuoN
l,l J
597'to.
Hubel DH, Wiesel TN. (1965) Binocule ilt€raction in sEiate cortex of kir.ens
r€ared
wth anificial
Hussain
squint. J
Netophyriol. 28(6)t l04l-59.
N, Flunerfet BA, Rajatund
N
(2001) Glut matergrc regulation
of
halopdidolisduced c-fos cxpr€ssiotr in the mt slriatuar and nucleus accubens
Newosc| lo2Qrt 39t 99
Isackon PJ, Hunirme l\rlv! Muroy KD, Call CM O99I) BDNF mRNA
exlrcssiotr is increased in adull d forcbEitr afier linbic seizutEs: l'mPolal
patterns of inducdon dislincl
Isom
LL.
fion
NGF . Neton
6(qt 91148'
(2001) Sodium cha$El bcra subuts: arlthin8 bul auiliarv'
Newoscvntist 7 (l)t 42 54.
J€nlsch TJ, Ilubn€r CA,
!'uhmm
JC. (2004) Ion
chdels:
tunction unavelled
by dystuncrion. ,Yr&E cetl a iol- 6| 103947 .
edition),
Kddcl E& Schw.rtz JH. (2000) Priffillcs of Neural
Ncw Yo*: Mccr'an-fill pp. 154-69.
Johnson
M& Miltr RL, Tom-Br@6 Y, HoPper JL'
Jesscll TM,
Scienca (4$
Schetre' IE, Berkovic SF'
(2003) A twin study of s.netic influencs on epilelsv outcome. Tvih Res 6(2)l
140-46.
Jones
K&
Rcichardt
LI.
(1990) Molecutar cloning of a humtn gmc that is a
momberof$e nefle sroMh factorfmil!. Prcc
Na AcadSci
87(20):8060'64
l4l
Kabn SM. Rnjaramd C, Rittey C, Zaki HS, K€meny AA, McMu[an J. (2009)
vagrs
rde
srimulation
in
childeD wilh intractable epiloply: itrdications,
comlliq1io6 ud out(ma Cntldr X€n
,'rl'
25(9): 1097100.
Srymczak S. (2002) Matrix
mctalloproteitracs in the sdult b6in physiolos/: a link bctw@ eFos, A.P-l ed
Kacmdek
L,
Lapitska-Dzwonok
J,
rcnodeling of neuonal conoe.nons2 EMBO
J 2r(24)t 664348.
Kaloh-scmba R" Takeuchi lK, InasMa Y, Ito H, Kato K. (1999) Brain-derived
neuotophic factof,
nw. grcrlh ed leurot ophin-3 s.l.ct
bain following kinic acid-induced seiarc aclivii) . ,Veooici
d regios ofth€ ml
Res.
35(lr. 19-29.
Kelly ME. (1998) Ihe kindlhg nodcl of temloral lobc epilePsv ln
N.wophamacoLag) Methob in Epilepsy ,Rereatc, Ed Petcson SL. ed
Albertson TE. P!. 4l-?5. B@ Rs0or CRC Pss.
Kemeny AA. (2001) Surgcry
fd epil?sy S?rd.
10(6)1 461-65.
Khatri I-A, Iannaccone ST, Ilyas MS, Abdullah M, Saleem S (2003) Epide'niologv
ofcpilepsy
Ki€ssling
i!
Ptkisran:
rcviw oflit@t$.
N! Gals P. (1993)
J Pak Med
Asoc 53(r2)t
lmmediate e3.tv gene exp!€ssion
i!
594'7
experimenlal
epilepsy. Rrcia Pathol. 3(4rt 381'93.
H
Y, t^au GC, Broolc'Ktyal AR. et al , (2012, Wan'
derived reurotophic faclor uses CREB ad Egr3 to regulare NMDA r€cepior
Kim IH, Rob€rts DS,
levcls io conical neuloDs.
Kniyanant
\
JNetochen. L2oQ)t210-19
Kiriyannd Y, Sveods€n cN, ftBnSniPon W. (2012) BDNF IGF-
and GDNF{@reting human neual prog€niior cells r€scue
mvloid
l-
'
P-indu@d
roxicity in @hred rar septd nl:mN. Neuochen R6. 37(l). 143-52.
KI€e
M&
strycbninc
Shirasrki T, Nataye T, Akaike N, Melikov EN. (1992) Intdactiotr
dd
bicuculline with GABA- and glycin€-inducfd chlo.ide
of
csots ir
t42
isolared CAI oeuons.
M.J. (Eds.),
KosDan
In: p
eprl and
iribitiM. Sp.ddrittt EJ.
and Gutnick
Urbd und Schw@edersz Miinch€n, pp. 93-106.
JP,
Blomqvilr A. (2005) forebnir p.lenE
duins cucer-ssociated anorerda-.achaxia D
n1-
ofcFc
Et
aad
168 irdu.tid
J Nesros.i. 2r(r0r, 2752-
66.
Koyada
&
MIi Fujiswa
Yamadr
S, Katoh-Semba
&
Matsuki
\
IkcBaya Y.
