Host Cell Contact-Induced Transcription of the Type IV Fimbria Gene

Document technical information

Format pdf
Size 1.7 MB
First found May 22, 2018

Document content analysis

Category Also themed
Language
English
Type
not defined
Concepts
no text concepts found

Persons

Organizations

Places

Transcript

INFECTION AND IMMUNITY, Feb. 2004, p. 691–700
0019-9567/04/$08.00⫹0 DOI: 10.1128/IAI.72.2.691–700.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Vol. 72, No. 2
Host Cell Contact-Induced Transcription of the Type IV
Fimbria Gene Cluster of Actinobacillus pleuropneumoniae
Bouke K. H. L. Boekema,1 Jos P. M. Van Putten,2 Norbert Stockhofe-Zurwieden,1 and
Hilde E. Smith1*
Division of Infectious Diseases and Food Chain Quality, Institute for Animal Science and Health, ID-Lelystad, 8200 AB Lelystad,1
and Department of Infectious Diseases and Immunology, Utrecht University, 3508 TD Utrecht,2 The Netherlands
Received 13 May 2003/Returned for modification 29 July 2003/Accepted 5 November 2003
tion of the major subunit gene. In Pseudomonas aeruginosa, the
PilS/R sensor-response regulator pair (12) and the alternative
sigma factor ␴54 (15) are essential for pilA transcription. In
contrast, Neisseria meningitidis pilE utilizes a ␴70 promoter (4)
and is down-regulated upon cell contact by CrgA (5). Knowledge of the regulation of Tfp expression is of obvious importance in the dissection of the functions of Tfp in bacterial
pathogenesis and their potential as a target for future infection
intervention strategies.
In order to further explore the boundaries set to the plasticity of the Tfp system, we investigated the Tfp of Actinobacillus pleuropneumoniae. The Tfp of this respiratory pathogen
may possess unique properties because of its high host specificity for pigs. A. pleuropneumoniae has been demonstrated to
express fimbrial structures and to possess a 17-kDa protein
that, based on its immunological cross-reactivity with Tfp of M.
bovis and N-terminal amino acid sequence homology, was classified as belonging to the type IV family of pilus proteins. The
potential to produce Tfp was further supported by the recent
demonstration of a gene cluster that consists of four genes
(apfABCD) that share homology at the deduced amino acid
level with pilABCD of the Tfp gene family, although gene
transcription was not demonstrated (33). Here we report the
successful constitutive expression of fimbria subunits and of
intact Tfp in A. pleuropneumoniae after placement of the
cloned Tfp gene cluster behind a constitutive promoter. Additional experiments with promoter-reporter gene fusion constructs indicated that the Tfp cluster is preceded by an intact
but tightly regulated promoter. Activation of native Tfp promoter activity required specific environmental conditions and
Fimbriae or pili are filamentous polymeric structures that
protrude from the bacterial cell surface (48). Type IV pili (Tfp)
form a unique class of multifunctional fimbriae defined by
shared structural features and a conserved biogenesis pathway.
They are typically composed of thousands of core subunits with
masses of 15 to 20 kDa that are polymerized into a fiber.
During Tfp biogenesis, the major subunit is formed as a prepilin that is processed into mature pilin by a type IV prepilin
peptidase. This enzyme removes the unique amino-terminal
leader peptide and methylates the newly formed N-terminal
amino acid residue prior to assembly of the subunits into pili.
The genes and gene products required for Tfp biogenesis are
remarkably conserved among the extremely diverse groups of
gram-negative species that can produce Tfp (37). Tfp can display a diverse set of functions and may be involved in DNA
uptake (16, 25, 47), adherence (10, 27, 28, 34, 37), protein
export (9, 13, 16, 29, 30), twitching motility (23), and phage
infection (44).
Besides the apparent conservation in biogenesis, architecture, and function, Tfp from different species can exhibit
unique properties. The plasticity of Tfp ranges from variable
length of the leader peptide to noted differences in the genetic
regulation of Tfp expression among species (37, 46). The bestunderstood regulatory systems involve transcriptional modula* Corresponding author. Mailing address: Division of Infectious
Diseases and Food Chain Quality, Institute for Animal Science and
Health, ID-Lelystad, P.O. Box 65, 8200 AB Lelystad, The Netherlands.
Phone: 31-320-238023. Fax: 31-320-238961. E-mail: [email protected]
.nl.
691
Downloaded from iai.asm.org at LANDBOUWUNIVERSITEIT on November 12, 2007
Type IV pili (Tfp) of gram-negative species share many characteristics, including a common architecture and
conserved biogenesis pathway. Much less is known about the regulation of Tfp expression in response to
changing environmental conditions. We investigated the diversity of Tfp regulatory systems by searching for
the molecular basis of the reported variable expression of the Tfp gene cluster of the pathogen Actinobacillus
pleuropneumoniae. Despite the presence of an intact Tfp gene cluster consisting of four genes, apfABCD, no Tfp
were formed under standard growth conditions. Sequence analysis of the predicted major subunit protein ApfA
showed an atypical alanine residue at position ⴚ1 from the prepilin peptidase cleavage site in 42 strains. This
alanine deviates from the consensus glycine at this position in Tfp from other species. Yet, cloning of the
apfABCD genes under a constitutive promoter in A. pleuropneumoniae resulted in pilin and Tfp assembly. Tfp
promoter-luxAB reporter gene fusions demonstrated that the Tfp promoter was intact but tightly regulated.
Promoter activity varied with bacterial growth phase and was detected only when bacteria were grown in
chemically defined medium. Infection experiments with cultured epithelial cells demonstrated that Tfp promoter activity was upregulated upon adherence of the pathogen to primary cultures of lung epithelial cells.
Nonadherent bacteria in the culture supernatant exhibited virtually no promoter activity. A similar upregulation of Tfp promoter activity was observed in vivo during experimental infection of pigs. The host cell
contact-induced and in vivo-upregulated Tfp promoter activity in A. pleuropneumoniae adds a new dimension
to the diversity of Tfp regulation.
692
BOEKEMA ET AL.
INFECT. IMMUN.
TABLE 1. A. pleuropneumoniae strains used in this study
Strain
Source
1
2
3
4
5a
5b
6
7
8
9
10
11
12
1
2
1
1
2
3
3
3
3
5
6
7
7
7
7
7
7
8
8
9
9
10
11
11
11
11
12
2
2
S4074
1536
1421
M62
K17
L20
Femø
WF83
405
CVI13261
D13039
56153
8329
N273
N282
HS25
HS57
126023-1
117559-5
16169
HS77
126023-3
J45
125739
2827
25535-2578
HS30
212:89-32159
22:91-895
126398-165
20044
896
HS17
125943-191
3177/89
117559-1
111290
20492
126219-2
6807/90
118126G
118126K
Reference
Reference
Reference
Reference
Reference
Reference
Reference
Reference
Reference
Reference
Reference
Reference
Reference
ID-Lelystad
ID-Lelystad
Blackallb
Blackall
ID-Lelystad
ID-Lelystad
ID-Lelystad
Blackall
ID-Lelystad
Inzanac
ID-Lelystad
ID-Lelystad
ID-Lelystad
Blackall
Hilbinkd
Hilbink
ID-Lelystad
ID-Lelystad
ID-Lelystad
Blackall
ID-Lelystad
Nielsene
ID-Lelystad
ID-Lelystad
ID-Lelystad
ID-Lelystad
Nielsen
ID-Lelystad
ID-Lelystad
a
All listed strains are of biotype 1, except strains N273, N282, 118126G, and
118126K (biotype 2).
b
P. Blackall, Animal Research Institute, Brisbane, Australia.
c
J. Inzana, Virginia Polytechnic Institute and State University, Blacksburg.
d
F. Hilbink, Central Animal Health Laboratory, Upper Hutt, New Zealand.
e
R. Nielsen, State Veterinary Serum Laboratory, Copenhagen, Denmark.
was induced during the adherence of the pathogen to host
epithelial cells and during experimental infection in pigs.
