Functional Dissection of SseF, a Type III Effector Protein Involved in

Document technical information

Format pdf
Size 628.0 kB
First found May 22, 2018

Document content analysis

Category Also themed
Language
English
Type
not defined
Concepts
no text concepts found

Persons

Petra Schersing
Petra Schersing

wikipedia, lookup

Organizations

Places

Transcript

Traffic 2006; 7: 950–965
Blackwell Munksgaard
# 2006 The Authors
Journal compilation # 2006 Blackwell Munksgaard
doi: 10.1111/j.1600-0854.2006.00454.x
Functional Dissection of SseF, a Type III Effector Protein
Involved in Positioning the Salmonella-Containing
Vacuole
Garth L. Abrahams, Petra Müller and Michael
Hensel*
Institut für Klinische Mikrobiologie, Immunologie und
Hygiene, Universität Erlangen-Nürnberg, Erlangen,
Germany
*Corresponding author: Michael Hensel, [email protected]
mikrobio.med.uni-erlangen.de
Intracellular replication of Salmonella enterica requires
the formation of a unique organelle termed Salmonellacontaining vacuole (SCV). The type III secretion system
(T3SS) encoded by Salmonella Pathogenicity Island 2
(SPI2–T3SS) has a crucial role in the formation and maintenance of the SCV. The SPI2–T3SS translocates a large
number of effector proteins that interfere with host cell
functions such as microtubule-dependent transport. We
investigated the function of the effector SseF and
observed that this protein is required to maintain the
SCV in a juxtanuclear position in infected epithelial
cells. The formation of juxtanuclear clusters of replicating
Salmonella required the recruitment of dynein to the
SCV but SseF-deficient strains were highly reduced in
dynein recruitment to the SCV. We performed a functional dissection of SseF and defined domains that were
important for translocation and the specific effector functions of this protein. Of particular importance was a
hydrophobic domain in the C-terminal half that contains
three putative transmembrane (TM) helices. Deletion of
one of these TM helices ablated the effector functions of
SseF. We observed that this domain was essential for the
proper intracellular positioning of the SCV to a juxtanuclear, Golgi-associated localization. These data show that
SseF, in concert with the effector proteins SifA and SseG
mediate the precise positioning of the SCV by differentially modulating the recruitment of microtubule motor
proteins to the SCV.
Key words: intracellular pathogen, microtubule motor
protein, type III secretion system
Received 15 December 2005, revised and accepted for
publication 22 May 2006, published on-line 27 June 2006
Salmonella enterica is a facultative intracellular pathogen
that resides in a membrane-bound compartment after
internalization by host cells. This compartment, referred
to as Salmonella-containing vacuole (SCV), deviates from
the default endocytic pathway and allows for the massive
intracellular replication of S. enterica [reviewed in (1,2)].
The intracellular pathogenesis of Salmonella is a complex,
950
multifactorial trait that involves metabolic flexibility to
adapt to nutrient limitation as well as repair mechanisms
to compensate for damage induced by host defense
mechanisms. In addition, intracellular Salmonella modify
the biogenesis of the SCV by interference with normal
host cell processes. This modification is dependent on
the function of a type III secretion system (T3SS) that is
encoded by Salmonella Pathogenicity Island 2 (SPI2) (3).
T3SS are complex molecular machines that translocate
effector proteins from the bacterial cytoplasm into the
host cell [for a review, see (4)]. These effector proteins
act as ‘injected toxins’ and modify various host cell processes for the benefit of the pathogen. Salmonella enterica possesses two T3SS, with the SPI1–T3SS involved in
invasion of host cells and gastrointestinal pathogenesis
and the SPI2–T3SS being active during intracellular life of
Salmonella. The SPI2–T3SS is specifically activated by
intracellular Salmonella and translocates a group of effector proteins across the membrane of the SCV (3).
Several recent studies have indicated that the successful
intracellular life of S. enterica depends on the modification
of the host cell microtubule cytoskeleton and the interference with cellular transport processes of the host cell
(5–10). In mammalian cells, microtubules are organized in
a polarized fashion with the minus-ends located in the cell
center and the plus-ends at the cell periphery. The correct