(2004) Brain-derived neuokothic factor induces hlT€rexcitabl€ rc'eltrant ciEuits
itr &€ d.fltaie gl.us. J
lleodcl
Krsek P, Mikuleokt A, Drug.
24t 7215-24.
&
Kubov6 H, Hlindk
z
er
al,
(2004) Lons"tem
belavioBl and morphologicrl conlequdc€s ofnonenvdsive st.a$s elilePlicur in
ftis. Epitepsr Reha'.
hbe
sp)t
1E0-9t
D, Murphy J, Te.oma E. (1999) va€ls new. stindatioD for mediclrioD-
resi$ant g€n€.alize.t .Pil€psy. 804 \'l'{S Studv Group.
Luol
52(7): 1510-12'
riliDer Drt4 Butler LS, cao Z Hosford DA' Shh c, McNam@ JO
(1993)
Induction of efos nANA by kindled s€izurer: @mplcx rclalionshiP with neuronal
bwst f]tring. J Nesos.i. l3@\t 744-51
Lthteinen
Decreas€d
S, Pitk?rn€n
A, Saarctrinfl T, Ni$sinen J, Koponen
BDNI signallilg in
NtuNci rs(l)t
E
Cast€n E (2002)
transgenic mice reduces epilQtogenesis
tr
J
72t-34.
v, vald MM (2006) The Aid€miolos/ and imlet
injury: a b.i.t @@iefl. J Eedd TtoM Rehabil. 2l(rt 175'8.
Lanslois JA, Rutlatd-Brown
of Eaumalic b6in
LaunEen I, De weillo
I&
Lazdunski M. (1997) The gotassiurn ohainel opcna
(7)-cromakaliFl prevenLs ehtanate-inde€d @ll desti in hiPpocanpal ncuons../
N.w@htn.
L6
69
| 1570- t5 79.
C, Leach MJ. ( 1993) Siudica m the mechmism of action of the novel anti143
conrljlsdl lamotigiDe (Luicral) using
.oiex. 8,oin
Res.
!rim]
neuologcal ouhu6 &om ar
6r2(r-2)t 190-99.
Lcidenleina NJ, Broming MD, tt
ris
RA. (1991) GABA
phosdofylation: multille sil€s, actions and artifacls.
A
I/€rd Phamrcol
r@plor
Sci. 12.
84-E7-
L.nkey N,
Kmly
inhibirors
to hperpolarized and delolarized
R,
Eprai N, Vizi E, Mike A.
Neuophamacol 60(lrt
19
(201
l) BitrdiDs of sodiu claflrel
conlodnations
of 0E ch@el.
l-200.
Lconed BE. (2003) Fundmentlls of Psychopima@logy, 3rd ed, Jobl Wilcy
and
so6, Chichetcr. Pp: 295'18.
Leweke
Fl4 Louvel J, Rausche G, Hehemarn
n.uonal activity
ed
slie.a. F.pilepsy Res.
U. (1990) Effe.ts
ofp.det"zol on
on odncellular calcium corc&ntation in mt hippocmpll
6t 187 98.
Liu H, cldcy C, Cornier J, K.ss R. (2003) Muratio$
i[
cardiac sodiun
chrmeb: clinical tnpfic{tio$ . ,4h J PhorDacosenonier 3(3rt 113-79.
Lopcs-cends L (2008)
fte
gmetics of€pil€psies. JPed,?rr (Rio I). 84(suppl 1):
s33-9.
Loschd W, Ebert U. (1996) The rcle of th€ piriform corr.x in kindlinS. p'og
NetobioL 50(5-6\:
427
-8r.
Loschs W. Hitnnck D, F4sbenda CP, Nolting B. (1991) The rot€ ofre.hnical,
biologi@l
md
lhannacoloeicd faotors
in the
laborltory evalualion of
eliconrdsaDt drugs. IIL Pentyl€rc&rrdzolc seizue rnod€ls. Epile?ry nej. (3):
l7l-89.
re selectivc
inhibitior in culror€d nmalian
M&Donald RL, Bark r JL. (1977) Pmtyt.neteruol and pcnioillin
antagonists
n
uffi.
of GAgA-mediated post-synapric
Ndtue
267
| 120-21.
t44
Maisonpiene PC, Le Beau
SM.
'r zt,
MM Esinosa
R 3id. lp NY, Bclluscio L. de la Motrte
(1991) Hlllt@ and mt brci!-dtrived neuotrothic factd
go.
leuotrothin-3:
strucnres, dbrributioN,
ud
ed
chrcmosomal locrliatioDs.
Genoni^ r0(3)t 558-68.
Malcay G, Moln{ P, Grubq L. (1994) Col@oa Dods of actio of
s aId pdtylenetetzzol od the GABA A
butyrolacton
g.|re-
rccrptor-iotropboE
@npt
x. Et t J
Mditri
C, Harvey AS, ?€lekmo, JT, Berkovic SL (2003) Epilclsy in offsprins
Phamacol.258t 6148.
of
whon both p@nls have idiopalhic gcncralized elilepsy: bi?arenlal i.hqilanc€.