MATERIALS AND METHODS
Bacterial strains, growth conditions, and plasmids. Strains and plasmids used
in this study are listed in Tables 1 and 2. A. pleuropneumoniae strains were grown
on sheep blood agar plates containing 0.1% NAD (Calbiochem, La Jolla, Calif.)
or in brain heart infusion medium (BHI) (Gibco BRL, Paisley, United Kingdom)
containing 0.008% NAD (BHI-NAD) with or without 1.5% Bacto Agar (Becton
Dickinson, Alphen aan den Rijn, The Netherlands). To study fimbria expression,
A. pleuropneumoniae was grown on Luria-Bertani (LB) agar plates containing
0.008% NAD (LB-NAD) or in 5 ml of chemically defined medium (CDM) (11)
in air, in CDM under microaerophilic conditions (composition: 6% O2, 7% CO2,
7% H2, and 80% N2, obtained with an Anoxomat WS8000 [Mart Microbiology,
Lichtenvoorde, The Netherlands]), in tryptic soy broth (TSB) (Biotrading
Benelux, Mijdrecht, The Netherlands) plus 0.008% NAD, or in LB medium plus
0.008% NAD. All Escherichia coli strains were routinely grown in LB with or
without 1.5% Bacto Agar (Becton Dickinson). When appropriate, ampicillin
Downloaded from iai.asm.org at LANDBOUWUNIVERSITEIT on November 12, 2007
Serotypea
(AMP) was added to the growth medium at a concentration of 100 ␮g/ml (E.
coli) or 5 ␮g/ml (A. pleuropneumoniae). E. coli M15(pREP4) was grown in the
presence of kanamycin at a concentration of 25 ␮g/ml. Bacteria were grown at
37°C unless indicated otherwise.
Preparation of inocula. For preparation of inocula, A. pleuropneumoniae
strains were grown in 5 ml of BHI–0.008% NAD–AMP for 16 h. Bacteria were
washed with phosphate-buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 8.1
mM Na2HPO4, 2.8 mM K2HPO4, pH 7.2) and diluted to approximately 2 ⫻ 106
CFU/ml in PBS. The number of CFU before and after inoculation was determined by plating 10-fold dilutions in triplicate on BHI-NAD-AMP agar plates.
DNA transformation. For use in electro-transformation, A. pleuropneumoniae
reference strain S4074 (serotype 1) was grown in 5 ml of TSB with 0.008% NAD
(TSB-NAD) at 37°C with shaking at 120 rpm. After overnight growth, the culture
was diluted 10-fold in TSB-NAD and incubated for 90 min at 37°C with shaking.
Then, the bacteria were collected by centrifugation (5,500 ⫻ g, 10 min, 4°C),
washed with 25 ml of chilled 274 mM sucrose–15% glycerol, and resuspended in
274 mM sucrose–15% glycerol to an optical density at 600 nm (OD600) of 6.0.
Fifty microliters of this cell suspension (which was kept on ice) was mixed with
plasmid DNA (1 ␮g) and transferred to a prechilled electroporation cuvette
(Bio-Rad, Richmond, Calif.) with an electrode distance of 2 mm. Electrical
charges (2,500 V; capacitance, 25 ␮F; resistance of parallel resistor, 200 ⍀) were
delivered to ice-cold samples using a Gene-Pulser (Bio-Rad). Immediately after
the electrical charge 900 ␮l of SOC medium (31) supplemented with 0.008%
NAD was added, and the cells were allowed to recover at 37°C for 3 h with
shaking. The cell suspension was plated onto BHI-NAD agar plates containing
AMP (5 ␮g/ml) (BHI-NAD-AMP). Transformants were grown overnight in 5 ml
of BHI-NAD-AMP and stored at ⫺70°C in 50% glycerol in BHI. Transformation
to E. coli was done according to the instructions supplied by the manufacturer.
PCRs. Oligonucleotides used for PCR and DNA sequencing were obtained
from Isogen Biosciences (Maarsen, The Netherlands) or Gibco. Relevant oligonucleotides are listed in Table 3. Touch down PCR was carried out by using the
AmpliTaq DNA polymerase kit reagents (Roche Molecular Systems, Inc.,
Branchburg, N.J.) according to the supplied protocol using primers 1024 and
1025. Each 50-␮l PCR mixture contained 50 ng of template DNA, 15 pmol of
(each) primer, 200 ␮M deoxynucleoside triphosphate mix, 1⫻ PCR buffer, and
1.25 U of enzyme. Each sample was amplified using the following conditions: 10
min at 94°C; 10 cycles of 15 s at 94°C, 15 s at 55°C increased by 0.5°C per cycle,
and 10 s at 72°C; 30 cycles of 15 s at 94°C, 15 s at 50°C, and 1 min at 72°C; and
7 min at 72°C.
Amplification of the complete fimbria operon was done by using the Expand
High Fidelity kit (Roche) according to the supplied protocol using primers 25
and 26. Each 50-␮l PCR mixture contained 50 ng of template DNA, 15 pmol of
(each) primer, 200 ␮M deoxynucleoside triphosphate mix, 1⫻ buffer, and 2.6 U
of enzyme mix. Each sample was amplified using the following conditions: 2 min
at 95°C; 10 cycles of 20 s at 94°C, 30 s at 55°C, and 270 s at 68°C; 20 cycles of 20 s
at 94°C, 30 s at 55°C, and 270 s plus 5 s per cycle at 68°C; and 10 min at 72°C.
Standard PCR was carried out by using the Takara ExTaq kit reagents (Takara
Shuzo Co., Ltd., Otsu, Shiga, Japan) according to the supplied protocol. Each
50-␮l PCR mixture contained 50 ng of template DNA, 15 pmol of primer, 200
␮M deoxynucleoside triphosphate mix, 1⫻ PCR buffer, and 1.25 U of enzyme.
Each sample was amplified using the following conditions: 10 min at 94°C; 30
cycles of 15 s at 94°C, 30 s at 60°C, and 30 s at 72°C; and 7 min at 72°C. All PCRs
were performed on a Primus 96 apparatus (MWG Biotech AG, Ebersberg,
Germany).
DNA manipulations, Southern blotting, and hybridization. Plasmid DNA was
isolated by using the Miniprep or Midiprep Wizard kit (Promega Corporation,
Madison, Wis.). Genomic DNA was isolated as described by Sambrook et al.
(31). DNA ligations were done by using the rapid ligation kit (Roche Diagnostics
GmbH, Roche Molecular Biochemicals, Mannheim, Germany). For use in
Southern or spot blot hybridization, PCR products were labeled with [␣-32P]CTP
via random-primed labeling (Boehringer Mannheim). For spot blotting, 3 ␮l of
plasmid DNA or 3 ␮l of culture was spotted on Genescreen Plus (NEN Life
Science Products, Boston, Mass.), denatured with 0.4 M NaOH–1 M NaCl (two
times 5 min), and neutralized in 2⫻ SSC (1⫻ SSC is 150 mM NaCl plus 15 mM
sodium citrate). For Southern blotting, approximately 20 ␮g of bacterial genomic
DNA was digested with EcoRI, subjected to electrophoresis in a 0.8% agarose
gel, and transferred to Genescreen Plus by standard procedures (31). Radioactive labeled amplicons were boiled for 10 min, chilled in ice, and used as probes.
Blots were incubated with the labeled probes for 16 h at 65°C in hybridization
solution (342 mM Na2HPO4, 158 mM NaH2PO4, 1 mM EDTA, 7% [wt/vol]
sodium dodecyl sulfate [SDS]). The membranes were washed twice (30 min,
65°C) with washing solution (27 mM Na2HPO4, 13 mM NaH2PO4, 1 mM EDTA)
TRANSCRIPTION OF Tpf OF A. PLEUROPNEUMONIAE
VOL. 72, 2004
693
TABLE 2. E. coli strains and plasmids used in this study
E. coli strain or plasmid
Strains
DH5␣F⬘
Relevant characteristic(s)
Reference or source
Gerald F. Gerlach, Tierärtzliche
Hochschule, Hannover,
Germany (2)
Stratagene, La Jolla, Calif.
Westburg, Leusden, The
Netherlands
Westburg
This study
pUC-SD2-ApfABCD
pGZRS19
Expression vector
0.5-kb BamHI-SphI fragment containing A. pleuropneumoniae
apfA lacking part of signal peptide in frame with Nterminal HIS tag in pQE30
Used for cloning
Used for cloning
Used for cloning
Vector used for construction of a library of partially Sau3AIdigested DNA fragments of A. pleuropneumoniae strain
AP76 of serotype 7
Vector used for construction of a library of partially Sau3AIdigested DNA fragments of A. pleuropneumoniae strain
AP76 of serotype 7
Promoter-trap vector that contains, in sequence, the T4
terminator, a unique BamHI site, and a promoterless copy
of the Vibrio harveyi luxAB genes in pGZRS19
Active SD2 promoter of A. pleuropneumoniae serotype 1 in
promoter-trap vector pTF86
Promoter region in apfA orientation of A. pleuropneumoniae
serotype 1 in promoter-trap vector pTF86
Promoter region in radA orientation of A. pleuropneumoniae
serotype 1 in promoter-trap vector pTF86
3.9-kb XbaI-BamHI fragment containing A. pleuropneumoniae
apfABCD operon, including RBS but lacking promoter in
pUC18
SD2 promoter upstream of fimbria operon in pUC-ApfABCD
E. coli-A. pleuropneumoniae shuttle vector
pGZRS-F1
Fimbria operon downstream of SD2 promoter in pGZRS19
XL2-Blue
M15(pREP4)
Plasmids
pQE30
pQE-ApfA
pGEM7
pUC18
pKUN
pGH432
pGH433
pTF86
pSD2
pTF-F
pTF-R
pUC-ApfABCD
containing 5% SDS and twice (30 min, 65°C) with the same solution containing
1% SDS.