functioning of microtubules is essential for both the transport and spatial organization of membrane-bound organelles within the cell. For example, microtubules guide
the endoplasmic reticulum, control the distribution of melanophores and depolymerization of microtubules results in
a collapse of the Golgi apparatus. The microtubule-associated motor proteins dynein and kinesin are
thought to play a key role in this process by facilitating
the directional transport of organelles to either the minusor plus-ends of microtubules, respectively, and in so doing
ensure that the correct cellular distribution of the organelles is maintained [reviewed by Hirokawa (11)].
While the function of the SPI2–T3SS is essential for systemic pathogenesis and intracellular lifestyle of S. enterica,
the contribution of the several effector proteins to these
virulence traits is only partially understood. SifA is an
effector that is encoded by genes outside of the SPI2 locus.
The function of this protein is important for the induction
of tubular aggregates of late endosomal/lysosomal compartments referred to as ‘Salmonella-induced filaments’
(SIF) (12). SIF form along microtubules (13) and the
SseF and SCV positioning
function of SifA is required for the maintenance of the SCV
(14) as SifA-deficient Salmonella are released into the host
cell cytoplasm. Recent work suggested that SifA is
required to prevent the interaction of the microtubule
motor protein kinesin with the SCV (10). This interference
is thought to be crucial to maintain the integrity of the SCV
[for recent reviews, see (15,16)].
The formation and dynamics of SIF is controlled by PipB2 (17)
and SopD2 (18), further SPI2–T3SS effector proteins
encoded by genes outside the SPI2 locus and by SPI2encoded SseF and SseG (19). Our group has previously
demonstrated that SseF and SseG are associated with late
endosomal/lysosomal membrane compartments as well as
with microtubules. It was found that both effectors were
required for the induction of SIF (20). In the absence of
SseF or SseG, the aggregation of endosomal compartments
to SIF was incomplete and so-called ‘pseudo-SIF’ were
observed (19). Furthermore, the formation of massive bundles of microtubules was observed in infected HeLa cells.
This phenotype was dependent on the function of SPI2 and
in particular required the function of SseF and SseG (6). Work
by Salcedo and Holden (7) showed that SseG is required to
direct the SCV to a juxtanuclear, trans-Golgi network (TGN)associated subcellular position. It was also observed that
translocated SseG is targeted to the TGN, a finding that
was not corroborated by another study (6). The molecular
functions of SseF have not been analyzed in detail.
Based on the interference of intracellular Salmonella with
microtubules, we speculated that the SPI2–T3SS and
more specifically the effector proteins may control the
trafficking or subcellular localization of the SCV as a prerequisite for intracellular proliferation. We set out to determine the contribution of these SPI2 effectors to the
positioning of the SCV and the interference with the organization and function of the microtubule cytoskeleton. We
observed that SseF is required for the positioning of the
SCV to a juxtanuclear position and the formation of tight
clusters of replicating bacteria, previously referred to as
microcolonies (21). Our observations further suggest that
these phenotypes are mediated by the SseF-dependent
recruitment of the dynein motor complex to the SCV.
Results
Formation of juxtanuclear microcolonies requires the
function of the SPI2–T3SS
In order to investigate the dynamics of the intracellular
replication and formation of microcolonies of Salmonella
in mammalian cells, HeLa cells were infected with
Salmonella wild-type (WT) or a SPI2 null mutant strain
(ssaV) and the subcellular localization of the SCV was
examined. We observed that the majority of internalized
bacteria appeared in a juxtanuclear localization within 2 h
after infection. This initial juxtanuclear localization was independent of the function of the SPI2–T3SS (Figure 1A). A
Traffic 2006; 7: 950–965
large number of SCV harboring wild-type Salmonella (WT
SCV) remained in a juxtanuclear position throughout the
time course of the experiment and, at 16 h post-infection
(p.i.), 81 5% of the WT SCV formed microcolonies positioned in the juxtanuclear region. By contrast, whereas