Epileps ia 41(9). 1250-54.
Mdry 3, Cdoll
neuotrophic
P, Cclldino
f&tor
A. Catran E, Stligd V.
prornotes
rle
diffcrentiaiion
er
al., (1996) Bnin daivcd
of
various hippocampal
nonplranidal n€urons, including Cajal-R€tzius c€lls, in o.sanotTic slic€ cuhrcs.
J N.wosci. L6(2tt 675-8'7 .
M4|on CR Coop€i Rrt4 (lq?2) A !.flDrrcrr clrange in c'nrulsive UuEstotd ir
nomal ild bain-dMaged Els wirh r.pcared snul doses oI p€nq,le&tera"ot€.
Epilepsia r3(5)t
663 -1 4.
Mattson RH. (1995) Efii@cy
etiQiloptic
md advlrse efi@rs of
esi.abtisled
ard n€rr
dru8s. Epll.psia 36(Suppt 2): 313-26.
McAllister AK, Lo DC, Katz LC. (1995) Neurorro?his rcSulaae d€a&inc grc*1h
in developing vhusl corlex.
Mclntyrc Dc,
,Ve
bon t5(4)t 79t-803.
K.lly ME Amrtrons
JN. (1993) Kindlins in rhe
lerifiinal
codex.
Rruih Res. 615(r\: t-6.
Mclntre DC, Kelly ME. (2000) 'IrE parahippt)(mlal @nic€s ad kindtitr&,4e
N
Y
Acad Sci
gttt
343-54-
145
Mclnr)'r€ DC, Plad IR. (1989) Piriform conex involvenmt in kindling 'vet?o'ci
Biobehe
Ree.
r3(4): 277'Eo
Mclnlyre DC, Plant JR 0993) Lotrs-lastins chanss in the ongin of sPont$€ou
dnchuges eoft anygdala-kindled mls: Pirifom vs pdirhinal cortex in vitro'
bain
Res.
624(r-2)t 268'7 6.
and some new
Molntyre DC, Poulter MO, Gilbv K. (2002) Kindling: som€ old
Epilery R6. 50(l-2)t 79-92
Dw, Shin C, Cnin BJ, Gellman RL' Ciacchino JL
Clit
TIle kindlins model of clilelsv: ! criticll rcvi*- CRC Ctt Re'
McNamam IO, Bonhaus
(1985)
Ne* o b i o 1. r(4') t 3 4 1'9
1
McNam@ ro, Huds YZ,
L.rndd AS
uderlying epileptog€n*b.
Sc i
(2006)
Moletutd sisnaling m@ha$istr's
STKf (356, rc12
kindling developmenr
McNanan JO (1995) Analvses of the flolecular basis of
Pr/chiatry Clin
Netosci 49Q\t St75-E'
M€ldrum BS, Rogawski
ddelo4lr
Meldm
MA
Neqotheraped
rbs
(2007) Molecular lagets for dtiepilePtio drug
4(r): 18-61'
BS- (1997) Identificalion
a
pr@linical te''ting of novel antie9ileptic
@mpouds. tPtlepta 38(SqPl 9): S?-15.
l,,tbre TI! ApPlegale cD. (2003) Pesisted reeionar incr'ase' in bmin'd'lived
de depmd€itt uPon
neurotophic factor in the flurolhyl modet of epilcPtogenesis
the kindling statB of thc
uiml. Nesotci l2l(4\t lA3l-45'
epil€psies: clini@l
Michelucci R, ?asili E, Nobile C. (2009) Late'al temPoral lobe
@d g.nehc
fohG.
tPtilePrta 50 SqpPl 5: 52_4'
IM
Milsilostas DD, Sechez del Rio M, Waober C' Moskowilz MA' Cuh€r
cfos
( 1998) Thc NMDA @ePtor mbgonist MK-80lrcdu6 capsaicin'induced
46
expEston witbr nt ErgemioalDucleu caudalis. PaD 76(l-2):
2198.
I, Tachib&a M, lbi D. Someya E. er al., (201l) Malrix
metalloprcrernase-9 conribures ro kirdl€d seizur.
Mizoguchi
tl,
Nakade
pedylenetetr@lqtreted mi@ by convedhg preBDNF to natur€ BDNI in the
hippocamps.
"rlr'erorci 31(30:
12963-71.
Monjc P, Hemtudez-Losa J, Lyons RJ, Casrellone MD, Cutkind JS. (2005)
Regulation of the naffcriptional activity of c-Fos by ERK.
prolyl isoD.me PIN L J
Ad
Chen. 240(421: )504i-E4
.
Moreni P, Pete6 SU, D€l Gaudio D, Sahoo T, Hyland K.
.t
d1., (2008)
Brief
repo.r: aurisdc symptons, developmentd rcgrcsioq mental ret&dalion, cpiLlsy,
and
dyskin6i6 itr CNS folate defpieacy.J,i{ttbn Dd Disotd tE(6), ll70-7.