Cloning. In order to verify the specificity of the ApfA peptide antiserum, the
apfA gene was PCR amplified with primers 9 and 10 (Table 3; Fig. 1) and cloned
in frame with a His tag at the amino terminus (Fig. 2A) in the expression plasmid
pQE30, generating pQE-ApfA. pQE-ApfA was used to transform E. coli
Promega
Gibco
18
Gerald F. Gerlach (2)
Gerald F. Gerlach (2)
Martha Mulks, Michigan State
University, East Lansing (6)
Martha Mulks (6)
This study
This study
This study
This study
Susan West, University of
Wisconsin—Madison (45)
This study
M15(pREP4). Expression was induced by the addition of 1 mM IPTG (isopropyl␤-D-thiogalactopyranoside).
The entire fimbria operon of A. pleuropneumoniae serotype 1 containing the
putative ribosome binding site but lacking its own putative promoter sequence
was amplified with primers 25 and 26 (Table 3; Fig. 1) and the High Fidelity kit.
The resulting PCR product was cloned in pUC18 with XbaI and BamHI gener-
TABLE 3. Oligonucleotides used in this study
Oligonucleotide
(restriction site)
Location (nt)a
Use
Sequence (5⬘ to 3⬘)b
1024
1025
FwG
RevG
8
9 (BamHI)
10 (SphI)
25 (XbaI)
26 (BamHI)
29 (BamHI)
30 (BamHI)
1167–1198
1379–1354
1742–1768c
1947–1921c
135–156
1155–1175
1642–1664
1037–1059
4882–4902
1177–1158
791–813
Touch down PCR on fimbrial subunit
Touch down PCR on fimbrial subunit
Insert PCR on pGH432 and pGH433
Insert PCR on pGH432 and pGH433
Sequence analysis of cleavage site
Cloning of apfA
Cloning of apfA
Cloning of apfABCD
Cloning of apfABCD
Cloning of promoter region
Cloning of promoter region
AAAAAAGGGTTTACATTAATCG
GCTIIAATICCITTTTGTCCICCIITAC
CGGCCAAGCTTACTCCCCATCCCC
CCACTCCCTGCCTCTGTCATCACG
TGTTCGGTCATGGCAAATACGC
CGGGATCCCGTATTCGACCGCTTACTAACGCG
ACATGCATGCATGTGCCACTGTTCCTCGGAAATCCGG
GCTCTAGAGCGATACGGATCGCAGAAGTCGG
CGGGATCCCGCCGATTCCACCGGTTAAACCG
CGGGATCCCGAAACGCGTTAGTAAGCGGTCG
CGGGATCCCGCATATCCGCTGAAGCGGTCGC
a
b
c
According to the operon sequence of A. pleuropneumoniae strain AP76 determined for this work (accession number AY235719).
Inosine (I) was incorporated to reduce specificity. Underlined nucleotides are not exact matches to the sequence and were altered to add restriction enzyme sites.
Location in plasmids pGH432 and pGH433, used for sequence analysis of inserts of A. pleuropneumoniae genomic DNA.
Downloaded from iai.asm.org at LANDBOUWUNIVERSITEIT on November 12, 2007
Library of partially Sau3AI-digested DNA fragments of A.
pleuropneumoniae strain AP76 of serotype 7 DNA in
plasmids pGH432 and pGH433
Used for plasmid construction and analysis
Used for analysis of expression vectors
694
BOEKEMA ET AL.
INFECT. IMMUN.
FIG. 1. Arrangement of the type IV fimbria operon in A. pleuropneumoniae. The region between accolades was completely sequenced. Open
arrows represent type IV fimbria genes, while filled arrows represent genes that are not involved in fimbria biogenesis. Small black arrows with
numbers indicate the positions of primers.
pended, and incubated in test medium for 2 h at 37°C without shaking. Test
media included BHI–0.008% NAD, CDM, CDM–20 ␮M FeSO4, and CDM–
0.03% NAD, and all media were supplemented with AMP at a concentration of
5 ␮g/ml. OD600 was determined and 2.5 ml of culture was centrifuged for 10 min
at 5,500 ⫻ g at 4°C, and pellets were resuspended in 40 ␮l of lysis buffer (50 mM
KCl, 2.5 mM MgCl2, 1.8 ␮M SDS, 15 mM Tris-HCl) and directly used for Lux
quantitation.
Promoter activity in the presence of LEC. The isolation and culture of porcine
lung epithelial cells (LEC) is described elsewhere (3). Overnight bacterial cultures were centrifuged and the pellets were resuspended in Dulbecco’s modified
Eagle’s medium (Gibco). Cell monolayers of LEC were infected at a multiplicity
of infection of 1,000 (with approximately 108 CFU/ml) in the presence of AMP
(5 ␮g/ml) and were incubated at 37°C in a 5% CO2 atmosphere. After 2 h,
supernatant medium with nonadherent bacteria was removed and kept at 4°C.
LEC were washed four times with 3 ml of PBS. Adherent bacteria were released
by treating the cell monolayers with 1% Triton X-100 in PBS (for 1 min).
Controls consisted of bacteria incubated with medium alone. For additional
controls, bacteria that were incubated with medium alone were centrifuged for
10 min at 5,500 ⫻ g at 4°C and were resuspended in 1% Triton X-100 in PBS (for
1 min). The numbers of CFU in supernatant medium and medium alone and of
Triton X-100-treated bacteria and adherent bacteria were determined by plating
10-fold dilutions in triplicate on BHI-NAD-AMP agar plates. One milliliter of
each suspension was centrifuged for 10 min at 5,500 ⫻ g at 4°C. The pellets were
resuspended in 20 ␮l of lysis buffer and directly used for Lux quantitation.
Promoter activity in vivo. Animal experiments were performed in three similar, consecutive trials in pigs in good health free of A. pleuropneumoniae. The
pigs were about 5 weeks of age and were housed in sterile stainless steel isolators.
For endobronchial infection, pigs were anesthetized with a combination of azaperone (Stresnil; Jansen Pharmaceutica B.V., Tilburg, The Netherlands) and
ketamine hydrochloride (Ketamine; Kombivet B.V., Etten-Leur, The Netherlands). Inoculation was performed as previously described (42). Briefly, a catheter with an outer diameter of 2.2 mm was advanced through the trachea deep
into the bronchi and 5 ml of bacterial suspension was slowly administered. Three
pigs per group were inoculated with approximately 107 CFU of A. pleuropneumoniae S4074 containing plasmids pTF86, pTF-F, or pSD2. The average inoculum contained 8.54 ⫻ 106 CFU. Two hours postinfection, pigs were anesthetized
by intravenous injection of pentobarbital and exsanguinated. The lungs were
excised, and three tissue specimens of approximately 1 cm3 were taken from both
distal caudal lung lobes for Lux analysis. Tissues were minced with scalpels, and
1.5 ml of PBS was added. Tissue suspensions were transferred to 5-ml tubes,
mixed for 5 s, and centrifuged for 5 min at 200 ⫻ g to remove large clumps of
tissue. Bacterial concentrations of the supernatant were determined by plating
10-fold dilutions on BHI-NAD-AMP agar plates. One milliliter of supernatant
was centrifuged for 5 min at 10,000 ⫻ g. The pellets were resuspended in 100 ␮l
of lysis buffer and directly used for Lux quantitation. For Lux analysis, the
bacterial lysate was mixed with 100 ␮l of N-decyl aldehyde. All animal experiments were approved by the ethical committee of ID-Lelystad.
Electron microscopy. Cultures were examined for the presence of fimbriae by
negative staining. Bacteria were absorbed on carbon-coated collodion nickel
grids from agar plates or suspensions. The grids were then floated three times for
5 s on a solution of 1% methylamine tungstate (Bio-Rad). After the staining
procedure, the specimens were viewed in a Philips CM10 electron microscope.
Statistics. Student’s t test was used for statistical analyses. P values of ⱕ0.05
were considered significant.