most of the SCV of the ssaV mutants strains were similarly located in the juxtanuclear region up to 4 h p.i., notable scattering of the SCV was observed at 6 h p.i., as well
as all later time points examined. At 16 h p.i. the majority
of ssaV SCV displayed a scattered distribution throughout
the cytoplasm, with only 19 1% forming discernible
microcolonies in the juxtanuclear region. In order to investigate which SPI2 effector proteins were responsible for
this phenotype, HeLa cells were infected with Salmonella
harboring mutations in genes for various effector proteins.
Similar to the WT strain, sseJ, sseI, pipB2, sopD2, sifB,
sspH1, sspH2 and slrP mutant strains accumulated in the
juxtanuclear region of infected cells up to 16 h p.i. (data
not shown). By contrast, Salmonella strains deficient in
sseF or sseG displayed a predominantly scattered distribution in infected HeLa cells (Figure 1B,C). To analyze if the
observed effect was restricted to the epithelial cell line
HeLa, we also analyzed the localization of SCV in the
fibroblast cell line COS-7 and the murine macrophage-like
cell line RAW264.7 after infection with WT Salmonella and
various mutant strains. A reduction of juxtanuclear SCV
formation for mutant strains deficient in ssaV, sseF or
sseG was observed in COS-7 cells, similar to the phenotype in HeLa cells (Figure 1D). As macrophages are important host cells for Salmonella, we also investigated the
formation of microcolonies in the macrophage-line cell line
RAW264.7. However, this analysis was hampered by the
more compact cell morphology of RAW264.7 cells and
phagocytic uptake of multiple bacteria (data not shown).
Thus, we focused on HeLa cells as an infection model.
To test if intracellular replication of Salmonella is affected
by the positioning of the SCV, we compared the proliferation of Salmonella WT with strains deficient in ssaV, sseF
and a plasmid-complemented sseF strain (Figure 2). These
analyses indicated that the intracellular proliferation of an
sseF strain is reduced to an extent similar to that of the
ssaV strain deficient in the translocation of the entire set
of SPI2 effector proteins. The intracellular proliferation of
the sseF strain could be restored by plasmid-borne SseF.
A comparable effect on intracellular proliferation has been
previously reported for effector protein SseG (7).
Effector protein SseF affects the distribution of the
motor protein dynein
The role of SPI2 in the positioning of the SCV described
above and previous observations on the interference of
SPI2 effector proteins with microtubule organization
prompted us to analyze the distribution of microtubule
motor proteins. In accordance with previous observations
(8), dynein was found to accumulate in the immediate
vicinity of the bacterial microcolonies (clusters consisting
951
Abrahams et al.
SPI2
B
C
100
2 h p.i.
WT
4 h p.i.
ssaV
ns
ns
80
60
40
*
*
*
20
0
ss
W
T
aV
ss
eF
ss
eG
ss
eJ
ss
eI
WT
% infected cell with
juxtanuclear microcolonies
A
D
6 h p.i.
8 h p.i.
sseG
% infected cell with
juxtanuclear microcolonies
100
sseF
ns
ns
80
ns
60
40
*
*
20
*
*
]
eF
eI
ss
[s
s
eF
ss
G
eJ
ss
eF
eG
ss
eF
ss
cB
ss
ss
aV
W
ss
T
0
12 h p.i.
10 h p.i.
sseJ
Figure 1: Role of SPI2 in positioning of intracellular Salmonella. (A) HeLa cells were infected with S. typhimurium wild-type (WT) and
an ssaV strain deficient in SPI2–T3SS function (SPI2) (LPS, green). At various time points post-infection (p.i.), cells were fixed and
immunostained for Salmonella LPS (green) and the trans-Golgi network using antibodies against Golgin97 (red). Micrographs show
merged immunofluorescence and phase-contrast images for representative infected host cells. Scale bar: 10 mm. (B) HeLa cells were
infected with WT S. typhimurium, the ssaV strain or various strains deficient in genes encoding SPI2 effector proteins. Cells were fixed
16 h p.i. and immunostained as for panel (A). Cells showing representative phenotypes for S. typhimurium WT and mutant strains
deficient in ssaV, sseF, sseG or sseJ are presented. Scale bars correspond to 10 mm. (C) HeLa cells were infected with various
S. typhimurium strains and 16 h p.i., the appearance and subcellular localization of the bacteria were analyzed. Infected cells with clusters
of replicating bacteria (microcolonies) in a juxtanuclear position were scored positive, while infected cells with a scattered distribution of
individual bacteria or microcolonies in the cell periphery were scored negative. At least 50 infected cells per infecting strain were analyzed