Morgan JI,
coho DR, Hemlst€d JL, Cunu
T. (198?) Mapping
!.rem of
evrcss,on ib fie cerlralnenob rJskmanerseizue S(rerce 2.17:
Morgm JI,
c!ru
c-Jar
lq2-9?
l
T. (1991) Prctconcoscre tr@criltion factos md elilcpsyl
Trendr Phdtuacol Sci. l2(9), 34349.
Morimoto K, Fannestock M, Rrcine zu. (2004) Kildling ard statu epilepti.u
models of epilepsy: rewiring the btu;ttt Prog Netobiol.
Mulley JC, Schetrer
genctic cause
Mycek MJ,
Ig
73(l\, l-60.
Pebou S, Bqkovic SF. (2003) Chmelop.thics
,s
a
of€lii€psy. C4. Optu Newoll6(2)t 17l-76.
HNey RA, Chmpe
PC. (1997) Lipincott's illustrated reviews:
Pharmacolo$/. Philad€lphia: Lippir@rq
Willim & Wil}irs.
Nai. PP, Kalita J, Misra uK. (2011) Slalus e!;lepricusr why, what,
ed
how.
J
Postgtud Med s7(3)t 242-52.
Ndda SA, Mack XJ- (2000) Seiarcs ald
senso.y sliDulation
Mux in differmt
pafteG of blain derived nemtrophic facror prctein expression in the barel correx
od
hippocampus. B/art,R€r Mol Btuik
R4.78(l-2)t
1-],4.
Olser RW. (1981) Tte GABA posBFapric mdbrane
receplor-ionophore
@nplex. Sit€ ofacdoD of@nvulsut and adicotrnisat drugs . Mol Ce Biochzn
39t 261-79
Pmayiotopoulos
Ct.
(2011) The new ILAB rcpo.t on lerminology and conc€pts
for organizalion of etileltic seizNsr a olinician's crilical
Ep i t eps ia 32(12\ | 2
|55
viq ed contribulion.
-60.
Pattabiraman PP, Tro!€a D,
Chiettini
C, ToDgio.Bi
(2005) Neuonal rctivity rcgulate thc dcvclopmmt
q
l
CaMneo A, Domenici L.
expresion .nd sub€.tlulu
lo@fizat'on ofcodical BDNF mRNA isofoms in vivo. Mol C.U Newosci.2S(3)l
556-',70.
Pdinos G, Walson C. (1998) Tle Rat Bain in Slereotdic Coordinales, Foulih
edinon. New York: Acadcnic Press.
Pljll@ JM. (2002) Brcnid,e, the
Ne@stt Pryhiatry.
72(3)t 412.
Pellock JM. (2002)
Tetnont
fist
effective dtiepileptic agmr.
J Neool
@nsidedtions: tradiiioml dtiepilcpric di€s.
Epiteps, Behd. 3(6St): t8-23.
Pellock JM. (2002) Tricyclic an|iconwlsanlsr safety aDd adve$e effectl.. Epitepsy
B.rar. 3(3S)r Sl4-sl?.
Penry JK,
Nclrma* ME. (1979) Thc
usc of anliQil€ptic dtoe;s.
Am h en Med
90(2):207-18.
Penry JK,
Poft. RI.
(1979) Epilepsy: mcchuisms and thempy_ Med Cti, Nonh
An. 63(4tt 801-12.
Pm@
E,
Kwe
can be avoidcj.
P. (2005) Oveitr@tmcnt in epilepsy. How
it occus srd how ir
CNsDtug' 19: 89?-908.
148
A
fitkNnen
Lulasiuk K. OoU) Mechanisms of epileplogeoesis atrd potential
lle€imenrwgets. Loncet
Netol
r0(2): 173-86.
Pruuniild P, Kaza seva A, Aid T, Palm K, Timusk T. (200?) Disseotins lhe
hunan BDNI locus: bidircctional trdrcription, compl€r( splichg, and multiple
promote$.
G.Dri.r
90(3): 397{6.
Pulsipher DT, Seidenberg M, Guidotti L, Tuchscherer \4,1, Morl,on J. er al., (2009)
Tbalmofrontal circuibf and ex@uliv€ dystuncrioD
myoclonic cpilepsy. EprLprk
50(t:
in
recent-onset juvenile
1210-19.
Pwes D, tuddle DR, While LE, cutietM'Ospina G. (1994) Neural activiry ud
ijle dEvelopnor ofth€ somatic s€nsory sysiem.
Racine R.
(r
978) Kindling: the
f6t
d@ade.
Cql Op,t Netobiol. 4(l)t
NeuBtgery
Rncine zu. (1972a) Modification of seizurc
Afrer'discharge threshold. t&ctloehc.phalogt
activit by
l2O-3.
312\t 23+52.
elect ical stinularion. I.
ctir Newophytiot 32(3)t 269'79
Reine RJ. (19?2b) Modifietid of $i4re activitv bv el@trical stimul.lion II
Morot
t
Rados
c. (2005) Epilelsy rnd
iznc- Ekcnoen ePha@ Clin N.toPhvsiol 32(J\. 28r-94
seizures can occu| at
dv
age FDA
co$un 39ls)l
3l-t.