Nucleotide sequence accession numbers. The nucleotide sequences of the Tfp
gene clusters of strains S4074 and AP76 are available at GenBank under accession numbers AY235718 and AY235719.
Downloaded from iai.asm.org at LANDBOUWUNIVERSITEIT on November 12, 2007
ating pUC-ApfABCD. An EcoRI fragment from pSD2 containing the transcription terminator T4 and constitutive A. pleuropneumoniae promoter SD2 was
subcloned in pGEM7, and a 600-bp fragment containing T4/SD2 was cloned with
HindIII and XbaI upstream of the fimbria operon in pUC-ApfABCD, generating
pUC-SD2-ApfABCD. The fragment containing T4/SD2 and the fimbria operon
was subsequently cloned in pGZRS19 with HindIII and BamHI, generating
pGZRS-F1. pGZRS19 and pGZRS-F1 were used to transform E. coli XL2-blue
as well as A. pleuropneumoniae S4074.
A PCR product with primers 29 and 30 (Table 3; Fig. 1) containing the fimbria
promoter region of A. pleuropneumoniae S4074 was cloned in pKUN with
BamHI, generating pKUN-F. A 320-bp BamHI fragment from pKUN-F was
cloned in front of the promoterless luxAB genes in pTF86 generating pTF-F
(orientation for the fimbria promoter) and pTF-R (orientation for the radA
promoter). The orientations of the inserts in pTF86 were confirmed by restriction analysis with EcoRI and BglII.
Sequence analysis was performed on inserts in plasmids pQE-ApfA, pGZRSF1, pTF-F, and pTF-R.
DNA sequencing and analysis. DNA sequences were determined by using the
Dye Terminator cycle sequencing ready reaction kit (PE Biosystems, Warrington, United Kingdom) in an ABI 373A DNA sequencer (Applied Biosystems, Foster City, Calif.). Reaction mixtures contained 500 ng of template plasmid DNA or 20 ng of PCR product, 8 ␮l of reaction mixture, and 3.2 pmol of
primer in a 20-␮l volume. Alternatively, DNA sequences were determined by
Plant Research International (Wageningen, The Netherlands) by using the BigDye Terminator mix (version 2.0; Applied Biosystems). Reactions contained 500
ng of template plasmid DNA, 4 ␮l of reaction mix, and 10 pmol of primer in a
10-␮l volume. Cycle sequencing reactions were performed on a Primus 96 apparatus (MWG Biotech). In all cases, both strands were sequenced. Primers
FwG and RevG (Table 3) were used for sequence analysis of inserts in plasmids
pGH432 and pGH433. Sequence analysis was performed using the DNAstar
software package (DNAstar Inc., Madison, Wis.). To search for homologies, the
nucleotide and amino acid sequences were compared with sequences in the
GenBank databases by using BLAST (1).
SDS-polyacrylamide gel electrophoresis and Western blot analysis. Production of fimbria subunits was analyzed by SDS-polyacrylamide gel electrophoresis
(17.5% polyacrylamide) and Western blotting. Blots were immunostained with
six-His-tagged monoclonal antibody (anti-His; Clontech Laboratories, Palo Alto,
Calif.) or polyclonal antifimbria peptide serum (Eurogentec, Seraing, Belgium).
The antifimbria peptide serum was raised in mice against a short synthetic
peptide with amino acid sequence CSGGQNGVRKMTELR from ApfA (Eurogentec).
Lux analysis. Quantitative analysis of Lux expression was performed on a
Victor 1420 multilabel counter (Wallac, Turku, Finland). N-decyl aldehyde
(Sigma Chemical Co., St. Louis, Mo.) substrate was made by dissolving a 20mg/ml concentration of Essentially Fatty Acid Free bovine serum albumin
(Sigma) in 1 ml of H2O with N-decyl aldehyde (1 ␮l/ml). This mixture was
incubated in a glass screw-cap test tube for 30 min in a sonicating water bath at
room temperature to disperse the N-decyl aldehyde into micelles. For Lux
analysis, 20 ␮l of bacterial lysate was mixed with 20 ␮l of substrate in white
Polysorb luminescence plates (Nunc GmbH & Co. KG, Wiesbaden, Germany).
This mixture was then read with normal emission aperture, a delay of 5 s, and a
counting time of 10 s. Luminometer readings (counts per second [CPS]) were
normalized to the number of bacteria in the sample as determined by plate
counts on selective media (␮CPS per CFU) or to the OD600 for pure cultures of
bacteria. An OD600 of 1.0 equals approximately 109 CFU/ml.
Promoter activity in vitro. To investigate promoter activity in vitro, overnight
cultures of A. pleuropneumoniae strains grown in BHI–0.008% NAD–AMP were
diluted 10 times in 5 ml of BHI–0.008% NAD–AMP and incubated for 3 h at
37°C without shaking. Bacteria were washed once with test medium, resus-
TRANSCRIPTION OF Tpf OF A. PLEUROPNEUMONIAE
VOL. 72, 2004
695
Downloaded from iai.asm.org at LANDBOUWUNIVERSITEIT on November 12, 2007
FIG. 2. (A) Alignment of amino acid sequences of type IV fimbria subunits of A. pleuropneumoniae strain S4074 of serotype 1 and of three other
Pasteurellaceae. Residues that are identical to the consensus are boxed. The putative cleavage site is indicated by a filled triangle. The position of
the fusion of ApfA to the His tag in pQE-ApfA is indicated by an open triangle. Conserved cysteine residues are indicated by stars. A synthetic
peptide with the amino acid sequence of residues 73 to 87 (CSGGQNGVRKMTELR [shaded]) of ApfA was used to immunize mice. GenBank
accession numbers are as follows: for A. pleuropneumoniae ApfA, AY235718; for H. influenzae Rd HI0299, AAC21963.1; for A. actinomycetemcomitans PilA, AAF89188.1; for P. multocida PtfA, AAF61196.1. (B) Nucleotide sequence of the promoter region of the fimbria gene cluster from
A. pleuropneumoniae strain S4074 of serotype 1. A putative ␴70 promoter sequence (⫺35 and ⫺10 box) and ribosome binding site (RBS) are boxed.
RESULTS
Cloning of the A. pleuropneumoniae fimbrial gene cluster.
The A. pleuropneumoniae Tfp gene cluster was amplified in two
steps. First, part of the major subunit gene was PCR amplified
with primers based on a conserved fimbria subunit sequence of
Haemophilus influenzae and Actinobacillus actinomycetemcomitans (primer 1025) and deduced from the previously determined N-terminal amino acid sequence of an A. pleuropneumoniae subunit (primer 1024). Inosines were incorporated
696
BOEKEMA ET AL.
to yacE. This gene encodes the enzyme dephosphocoenzyme A
kinase, which catalyzes the final step in coenzyme A biosynthesis, the phosphorylation of the 3⬘-hydroxy group of the
ribose sugar moiety (26). This gene also has no known relation
with fimbria biogenesis.
Analysis of the intergenic sequences indicated that the apfA
gene was preceded at 6 bp upstream of the putative start codon
by the sequence AGGAGA (Fig. 2B), which resembles the
AGGAGG consensus ribosomal binding sequence for A. pleuropneumoniae (6). A putative promoter with the sequence TT
GAC (⫺35) and TATAAT (⫺10) with a spacing of 19 bp was
identified at 180 bp from the ATG start codon (Fig. 2B). This
promoter structure is similar to the consensus ␴70 promoter
structure TT(G/A)AA (⫺35) and TATAAT (⫺10) in A. pleuropneumoniae (6). None of the different fimbria genes was
followed by a transcriptional terminator. This in conjunction
with the spacing of the apfABCD genes suggests that the genes
are arranged in an operon and may be cotranscribed.
A. pleuropneumoniae carries a single type IV fimbria operon.
To ascertain the presence of a single copy of apfA in the A.
pleuropneumoniae genome, Southern blot hybridization was
performed. Genomic DNA, isolated from A. pleuropneumoniae reference strains of serotypes 1 and 7 (S4074 and WF83)
and field isolates HS25 and HS77, was digested with EcoRI,
separated on agarose gel, and blotted. The blot was hybridized
with a PCR product containing the first half of apfA as a probe.
In all four strains, only one band hybridized with the probe
(data not shown), indicating that only a single copy of apfA is
present in the A. pleuropneumoniae genome of serotypes 1, 3,
and 7. This was confirmed by homology searches using the
complete ApfA or the signal peptide sequence of ApfA and
the unfinished genome sequences of A. pleuropneumoniae serotypes 1, 5b, and 7 (available from GenBank).