and mean values and standard deviation of three independent experiments are shown. (D) COS-7 cells were infected with WT
S. typhimurium and various mutant strains at an MOI of 50. Quantification of juxtanuclear microcolonies was analyzed 16 h after infection
basically as described for HeLa cells. The means and standard deviations of three independent experiments are shown. Statistical
analyses of mutant strains versus WT: *, p < 0.001; ns, not significant.
952
Traffic 2006; 7: 950–965
SseF and SCV positioning
25
SspH2 or SlrP were found to accumulate dynein at a level
similar to that found for the WT strain, SseF- or SseG-deficient
strains accumulated dynein at a markedly reduced level. The
inability of the SseF-deficient strain to recruit dynein was
shown to be specific, because a plasmid encoding SseF
could restore the ability of the SseF mutant strain to recruit
dynein to the SCV (Figure 3B, ‘sseF [sseF ]’).
2 h p.i.
Intracellular CFU/mL × 10–4
14 h p.i.
20
15
10
5
WT
ssaV
sseF
sseF [sseF ]
Infecting strain
Figure 2: Role of SseF for intracellular proliferation of
Salmonella in HeLa cells. HeLa cells were infected at an MOI
of 1 with Salmonella wild-type (WT), ssaV and sseF strains, and
the sseF strain harboring a plasmid for the complementation of
the sseF mutation. At 2 and 14 h after infection, infected host
cells were lysed by addition of Triton-X-100 and the colonyforming units (CFU) of intracellular Salmonella were quantified
by plating serial dilutions onto agar plates. The data show representative mean CFU/mL of lysates and the standard deviation of
mean and are representative of three independent experiments.
of five or more bacteria) in HeLa cells infected with WT
Salmonella for 16 h (Figure 3A). Dynein recruitment to the
SCV was not detectable prior to 8 h after infection and the
proportion of cells displaying dynein recruitment to the SCV
increased over time from about 8% to 62% at 8 and 12 h p.i.,
respectively. The observation of dynein recruitment to the
SCV [(8), this study] is in contrast to the work of Boucrot
et al. (10) that did not reveal dynein recruitment to the SCV
at 10 h after infection. A further study (9) did not indicate
dynein recruitment to the SCV, but the analyses were performed at 3 h p.i. After infection with the ssaV or the sseF
strain, the number of microcolonies was highly reduced and
intracellular Salmonella frequently appeared scattered
throughout the host cells as shown for an sseF-infected
HeLa cell (Figure 3A ‘sseF scattered’). For the analyses of
dynein recruitment, only those host cells were scored that
showed formation of microcolonies as shown in Figure 3
‘sseF microcolony’. Microcolonies formed by the ssaV strain,
which is deficient in translocation of all known SPI2–T3SS
effector proteins, displayed a marked decrease in its ability
to recruit dynein. To identify the SPI2 effector proteins
involved in the recruitment of dynein to the SCV, strains
harboring mutations in genes for various SPI2 effector proteins were examined (Figure 3B). While mutant
strains deficient in SseJ, SseI, PipB2, SopD2, SifB, SspH1,
Traffic 2006; 7: 950–965
Formation of juxtanuclear microcolonies requires the
function of microtubule motor dynein
To investigate the role of dynein in more detail, we performed experiments to interfere with dynein function.
Dynein activity can be inhibited by sodium o-vanadate
(22,23), and we analyzed the formation of juxtanuclear
microcolonies in the presence of this compound. In HeLa
cells infected with WT Salmonella, the preincubation of
cells with o-vanadate resulted in a dose-dependent reduction of microcolony formation (Figure 4A). o-Vanadate at a
non-toxic concentration of 100 mM is frequently used to
inhibit dynein function (24,25) and as we also did not
observe negative effects on host cells, this concentration
was used for further studies. To further investigate
whether dynein function is required for formation of juxtanuclear microcolonies, o-vanadate was added at various
time points after infection and the number of microcolonies quantified 16 h p.i. (Figure 4B). o-Vanadate addition at
early time points after infection caused a strong reduction
in microcolony formation, while the effect of the inhibitor
decreased at later time points of addition. We observed a
linear dependency between the time point of inhibition of