Rrivich C, Behr€Ir A. (2006) Rol€ of th€ AP-l htscriplion factor c-Jun ,rl
develolins, adult and injured W^n. Ptue Ne robiol TE(6rt 347'63.
R.j D, Gulali
S,
Lodh. R (201l) Status cpilepticus. tutan J Pediat.78Q)t 2r9'
26.
R khade SN, Ieson
lE.
nehanisms.
deuol
?r'ar
,Rd
(2009) Elilepbgenesis in lhe immatue brainr emerSing
5(7): 3E0-91.
Rme HP, Dale MM, Ritt€r lrvl Moorc PK. (2003) Phmcolog/, 5d cditiotr,
Edinbugh, Chuchill Livingstone,
!!
550-93.
t49
Rda M. Shan@ F, Choulhary ML R lhm AU, Sonbati S, Delorenzo RJ
(2002) ln viho inhibiiiotr ol pe yleneletzole md bicuculline-induc.d
epil.dfom activiry in rat hiFocampal pyamidal neuroN by aqEos aac{on
isolatd from Delphin'urn denuda$m . Neaosci 12fl. 333(2rt !03'06.
Raza
M,
Shaheen
F, ChoDdhar/
M,
R lman
AU,
Sombati S. et ol., (2003)
Anticonwlset effect of FS-I srbfiaction isolat€d fiom roots of Delphinim
dsudatwn on hippocepal plaeidal neuroB. Pi"to,r?' ,Rer. u(r): 36'41.
Riza M, Shaheen F, ChoudlDry
M,
Sombati S, R
fiq A-
.t al,
(2001)
Anticonwlsul aclivities of ethdolic exkact dd aqueous ftaction isolaled ftom
DelphiniM ddudatum. J rrr,rp hertucoL78(l)t 13-E.
R 2a
M,
shaheen F, Choudhary
Ml,
Sombati
s, R
tu
hippocdlal
(2004) Inhjbition ofsusiain€d repetitive firin8 in cultued
an aqueous ftaclion isol&led
ion
n AU, Ddireizo RI.
DelPhiniDn d€Ndanrm
neurons bv
J EthnoPhomtcol
90(z-3\t 367-74.
Ra
M, Shahe€n F, Choudhary
M,
Suia A. Rlhll@ AU, Sorrbati S, DcLoEMo
Anti@ ulsad a.tivilies of th. FS-l sultadion
D€lphinium dcnudatum. ?rlrrthet Res. l'(s)t 426-30
PJ. (2001)
Rehavi
lv! Skolnick
diazpe
P, Paul SM. (1982)
bhditrg in viEo:
@lation
Etr.ts oftet
isolated
2016
iom
rools
of
dcrivativs otr [3t{]
with @Nrlsam potcocy- Eu
JPra.m.ol
7E:153-56.
Rcprcsa
A, Jorquera I, I-e Gal
collaleml spmutinS of
li
Sall. G, Ben-Ai Y. (1993) EPil€lsy induced
hippMpal
mossy fibers: does
il
induc€ the dwelopment
of ectopic slmpses witlr g@ale @ll d.adtir62 Hippo.adpus 3t 251-68.
tuddle DR, Lo Dc, Katz Lc. (1995) Nl4-'nedialed rescue of lateml geniculele
neurors Aom efiecls
ofmonoold
deprivalion.
,V4rr.
37E(6553): 1E9-91.
150
Rocha L,
AckeM
RI, Engel
J
Ir. (1996) Cbionic dd sin8l. adniristrdion of
penMenclltrdzol modifi es bcnzodiaz;lbe rcc€llor binding: ar autondiogmphic
sttdy. Epilepq, Res.24(2)t 65-72.
Roga*ski MA5 Ldscher w. (2004) 'fte n€uobiology ofadiepilcpric drugs. rval
s0)t 553-64.
Rer Netlrosci.
Sagar SM, Sharp FR, cunntr
T. O9E6) Ex!6sion of efo6 prcteh in bnin:
metabolio maFing at the cellular level. Sc&ace 240(485?): 1328-3
Said HM. 0970)
Hddltd
Pbamacopoeia
of E4ten
l.
Mcdicire.
Hddrid
Narional louqdation, Times ftcss, Karachi, Pakistlr, p. 49.
Samrdn EB, van
Duijn CM, Christiae$ GC, Hofma! A, Lhdholt D.
Antiopilcptic dne regim€m and
Atu NetoL
46(rt
mjor coIgerital abnonalities in
099)
the offspring.
739-46.
Sande. JW. (2004) The
lse of dtiQileptjc dlugs--!{incipls dd
pnctice.
Epilepria 45 Suppl 6: 28-14.
Sddoval R" Gonzllez A" Caviedes
Homeostatic
fac.or
dd
nwns.
J
d
Paacttti F, smalla KH. er a/., (2011)
NMDA receltor doM-regulalion via blain d€rived rcurctrophic
niEic oxidodelendcnl signalliaS in mnical bul not
ir
bippooaD!.l
Netochen. Lr8(S)t 760-72.