Expression of the recombinant A. pleuropneumoniae Tfp.
Electron microscopy on A. pleuropneumoniae strains S4074,
WF83, HS77, and HS25 grown on LB-NAD agar plates yielded
no fimbria-like structures protruding from the cell surface.
Similar negative results were obtained for ApfA in Western
blots when lysates of strains grown in a diverse set of media
(including CDM) were probed with an antiserum raised
against a synthetic ApfA peptide with the amino acid sequence
CSGGQNGVRKMTELR (Fig. 2A). These data indicate that
Tfp expression is either tightly regulated and/or that the identified operon is not functional.
To distinguish between these possibilities, a PCR product
(obtained with primers 25 and 26 [Fig. 1]) containing the entire
Tfp gene cluster of A. pleuropneumoniae S4074 but lacking its
own promoter sequence was cloned in plasmid pGZRS19
downstream of the constitutive SD2 promoter. The resulting
plasmid pGZRS-F1 was used to transform E. coli XL2-blue.
Western blot analysis on whole-cell lysates of XL2-blue
(pGZRS-F1) with the ApfA-specific antiserum demonstrated
the presence of an approximately 15-kDa protein (Fig. 3, lane
5) that was absent from E. coli carrying the empty plasmid
pGZRS19 (Fig. 3, lane 4). Western blot analysis with Histagged ApfA and anti-His antibody (data not shown) confirmed that it was ApfA that was recognized by the peptide
antiserum (Fig. 3, lanes 1 and 2). Similar results were obtained
for A. pleuropneumoniae strain S4074 carrying plasmid
pGZRS-F1 (Fig. 3, lane 8), indicating that Tfp subunits were
Downloaded from iai.asm.org at LANDBOUWUNIVERSITEIT on November 12, 2007
at seven positions in primer 1025 to reduce its specificity.
Touch down PCR on genomic DNA from A. pleuropneumoniae
reference strains S4074, 1536, and WF83 yielded bands of the
expected size (220 bp) at annealing temperatures ranging from
35 to 40°C. DNA sequencing and subsequent analysis of the
PCR fragments revealed 55% similarity at the amino acid level
with the type IV fimbria subunits of A. actinomycetemcomitans,
H. influenzae Rd, and Pasteurella multocida.
In order to obtain the entire A. pleuropneumoniae subunit
gene (designated apfA) and possible flanking fimbrial genes, a
DNA library of A. pleuropneumoniae serotype 7 was hybridized
with the obtained apfA PCR fragments. Hybridizing clones
were collected, and the entire DNA sequence of the inserts was
determined. This procedure yielded a 5,303-bp DNA region
that contained four complete and two partial open reading
frames (ORFs) (Fig. 1). Similar data were obtained for reference strain S4074, serotype 1.
Properties of the major Tfp subunit gene, apfA. Sequence
analysis indicated that the first complete ORF of the identified
region was the apfA gene. The gene was 444 bp long and was
predicted to encode a 15.9-kDa protein (Fig. 2A). The putative
protein was 75 to 92% similar to the fimbria subunits of H.
influenzae, A. actinomycetemcomitans, P. multocida (Fig. 2A),
and Haemophilus somnus and identical to that of the putative
ApfA protein of A. pleuropneumoniae serotype 2 (GenBank
accession number AF302997). The deduced protein sequence
of ApfA contains many of the features shared by type IV
subunits in other gram-negative bacteria, except for the Ala
residue at position ⫺1 relative to the cleavage site (37) (Fig.
2A). Most known type IV prepilin-like leader sequences contain a glycine at this position (37) (Fig. 2A). PCR with primers
8 and 10 (Fig. 1; Table 3) and sequence analysis of 42 strains
of A. pleuropneumoniae including HS25 (Table 1), a strain
which has been reported to produce Tfp, confirmed that the
Ala residue at position ⫺1 was an intrinsic trait of the A.
pleuropneumoniae subunit gene (data not shown). This analysis
also revealed a stop codon at the predicted Gly residue 68 in
apfA of the A. pleuropneumoniae reference strain WF83 of
serotype 7.
Organization and characterization of the remaining of the
Tfp gene cluster. Downstream of the A. pleuropneumoniae
apfA gene three ORFs were identified which were designated
apfB, apfC, and apfD (Fig. 1). These ORFs encode proteins
with similarities to PilB, PilC, or PilD analogues of A. actinomycetemcomitans, P. multocida, H. influenzae, and H. somnus
which are involved in fimbria assembly (17, 29, 40, 41). The
predicted protein ApfD showed 45% similarity to PilD of A.
actinomycetemcomitans but showed very low similarities to P.
multocida and H. influenzae sequences. apfD putatively encodes a prepilin peptidase that cleaves the positively charged
N-terminal signal peptide of ApfA and methylates the exposed
phenylalanine residue (22, 38). ApfD contains two Asp residues (at positions 89 and 147) thought to be involved in the
active site of prepilin peptidases (20) but lacks a cluster of four
Cys residues found in other prepilin peptidases (35).
Analysis of the ORFs flanking apfABCD revealed a partial
ORF at 181 bp upstream of apfA on the opposite strand that
showed similarity to radA. This gene is involved in DNA repair
and has no known relation with fimbria biogenesis (32). Downstream of apfD, a partial ORF was found that showed similarity
INFECT. IMMUN.
VOL. 72, 2004
produced. Electron microscopy demonstrated straight fimbriae
protruding from the bacterial cell surface from the recombinant strain carrying the Tfp operon but not from the parent A.
pleuropneumoniae S4074 (Fig. 4) or from A. pleuropneumoniae
S4074(pGZRS19) (data not shown). Together, the data indicate that A. pleuropneumoniae carries an intact Tfp operon but
that, at least under the laboratory growth conditions employed,
the promoter activity may be insufficient to stimulate the formation of intact fimbriae.
Assessment of the Tfp promoter activity using luxAB gene
reporter fusions. The molecular basis for the apparent absence
of Tfp in A. pleuropneumoniae was further investigated with
the use of promoter-reporter gene fusions. Sequence analysis
of the putative Tfp promoter region suggested that a promoter
is located between the apfA gene and the adjacent oppositely
oriented radA gene (Fig. 2B). To determine possible promoter
697
activity in this region, a PCR fragment containing this entire
region of A. pleuropneumoniae S4074 was cloned in both orientations into reporter vector pTF86 in front of the promoterless luxAB genes, generating pTF-F (orientation for the fimbria promoter) and pTF-R (orientation for the radA
promoter), respectively. As a positive control, plasmid pSD2,
in which the luxAB genes are placed behind the constitutive A.
pleuropneumoniae promoter SD2, was used (6). All plasmids
(pTF86, pTF-F, pTF-R, and pSD2) were used to transform A.
pleuropneumoniae S4074, and the level of expression of the
luxAB genes was determined by measurement of Lux activity.
Growth of the various strains in different media (BHI-NADAMP or CDM-AMP) for 16 h or 10-fold dilutions of these
cultures for an additional 1 to 4 h yielded no reproducible Lux
activity for strain S4074 carrying the pTF-F plasmid or pTF86
(negative control). Under these conditions, strong positive signals were obtained for S4074 carrying pTF-R that carried the
promoter region in the opposite (radA) orientation and S4074
carrying pSD2 (positive control) (data not shown). However,
when bacteria at 3 h of exponential growth in BHI were collected by centrifugation, washed, and grown in CDM-AMP for
an additional 2 h, S4074 carrying pTF-F did exhibit a luciferase
activity of 4,678 ␮CPS/CFU, which was 26 times higher than
that of the negative control strain S4074 carrying pTF86 (P ⬍
0.05 [Table 4]). Similar experiments but with the strains grown
in the final 2 h of incubation in BHI-NAD-AMP instead of in
CDM indicated virtually no activity for the strain carrying the
putative Tfp promoter (pTF-F), although good activity was
observed for strains carrying pSD2 and pTF-R (Table 4). Extensive variation in the concentrations of potential regulatory
compounds such as Fe2⫹ or NAD (between 0.0004 and 0.03%)
in the media (43), or in growth temperature (33 versus 37°C),
either had no effect or caused a minor increase (by a factor of
1.6 to 1.8) in Lux activity (data not shown). Together, these
results strongly suggest that the A. pleuropneumoniae Tfp promoter is intact but active only under distinct and strictly defined environmental conditions.
FIG. 4. Electron micrographs of A. pleuropneumoniae reference strain S4074 (A) and S4074(pGZRS-F1) (B). Bacteria were stained with
methylamine tungstate and examined by electron microscopy as described in Materials and Methods. Bars represent 200 nm.
Downloaded from iai.asm.org at LANDBOUWUNIVERSITEIT on November 12, 2007
FIG. 3. Western blot analysis of fimbria subunit ApfA expressed in
E. coli XL2-blue or A. pleuropneumoniae S4074 containing no plasmid,
pGZRS19, or pGZRS-F1. Results for samples of E. coli M15(pQEApfA) are shown in lanes 1 and 2 (2 and 0.2 ␮l). The blot was stained
with antifimbria peptide serum. The arrow indicates the position of the
fimbria subunit ApfA (⫾15 kDa). Molecular size markers are indicated on the right (in kilodaltons).
TRANSCRIPTION OF Tpf OF A. PLEUROPNEUMONIAE
698
BOEKEMA ET AL.
INFECT. IMMUN.
TABLE 4. In vitro promoter activity in A. pleuropneumoniae S4074
BHI-NAD-AMP
CDM-AMP
Plasmid
Mean Lux
activitya ⫾ SEM
(␮CPS/CFU)
Relative
activityb
Mean Lux
activity ⫾ SEM
(␮CPS/CFU)
Relative
activity
pTF86
pSD2
pTF-R
pTF-F
90 ⫾ 17
7,307 ⫾ 6,651c
5,426 ⫾ 659c
77 ⫾ 14
1
81.12
60.24
0.85
179 ⫾ 15
16,690 ⫾ 986c
11,590 ⫾ 723c
4,678 ⫾ 959c
1
93.41
64.85
26.18
TABLE 6. In vivo promoter activity in A. pleuropneumoniae S4074
Plasmid
Lux activitya ⫾ SEM
(␮CPS/CFU)
Relative
activityb
In vivo/in vitro
ratio (BHI)
pTF86
pTF-F
pSD2
326 ⫾ 60
1,176 ⫾ 305c
22,601 ⫾ 2,814c
1
3.61
69.29
3.62
15.27
3.09
a
Results of three tissue specimens of three pigs are shown.
Relative Lux activity compared to pTF86.
c
Significantly different from pTF86 (P ⬍ 0.05).
b
a
The results of three experiments in triplicate are shown.
Relative Lux activity compared to pTF86.
c
Significantly different from pTF86 in the same medium (P ⬍ 0.05).
b
DISCUSSION
Tfp are important multifunctional bacterial surface organelles expressed by most gram-negative bacterial pathogens.
Awareness is growing that regulation of Tfp expression is an
essential quality enabling Tfp to function at the appropriate
time. The environmental cues that control Tfp expression in
the various species, however, are generally still poorly understood. In the present study, we investigated Tfp expression for
the porcine respiratory pathogen A. pleuropneumoniae. This
species carries a set of genes that shares features with the type
IV pilin gene family, but this appears to result only rarely in the
formation of Tfp (33, 43). We characterized the Tfp gene
cluster and demonstrated that Tfp are formed when the cluster
is placed behind a constitutive promoter. Promoter-reporter
gene fusions showed that the A. pleuropneumoniae Tfp promoter is intact but tightly controlled by environmental conditions. Promoter activity was demonstrated to be induced upon
contact of the bacteria with epithelial cells and in vivo during
experimental infection of pigs.
The Tfp clusters of two different A. pleuropneumoniae
strains consisted of four genes (apfABCD) separated by no or
only small intergenic sequences and lacked apparent transcriptional terminator sequences. The overall organization of the
gene cluster resembled that of the related bacterial pathogens
H. influenzae, A. actinomycetemcomitans, and P. multocida (7,
TABLE 5. In vitro promoter activity in A. pleuropneumoniae S4074 in the presence of LEC
Bacteria treated with medium alone
Bacteria in supernatant of LEC
Bacteria binding to LEC
Plasmid
Mean Lux activity ⫾ SEM
(␮CPS/CFU)
Relative
activityb
Mean Lux activity ⫾ SEM
(␮CPS/CFU)
Relative
activity
Mean Lux activity ⫾ SEM
(␮CPS/CFU)
Relative
activity
pTF86
pSD2
pTF-R
pTF-F
318 ⫾ 74
15,890 ⫾ 3,673c
9,230 ⫾ 2,660c
214 ⫾ 54
1
50.06
29.07
0.67
296 ⫾ 73
15,940 ⫾ 2,735c
4,851 ⫾ 1,333c
221 ⫾ 58
1
53.95
16.42
0.75
93 ⫾ 18
17,430 ⫾ 3,539c
5,970 ⫾ 943c
1,523 ⫾ 414c
1
188.33
64.49
16.45
a
b
c
a
Results of six experiments are shown.
Relative Lux activity compared to pTF86.
Significantly different from pTF86 under the same conditions (P ⬍ 0.05).
Downloaded from iai.asm.org at LANDBOUWUNIVERSITEIT on November 12, 2007
Host cell contact-induced activation of the Tfp promoter.
The apparent strict bacterial growth conditions required for
activation of the Tfp promoter led us to assess its activity
during infection of primary cultures of porcine LEC. The cells
were inoculated with A. pleuropneumoniae strain S4074 carrying pTF86, pSD2, pTF-R, or pTF-F for a 2-h period. At this
point, nonadherent bacteria, collected from the culture supernatant, and adherent bacteria, released from the host cells with
1% Triton X-100, were assayed for luciferase activity. Under
these conditions, adherent S4074 carrying pTF-F demonstrated a luciferase activity of 1,523 ␮CPS/CFU (Table 5). This
was substantially higher than the activity measured for the
nonadherent bacteria isolated from the culture supernatant
(221 ␮CPS/CFU, P ⬍ 0.05) and those from the adherent and
nonadherent negative control S4074 carrying pTF86 with the
promoterless luxAB genes (Table 5). Lux activities of the adherent and nonadherent positive controls S4074(pSD2) and
S4074(pTF-R) were high under all conditions and ranged from
4,851 to 17,432 ␮CPS/CFU (Table 5). Treatment of bacteria
with 1% Triton X-100 slightly reduced Lux activities of all four
strains (data not shown). Together, these results clearly indicate that the Tfp promoter is active when bacteria adhere to
the cell surface but not when they are present in the culture
supernatant.
In vivo activity of the Tfp promoter. To validate our in vitro
observations, the in vivo activity of the Tfp promoter was
measured in an A. pleuropneumoniae pig infection model. A.
pleuropneumoniae S4074 containing plasmids pTF86, pSD2, or
pTF-F was used for endobronchial inoculation of pigs. Two
hours after inoculation, pigs were sacrificed and the Lux activity of minced lung tissue was determined and related to the
number of CFU (Table 6). As expected, the in vivo Lux activity
of the strain with the promoterless luxAB genes, S4074(pTF86),
was low (326 ␮CPS/CFU [Table 6]), and the in vivo Lux activity of the strain with the constitutive expressed lux genes in
S4074(pSD2) was very high (22,601 ␮CPS/CFU [Table 6]). The
in vivo Lux activity of S4074(pTF-F) carrying the Tfp promoter
in the correct orientation was 1,176 ␮CPS/CFU. This was substantially higher than that of the negative control (P ⬍ 0.05)
(Table 6) and of the activity determined after growth in BHI
medium (Table 4). These data strongly suggest that the Tfp
promoter is active in vivo during infection of lung tissue.
VOL. 72, 2004
699
constitutively active. The changes in luciferase activity observed with strains carrying this construct clearly indicated that
promoter activity varied with the bacterial growth phase and
the type of growth medium that was employed. Tfp promoter
activity was found in cultures grown to mid- to late log phase
in CDM but not when grown in BHI. These data likely provide
the molecular basis for the reported variable presence of Tfp at
the surface of A. pleuropneumoniae when these bacteria are
grown in standard medium or in a CDM under microaerophilic
conditions. It has been reported that in certain A. pleuropneumoniae serotypes (5a, 9, and 10) but not in others (serotype 2)
NAD restriction is a critical factor for Tfp production (43). In
our hands, variation in the concentration of NAD did not
influence the activity of our (serotype 1) Tfp promoter. These
data suggest the existence of serotype specific differences in the
regulation of Tfp promoter activity. The exact signals that drive
Tfp promoter activity in serotype 1 are unknown. We noticed
that changes in temperature—which influence Tfp expression
in, among others, L. pneumophila (21)—or the availability of
iron had minor effects. These effects are probably not very
specific and may well be related to concomitant changes in
growth phase, which appear to influence Tfp promoter activity.