Scharfina HE, Solb
Al, CoodE6
JH. (2002) Stodatr@us
t@nqrt
seirc
afie. piloca4ineinduced status elilepncu activatc calbindin-imunoreactive
hilm cells of lhe ml d€ntato S/rus. ,V€qorcr:
Schreibef SS,
Mden
S, Tocco
c,
coreLation between the inductior
'
imediarc @ly goe. Bruin
Res
lrr:
7l -81.
Snols TJ, Thompson RF.
of
(l99la) A negative
long-term lotentiation and activadon
Mol Btuin Res.
ll(L\t
of
89-91.
Schreiber SS, Tocoo G, Sho6 TJ, Tornpon RF. (1991b) Activation of irunedial€
€rly
gones
!frq &ure
srtess.
Ne@orepo
ZrlT-2Q.
l5l
Schroder H, Becker A, Losstrer B. (1993) clurmnaie bindirs ro brain nembroes
is ircrc.sed in pmtyleretetrazole-kindled rats.
Schroder
H, Schlichthaar & I(rrg M. (1994)
J1r'rrocr"n. 60: t 00?,1 t.
Changec
of glutamatergic slnalric
mechanisns after ?TZ kindline andLTp . Nerro\ci. 60t 33,1-42.
Schlo€der H, Becker
pentylenetetrazol
atrd
A, crecksch G, Schro€der U, Hoelh V. (1998) The elled of
kindlilg on synapric mechanisms of intemcring glutanatergic
olioid syslem in $e lippocanpB ofFr. B/ai, rtar. 6 tt(t_2)t 4046.
Sharz CJ. (t990) rnputse acnvity md rhe pad€ming
ofconn@tions during CNS
6ev e )opma)t. Ne u oh 5(O: 7 4 5 _ S 6.
Shau FM, wei-Hua C, chrisiolhd JM. (2004) DoEomedral
t'olhdamic ard
bainstcn parhways contro ing tiermogoesis in brcun
adlp ose nss&-. J Thet@t
Aiol.290-6)t333 31.
sheelani M. (2005) Devetopment
of
pok
in Pakista. J
Med ,4soc.
a
compr€ho5iv€ elrlepsy sugsy programne
55(t)t 32-7.
Sheeb PL, Cara Heels, Thomas Sb€hr,
and Therdore R. (200s) Culnmins
Differ€ntial Block of Sensory Neuronal
Votage-Carcd Sodilun Chmels by
La@^sanide(2R)-2-(A.arylaniao)_N-benzyl_3,nerhox)"ropanuidel,
.nd cAtb^na4pine. J pha,h@t
Shih
YE
Yed
Atv!
ya
posioperarive seizue
Lid@aine,
Ep
Thef, 326(\)t Sg-9g.
DJ, Hung Lp,
clssiliaton
che HH, Liou
HH. (20rr) A nover
to. long,rcm mortatity of parienrs
wirh
int actable epilelsy: compafton
with rhe Engel systel!'.
14.
Netostsery Sg(rrt
64-
Stu
RS, Anisman H. MeBli Z.
Mctnryre DC. 1200.)) Changes in
exr.?cellutar
levels of any8dala amho
acids in sen€ncotiy fasr ud
slow kiDdlirg rat srains.
Brcin Res.916(rr, 3142.
152
Simjee SU,
Shatd
F, Choudhary
Kabir N, AslL.af N- (201
in
M,
R lDan AU, Jalmu S, Shah SU, Khan N,
l) Supression
or c-Fos Protein and nRNA Exprcssion
PentyleneletreolelDduced Kindled Mouse BEiD
,{euorci
Dec 15 tEpub ahead
by Isoxylilones. J Mol
ofprinll.
Simonds MA. (1982) Cbsifi@lion of sone GABA etagodsls wiu regard io
site of action and potenoy in slic€s of
nt
cun.ate nucl€us. Eur J Pharnacol. Wl
347-58.
Smit} MC, Bleck TP. (1991) CoN,ulsive disrders: loxicity of attioonvulsets.
Clin
Newophtnd.ol. l4(2), 97-t
15.
soanen V, Bayba! S, Dnic@ A" Kokal A, Ozturk M. (2011) Frequency of
epilepsie in fanily membeG of pancnrs with diff€.ent epil€ptic sytrdrone!.
Spencer SS.
,u
(i986) Surgical oltions lor unoontrolled epilepsy. Newol Clk. a0)l
669-95,
Squire RF, Saederup E, CEwley JN, Skolnick P, Paut SM. (1984) Convutrer
potencies
of
tekazoles
ee hjghly coselar€d with
actions
on
CAB.drberodi@pine/picroroxi, reccptor comllexes in br^ih. Life Sci. 35. t439-
Stariuk)iien€ V, Pilvink V, Reineadi.ne D, Jdauskaite
seizus in crilicaUy
sulula T, He
)O(
iU pati€rb.
L.
(2009) Epileldc
tledicina (KarM). 45(6)t 5Ot-01 .
Cavazos J, Scon
c.