A key topic in the assessment of regulation of Tfp expression
is the status of the system in the natural setting of an infection,
i.e., during the adherence of the pathogenic bacteria to mucosal epithelial cells and during experimental infection in the
legitimate host. A. pleuropneumoniae turned out to be an ideal
model system to address this topic. The strong Tfp promoter
activity measured for A. pleuropneumoniae bacteria that were
adherent to primary cultures of LEC compared to that for
nonadherent bacteria present in the culture supernatant
strongly suggests that contact with epithelial cells is a trigger
for Tfp production. Furthermore, our finding that the Tfp
promoter was upregulated in vivo after endobronchial inoculation of pigs indicates that this regulation does occur in the
natural host environment. The in vivo Lux activity appeared
less than that observed for the bacteria adherent to the cultured lung cells, but this may be explained by the fact that we
measured the total Lux activity in all bacteria (both adherent
and nonadherent) present in the tissue samples. The finding
that Tfp promoter activity is upregulated during contact with
host cells may seem bizarre considering that Tfp often confer
the initial bacterial attachment to host cells. For N. meningitidis, it has been demonstrated that the transcription of the
Tfp-tip-associated adhesin PilC1 is upregulated in the presence
of host cells (39). On the basis of the functions of type IV
fimbriae in other bacterial pathogens, that the fimbriae of A.
pleuropneumoniae play a role in the adherence and, possibly, at
other stages of the infection must be considered a possibility.
Whether Tfp of A. pleuropneumoniae are involved in other
typical functions of Tfp like twitching motility, DNA uptake,
protein secretion, or phage infection remains to be investigated. The nature of the environmental signals that drive the
regulation of apfABCD transcription is still unknown. The TfpluxAB reporter system that we have developed may provide a
good basis to take up this major challenge.
REFERENCES
1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.
Basic local alignment search tool. J. Mol. Biol. 215:403–410.
2. Baltes, N., W. Tonpitak, I. Hennig-Pauka, A. D. Gruber, and G. F. Gerlach.
Downloaded from iai.asm.org at LANDBOUWUNIVERSITEIT on November 12, 2007
8, 24) (unfinished genome of A. actinomycetemcomitans available from GenBank). It was remarkable that the apfA gene was
preceded by radA, whereas in A. actinomycetemcomitans, P.
multocida, and H. influenzae the major Tfp subunit gene is
preceded by ampD (unfinished genome of A. actinomycetemcomitans available from GenBank) (7, 8, 24). The frequent
clustering of the type IV subunit gene with ampD in other
species and the fact that in other species radA is located elsewhere in the genome suggest that in A. pleuropneumoniae
genomic rearrangements may have occurred that may have
changed the characteristics of the Tfp promoter region and
influenced the regulation of Tfp promoter activity.
Initially, the striking finding of an Ala residue at position ⫺1
relative to the ApfA cleavage site, which was found to be a
conserved feature among all 42 A. pleuropneumoniae isolates,
was considered as a possible explanation for the apparent rare
presence of Tfp at the surface of this pathogen. The consensus
cleavage site of Tfp subunits consists of the residues Gly (⫺1),
Phe (⫹1), and Glu (⫹5) (37). In P. aeruginosa, all but one
mutation at residue ⫺1 resulted in lack of processing of the
major subunit PilA (36). Partial processing of PilA was observed with a mutation to Ala (⫺1), but this did not result in
production of intact Tfp (36). A spontaneous mutant of Neisseria gonorrhoeae encoding a subunit containing Ser (⫺1) instead of Gly (⫺1) was also unable to assemble pili (19). Another type IV fimbrial subunit with an Ala (⫺1) is PilEL of
Legionella pneumophila, which can be assembled in intact fimbriae (34). Thus, the consequence for Tfp expression of the
presence of an Ala (⫺1) in the ApfA protein is difficult to
predict. In our hands, cloning of the Tfp cluster into an expression vector in A. pleuropneumoniae resulted in the expression of ApfA and Tfp formation. This suggests that, at least
with a strong promoter used, the Ala (⫺1) in ApfA does not
preclude Tfp biogenesis. At this time we do not know whether
the supposed prepilin peptidase ApfD of A. pleuropneumoniae
has unique characteristics with respect to cleavage activity in
comparison with other (PilD) prepilin peptidases or whether
ApfA is cleaved at a reduced efficiency. It can be imagined that
the latter may affect Tfp assembly when promoter activity is
less strong. Putative prepilin peptidases of Pasteurellaceae appear to lack a cluster of Cys residues in the N-terminal half of
the protein. Mutational analysis showed that the Cys residues
are required for both cleavage and methylation activity of PilD
(35). However, the role of these Cys residues in the activity of
prepilin peptidases has been recently questioned. Some of the
pilD mutants exhibited partial activity, and naturally occurring
leader peptidases lacking the Cys residues can be fully functional (14, 35). Mutational analysis showed that two highly
conserved Asp residues are absolutely required for protease
activity, suggesting that type IV prepilin peptidases comprise a
novel family of aspartic acid proteases (20).
Evidence that the Tfp promoter activity was subject to regulation was obtained when the putative Tfp promoter region of
A. pleuropneumoniae S4074 was cloned into a promoter trap
vector carrying the luxAB reporter genes. This strategy, which
allowed direct monitoring of promoter activity, demonstrated
that the DNA region preceding the Tfp operon carried two
promoters: the Tfp promoter that turned out to have variable
activity dependent on the environmental conditions and, on
the opposite strand, the radA promoter that appeared to be
TRANSCRIPTION OF Tpf OF A. PLEUROPNEUMONIAE
700
3.
4.
5.
6.
7.
8.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
2003. Actinobacillus pleuropneumoniae serotype 7 siderophore receptor
FhuA is not required for virulence. FEMS Microbiol. Lett. 220:41–48.
Boekema, B. K. H. L., N. Stockhofe-Zurwieden, H. E. Smith, E. M. Kamp,
J. P. van Putten, and J. H. Verheijden. 2003. Adherence of Actinobacillus
pleuropneumoniae to primary cultures of porcine lung epithelial cells. Vet.
Microbiol. 93:133–144.
Carrick, C. S., J. A. Fyfe, and J. K. Davies. 1997. The normally silent sigma54
promoters upstream of the pilE genes of both Neisseria gonorrhoeae and
Neisseria meningitidis are functional when transferred to Pseudomonas
aeruginosa. Gene 198:89–97.
Deghmane, A. E., D. Giorgini, M. Larribe, J. M. Alonso, and M. K. Taha.
2002. Down-regulation of pili and capsule of Neisseria meningitidis upon
contact with epithelial cells is mediated by CrgA regulatory protein. Mol.
Microbiol. 43:1555–1564.
Doree, S. M., and M. H. Mulks. 2001. Identification of an Actinobacillus
pleuropneumoniae consensus promoter structure. J. Bacteriol. 183:1983–
1989.
Doughty, S. W., C. G. Ruffolo, and B. Adler. 2000. The type 4 fimbrial subunit
gene of Pasteurella multocida. Vet. Microbiol. 72:79–90.
Fleischmann, R. D., M. D. Adams, O. White, R. A. Clayton, E. F. Kirkness,
A. R. Kerlavage, C. J. Bult, J. F. Tomb, B. A. Dougherty, J. M. Merrick, et
al. 1995. Whole-genome random sequencing and assembly of Haemophilus
influenzae Rd. Science 269:496–512.
Fullner, K. J., and J. J. Mekalanos. 1999. Genetic characterization of a new
type IV-A pilus gene cluster found in both classical and El Tor biotypes of
Vibrio cholerae. Infect. Immun. 67:1393–1404.
Hahn, H. P. 1997. The type-4 pilus is the major virulence-associated adhesin
of Pseudomonas aeruginosa—a review. Gene 192:99–108.
Herriott, R. M., E. Y. Meyer, M. Vogt, and M. Modan. 1970. Defined
medium for growth of Haemophilus influenzae. J. Bacteriol. 101:513–516.
Hobbs, M., E. S. Collie, P. D. Free, S. P. Livingston, and J. S. Mattick. 1993.
PilS and PilR, a two-component transcriptional regulatory system controlling
expression of type 4 fimbriae in Pseudomonas aeruginosa. Mol. Microbiol.
7:669–682.
Hobbs, M., and J. S. Mattick. 1993. Common components in the assembly of
type 4 fimbriae, DNA transfer systems, filamentous phage and proteinsecretion apparatus: a general system for the formation of surface-associated
protein complexes. Mol. Microbiol. 10:233–243.
Hu, N. T., P. F. Lee, and C. Chen. 1995. The type IV pre-pilin leader
peptidase of Xanthomonas campestris pv. campestris is functional without
conserved cysteine residues. Mol. Microbiol. 18:769–777.