(19EE)
Syllptic R.(gdizdion
b
dle
hppocampus induced by abtromal tundio@l activiry. Sc&rce 239(4E44r. tt4?_
50.
ssuon Lw. (1993) Blab
Ma!s: Stdchje ofth€.at br.in. Amlerd.qe: Ehevier,
pp240.
t5l
Swiryaid EA, Tomd JE. (1950) A
som€ phenylhydantoi$
Ep
ed
compdis of fie tuticotrwlsdt actio6 of
lh€n @reslonding phenylrcetylw?a J Phomocol
net. [nQ): t5r51.
Tm NC, Berkovic SL (2010) 'Ihe Elilelsy C€netic Association Database
(AiGAD): @lysis of 165 senetic association studies, t996-20os EPitepsia
5l(4):686-E9TeLlez-Zenteno JF, Sadsnand V, Riesberry Nd RobiNon
(2009) Epilepsy sutscry
recu€nt
status
ir
d|e elderly: an
uEual clsc of
CL,
L
Oai.edo
et
at,
me with
a 75-vear-old
epil.llicus. EPileptic Dtsord Ll(2)t 144'49
Tqnkin NR, Je€ll AD, Ande6on GD. (2001) Antiepilep.ogoic age s: how close
de we?
D/,sr 6r(8)1
-Ito€nen
1045-55.
H, Bedc YA. (1980) Physiolos' of
ne
e Srosnh
k
tot- Phrsiol Rq
60(4):1284-335.
Tir0mu5k T, Belluedo N, Pe$son H, Melsis M. (1994) Developmenral resulation
of btuin-denved neuoaod c facior m€ssens€r RNAS transcribrj fton diftermt
promolers in the rat brai!. dellrosci 60?rt 281-91
Timofecv I, Ba?nsov M, A\trmescu S, Nita DA. (2010)
{re roles of synaltio platicity . Netroscientist
Tongiorsi E, Amellin M,
Giuliani
rdi6.vents
that tdgger
dd
ePilcPsy:
19'27 '
PC, Bresola G' Zu@hini
Bmitr-derived neurotroPhic factor mXNA
rrd<trilic
l6(l\t
Posttluatic
s
e'
4l'
(2004)
prot€in are lag€led to discrete
epil?togdesis JN.4orci 24(30)t 6U2-52'
Tonsiorsi E. (2008) Activity-deptudent expre$ion of bmin-ddived neuolrophic
factor in den&it€s: facb
dd
oPen
qu6tio6 N€uorci
Tator CH- (1996) Normar lnd abnomal
Tynieski
M
neuroff:
bsis for lhe pathophysiology of tlamatic
a
lRes 61(4)1 335-46'
€lciun
homeosbsis in
ond bchetnic @nlral nervous
t54
systEm injury.
N,uoruse.,
vdflzakk€r M,
Imrry
3E(6): t l?6-95
RD, Brcindcl T, Spmcer
RL
(2008) Envircmental
novelly is essocialed with a selective incre&se in Fos exp6sion in the outPul
cdtq Leffi Men
elemcds of the hippocm9al fomarion and 1he Petirninal
rs(u):
899-906.
L, K!s, R. Kulovani M, Mdes P (1990) Excitaiory altrino acid
lire sci
a asonist! bd pentvlsetetrazol-induced seizur's duing ontogenesis
Velisek
45t 1349-57
-
K er al' (2010) Sl'naPtic
verpeli C, Pieoli G, Zachi A, Gardoni F' Hlans
bv modulalins eBlz-dcpendenr
aclivitf contob dondrilic sPine moryholory
BDNF sytthcsis.
Vezani A,
JNerorc':
Balosso S,
30(17)1 583042'
Riviza
T
(2008) TlE
pathophysioloF/ ol Ailepsy Sfa h Behav
vezzani A, Moneta
lhne
'ote
of cvtoki!* id
22(6J' 191-803
SJ et a/'
D' Richichi C' Aliprandi M' Buows
,J*"""t .n t tn"t'"""
ihc
(2002)
nolccules itr
cvloki'es and dti'inflammatorv
EPlePria 43(supPl5): 30_5seiArcs and ePil'Progonesis
(2011) ch6ges
s
Dolic L' Dedeuwadde
Ds'
Liu
A,
'ral'
Tostelin
L,
Vivash
rladonshjP
e9ilepbgenosisi
densiiv during limbio
t- t-irr"."*,
"*^t""'R
nt*
*o"v
ro..
tuln\g Nerobiol Djr; 4r(2\'221'36'
'p
^c
Grcck$h G' Hdllt
P'
Mavs
U'
Ricchen
ME,
Vodliotis
V
(1998)
ofkhdLod lats is
exgession in rhe hiplocarnpus
7e2t2se-3or
wfth n'loxone s/'in rtes
"""Oi"".,"""-t*'*
.;;1".:";; **"*t't
"fos
*ament
wsll&c RH, Wang Dvr',
shs! &
Schcfftr lE' Geo4c AL
Ir"
'r 't '
(199E)
a mutation in ihe Na+-
epilePsy aisociated {ilb
r"urit" *i^r* ^A g**aized
scNlB Nal Gd"et 19(4):366'70
;hannel bclal subunit sene
wes c, wu H, He F, Jing X, Liang Q, Hcng C. e/ a1., (2012) All€viation of
lenic Chlo
de-induced Soirucs and Rctdded Behrviou in Epilepric Rats by
Corli@l Elecrrical Stinulation'lt6t^ant. J Int Me.l Res. 40(D: 266-81.
wlloabe Y, Jobson R3, Burler LS, Binder DK, Sp'es€lmo
Blv.t er 4t., (1996)
Null nutation ofc-fos inpair strudural and tunctional pldticiry in kindling model
ol ep;lery. J
NtuBci. r6<r2)t 3827 -36.