Ishimoto, K. S., and S. Lory. 1989. Formation of pilin in Pseudomonas
aeruginosa requires the alternative sigma factor (RpoN) of RNA polymerase.
Proc. Natl. Acad. Sci. USA 86:1954–1957.
Kennan, R. M., O. P. Dhungyel, R. J. Whittington, J. R. Egerton, and J. I.
Rood. 2001. The type IV fimbrial subunit gene (fimA) of Dichelobacter
nodosus is essential for virulence, protease secretion, and natural competence. J. Bacteriol. 183:4451–4458.
Koga, T., K. Ishimoto, and S. Lory. 1993. Genetic and functional characterization of the gene cluster specifying expression of Pseudomonas aeruginosa
pili. Infect. Immun. 61:1371–1377.
Konings, R. N., E. J. Verhoeven, and B. P. Peeters. 1987. pKUN, vectors for
the separate production of both DNA strands of recombinant plasmids.
Methods Enzymol. 153:12–34.
Koomey, M., S. Bergstrom, M. Blake, and J. Swanson. 1991. Pilin expression
and processing in pilus mutants of Neisseria gonorrhoeae: critical role of
Gly-1 in assembly. Mol. Microbiol. 5:279–287.
LaPointe, C. F., and R. K. Taylor. 2000. The type 4 prepilin peptidases
comprise a novel family of aspartic acid proteases. J. Biol. Chem. 275:1502–
1510.
Liles, M. R., V. K. Viswanathan, and N. P. Cianciotto. 1998. Identification
and temperature regulation of Legionella pneumophila genes involved in type
IV pilus biogenesis and type II protein secretion. Infect. Immun. 66:1776–
1782.
Lory, S., and M. S. Strom. 1997. Structure-function relationship of type-IV
prepilin peptidase of Pseudomonas aeruginosa—a review. Gene 192:117–121.
Mattick, J. S. 2002. Type IV pili and twitching motility. Annu. Rev. Microbiol. 56:289–314.
May, B. J., Q. Zhang, L. L. Li, M. L. Paustian, T. S. Whittam, and V. Kapur.
2001. Complete genomic sequence of Pasteurella multocida, Pm70. Proc.
Natl. Acad. Sci. USA 98:3460–3465.
Meier, P., C. Berndt, N. Weger, and W. Wackernagel. 2002. Natural transformation of Pseudomonas stutzeri by single-stranded DNA requires type IV
pili, competence state and comA. FEMS Microbiol. Lett. 207:75–80.
Mishra, P., P. K. Park, and D. G. Drueckhammer. 2001. Identification of
Editor: V. J. DiRita
INFECT. IMMUN.
yacE (coaE) as the structural gene for dephosphocoenzyme A kinase in
Escherichia coli K-12. J. Bacteriol. 183:2774–2778.
27. Nassif, X., M. Marceau, C. Pujol, B. Pron, J. L. Beretti, and M. K. Taha.
1997. Type-4 pili and meningococcal adhesiveness. Gene 192:149–153.
28. Paranjpye, R. N., J. C. Lara, J. C. Pepe, C. M. Pepe, and M. S. Strom. 1998.
The type IV leader peptidase/N-methyltransferase of Vibrio vulnificus controls factors required for adherence to HEp-2 cells and virulence in ironoverloaded mice. Infect. Immun. 66:5659–5668.
29. Pepe, C. M., M. W. Eklund, and M. S. Strom. 1996. Cloning of an Aeromonas
hydrophila type IV pilus biogenesis gene cluster: complementation of pilus
assembly functions and characterization of a type IV leader peptidase/Nmethyltransferase required for extracellular protein secretion. Mol. Microbiol. 19:857–869.
30. Rossier, O., and N. P. Cianciotto. 2001. Type II protein secretion is a subset
of the PilD-dependent processes that facilitate intracellular infection by
Legionella pneumophila. Infect. Immun. 69:2092–2098.
31. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Press, Cold Spring Harbor,
N.Y.
32. Song, Y., and N. J. Sargentini. 1996. Escherichia coli DNA repair genes radA
and sms are the same gene. J. Bacteriol. 178:5045–5048.
33. Stevenson, A., J. Macdonald, and M. Roberts. 2003. Cloning and characterisation of type 4 fimbrial genes from Actinobacillus pleuropneumoniae. Vet.
Microbiol. 92:121–134.
34. Stone, B. J., and Y. Abu Kwaik. 1998. Expression of multiple pili by Legionella pneumophila: identification and characterization of a type IV pilin gene
and its role in adherence to mammalian and protozoan cells. Infect. Immun.
66:1768–1775.
35. Strom, M. S., P. Bergman, and S. Lory. 1993. Identification of active-site
cysteines in the conserved domain of PilD, the bifunctional type IV pilin
leader peptidase/N-methyltransferase of Pseudomonas aeruginosa. J. Biol.
Chem. 268:15788–15794.
36. Strom, M. S., and S. Lory. 1991. Amino acid substitutions in pilin of Pseudomonas aeruginosa. Effect on leader peptide cleavage, amino-terminal methylation, and pilus assembly. J. Biol. Chem. 266:1656–1664.
37. Strom, M. S., and S. Lory. 1993. Structure-function and biogenesis of the
type IV pili. Annu. Rev. Microbiol. 47:565–596.
38. Strom, M. S., D. N. Nunn, and S. Lory. 1993. A single bifunctional enzyme,
PilD, catalyzes cleavage and N-methylation of proteins belonging to the type
IV pilin family. Proc. Natl. Acad. Sci. USA 90:2404–2408.
39. Taha, M. K., P. C. Morand, Y. Pereira, E. Eugene, D. Giorgini, M. Larribe,
and X. Nassif. 1998. Pilus-mediated adhesion of Neisseria meningitidis: the
essential role of cell contact-dependent transcriptional upregulation of the
PilC1 protein. Mol. Microbiol. 28:1153–1163.
40. Tonjum, T., N. E. Freitag, E. Namork, and M. Koomey. 1995. Identification
and characterization of pilG, a highly conserved pilus-assembly gene in
pathogenic Neisseria. Mol. Microbiol. 16:451–464.
41. Turner, L. R., J. C. Lara, D. N. Nunn, and S. Lory. 1993. Mutations in the
consensus ATP-binding sites of XcpR and PilB eliminate extracellular protein secretion and pilus biogenesis in Pseudomonas aeruginosa. J. Bacteriol.
175:4962–4969.
42. Van Leengoed, L. A., and E. M. Kamp. 1989. Endobronchial inoculation of
various doses of Haemophilus (Actinobacillus) pleuropneumoniae in pigs.
Am. J. Vet. Res. 50:2054–2059.
43. Van Overbeke, I., K. Chiers, G. Charlier, I. Vandenberghe, J. Van Beeumen,
R. Ducatelle, and F. Haesebrouck. 2002. Characterization of the in vitro
adhesion of Actinobacillus pleuropneumoniae to swine alveolar epithelial
cells. Vet. Microbiol. 88:59–74.
44. Watson, A. A., J. S. Mattick, and R. A. Alm. 1996. Functional expression of
hetereologous type 4 fimbriae in Pseudomonas aeruginosa. Gene 175:143–
150.
45. West, S. E., M. J. Romero, L. B. Regassa, N. A. Zielinski, and R. A. Welch.
1995. Construction of Actinobacillus pleuropneumoniae-Escherichia coli shuttle vectors: expression of antibiotic-resistance genes. Gene 160:81–86.
45a.Winther-Larsen, H. C., and M. Koomey. 2002. Transcriptional, chemosensory and cell-contact-dependent regulation of type IV pilus expression. Curr.
Opin. Microbiol. 5:173–178.
46. Wolfgang, M., P. Lauer, H. S. Park, L. Brossay, J. Hebert, and M. Koomey.
1998. PilT mutations lead to simultaneous defects in competence for natural
transformation and twitching motility in piliated Neisseria gonorrhoeae. Mol.
Microbiol. 29:321–330.
47. Wu, H., and P. M. Fives-Taylor. 2001. Molecular strategies for fimbrial
expression and assembly. Crit. Rev. Oral Biol. Med. 12:101–115.
48. Zhang, Y., J. M. Tennent, A. Ingham, G. Beddome, C. Prideaux, and W. P.
Michalski. 2000. Identification of type 4 fimbriae in Actinobacillus pleuropneumoniae. FEMS Microbiol. Lett. 189:15–18.
Downloaded from iai.asm.org at LANDBOUWUNIVERSITEIT on November 12, 2007
9.
BOEKEMA ET AL.

Similar documents

×

Report this document