KGis ID,
Wamd
SG,
cxprcssed
in eabryonic bul not adull spinal sensory D€uoN, md is r€-€xpressed
Black JA. (1994) Type
ltr sodim cbdnet dRNA
is
following axolomy. -rNelopl'),r iot. 12ll)t 466-70.
Wong
I, Webst.r MJ, Cdsalo H, Wcickc4 CS. (2009) Chd8es
i!
altornalivc
brain-d€.ived neuro!.ophic f&tor r.ansc.ipt er?fession in 1jle developing hunar
rleftontal @nex.
lt
Yasmolo
Et
J Neuos.i.
OkMua A"
29?rt 13tt-22.
Fukuda M. (201l)
Epilelsis
and epit€pnc syndromes
slaning in Oe neonaLal pdod. Bnin Dev. 31(3):2t3-2 -.
K, vogel SM
Yamaoka
Seyama
molemltu mechanisns ofgalins
L
(2006) Na
chuet lhamacolosy and
. Cst Pham De'. rz(4)t 42942.
Yoshihisa I, Masato 1,4 Hideki L (2000) supprcssion ofpenrylerelerazol-induc€d
seizues
dd
c-fos €xlression in mouse brain by L-cmitine. J OccW Heatth. 421
n9J3.
ZuccoDl V.
Zuliei V,
r'01ll
s,eep-Rlabd epileps,. Ha4db Cln Lcwot 99: Ii09.17.
Fantini M, Rivas M. (2012) Sodiurn
Target for Trcating Elilepsy: Reenl Updar€s.
IEpub ahe-ld
Chmel Blockd
Cw
as
Tlenpeutic
Top Med Chen Fet 2t.
ofprintl.
156
LIST OF PUBLICATIONS
Shrh
SU,4$r4l!,
Soortro ZH, Shah lv1R, Kabii N' Simjee SU. (2012) th€ anti-
snhddc md antloxidative effoct ofNBD (6-nit!o-1,3-bemdioxme) in adjuvdn
induced
ardrnb (AIA) in Bts.lnllann R6 Apt27 Epull
sinjce sU,
Shaheen F, Choudhary
Kabn N, A5hnf N. (201
l)
ahead
M, Rdman AU, Jmau
of Virnl-
S, Shah SU, Khan
Supp.ession ofc,Fos piotein and mRNA
N,
exl$siotr in
penrylenetet
Dec
l5
kindl€d nouse bnin by isoxylirones. J Mol N.urosci.
^zole-iDduced
lEpub a.head oflrinr].
Khe H,
saced
M, cilmj AU,
Khan MA, Khan
t,
Ashraf N. (2mt)
And,ociccpive acriviry ofaeriallais ofpolygonatm verticiltaiutr|: Aftenuarion
oibo$ ptripf erat ed @ntral lain mediatoB. p,rylolrd&s. ,5,lrlt 7e}4-1cr,0.
Ained
S,
Asbnf N. Rehme N, Neir t4 Alhtar KS,
Jabbar
A dd
Shabana SU.
(2010) Anticonvulsanr and anlimicrobial aorivities
ot dre metheolic qtracr
cymbopogon jwarancula. J l/op Med prdk! rr(r)t 3g-a4.
of
THESIS RELATED ABSTRACTS
Shabea U. Sinj@, Frzana Shah€eq Afla-Ur_RanJnan, M. Iqbal
Choudhary,
Nuru!Kab4 and Nrdeem AstEt koxylilones (E/Z isomqic
nixturc) atl€nuates
clteges h levels of BDNF ed cf6 in vaious rcdos
ofnic€ bdin hddgoing
chemical kindling:
irlti@..ioff tor alrietiteltog€nic lro?enics.
EPILEPSIA Volumq
Published:
5l
Spec'lt issrler Sp. Iss. SI Su!!l.
4
Sou@l
pages: 80-80
ruN 2010.
Sibje, Fa@m Shaheen, M. Iqbal Choudhary, Atta_ur_R nmdn,
Nudl K.bn, Syed Uzir SlEl! ed Nade€m Asbnt T&geling
Epilepsy:
ShabdB U.
Molecula! narke.s of epileprogenesis anil its nodulalon
by isolylitones
[sZ
mixnuel.3d Inremarionsl Symposium-cun-Training Couse
Medicin€ and Drug R€s€3rch, 3rd
-
on
6thjanuary 2011, Irtemational
Biological Scienccs, UDiv€rsity of Karachi, Kanchi,

Similar documents

×

Report this document