dynein function and the formation of microcolonies, indicating that dynein function is continuously required for
formation of the SCV and the growth of microcolonies.
Dynein function can also be altered by overexpression of
the dynactin complex subunit p50/dynamitin (26) or the
presence of a dominant-negative allele of the Rab7 effector protein RILP (27). We generated a transfection construct for expression of p50/dynamitin–EGFP and
observed that in transfected HeLa cells the organization
and subcellular localization of the Golgi and late endosomal/lysosomal compartments was dramatically altered, a
phenotype consistent with the disruption of the dynactin
complex and dynein motor function (28) (see also
Supplementary Figure S1). Overexpression of p50/dynamitin was found to reduce the formation of juxtanuclear
SCV by approximately 40% relative to cells transfected
with a control EGFP-expressing plasmid (Figure 4C).
Similar to previous observations (8), disruption of dynein
function by overexpression of p50/dynamitin was also
found to inhibit the intracellular replication and the ability
of Salmonella to form SIF in infected cells (data not
shown). In addition, expression of dominant-negative
RILP-C33 strongly reduced the formation of juxtanuclear
microcolonies, while expression of WT RILP had no effect
(Figure 4C). A similar level of dynein recruitment to microcolonies formed by WT Salmonella was observed in cells
transfected with control and RILP vectors. For most of the
953
Abrahams et al.
A
Salmonella
Dynein
Merge
WT
sseF
scattered
sseF
microcolony
Mock
B
100
% microcolonies with
dynein accumulation
ns
ns
ns
80
ns
ns
ns
60
ns
ns
ns
40
*
20
*
*
*
*
eF
pi
pB
2
so
pD
2
si
fB
ss
pH
1
ss
pH
2
sl
rP
ss
T
aV
ss
W
ss
eI
[s sse
se F
F
]
eJ
ss
eF
eG
ss
aV
ss
ss
W
T
0
Figure 3: SPI2 effectors mediate the recruitment of microtubule motor dynein to Salmonella microcolonies. HeLa cells were
infected with various S. typhimurium strains and the distribution of cytoplasmic dynein was analyzed. Cells were fixed 16 h post-infection
(p.i.) and processed for staining of Salmonella (green) or dynein (red). (A) Confocal micrographs showing dynein distribution in uninfected
cells (mock) or cells infected with wild-type (WT) Salmonella or the indicated mutant strains. Note the accumulation of dynein at a
microcolony of the WT strain. The frequency of microcolony formation was 81 5% for the WT strain and 19 1% for the ssaV strain.
Microcolony formation was also reduced after infection with sseF or sseG strains. Infection with these mutant strains frequently resulted
in the appearance of a scattered distribution of the intracellular bacteria (shown for sseF ‘scattered’). For the subsequent analysis of
dynein accumulation, only those infected cells were considered that showed typical microcolonies of at least five bacteria (as shown for
sseF ‘microcolony’). Scale bars represent 10 mm. (B) The recruitment of dynein to microcolonies was quantified. After infection with
various Salmonella strains, cells harboring microcolonies were identified and scored for the appearance of condensations of dynein. At
least 50 microcolonies per infecting strain were scored and the means and standard deviation for three independent experiments are
shown. Statistical analyses of mutant strains versus WT: *, p < 0.001; ns, not significant.
954
Traffic 2006; 7: 950–965
SseF and SCV positioning
A
B
% infected cells with
juxtanuclear microcolonies
80
C
*
60
*
*
40
*
*
* * * *
* *
* *
*
ns
ns
*
*
*
20
*
ss
aV
ve
ct
or
ct
or
0
ve
p5
W
T
33
W
T
-C
0 1 2 3 4 5 6 7 8 9 10 11 Mock
Time after infection o-vanadate added (h)
W
T
200
R
100
IL
P
50
R
10
o-Vanadate (μM)
W
T
0
IL
P
0
Figure 4: Formation of Salmonella microcolonies requires dynein motor activity. (A) HeLa cells were infected with wild-type (WT)
Salmonella. Various amounts of sodium o-vanadate as indicated were added 30 min prior to infection to HeLa cells and maintained
throughout the experiment. The cells were fixed 12 h post-infection (p.i.) and the formation of juxtanuclear microcolonies was quantified
by analyses of at least 100 infected cells. Statistical analyses: *, p < 0.001. (B) HeLa cells were infected with WT Salmonella and 100 mM
sodium o-vanadate was added at various time points after infection as indicated. Cells were fixed 12 h after infection and the formation of
juxtanuclear microcolonies was quantified in at least 100 infected cells per time point. Statistical analyses (inhibitor versus mock: *,
p < 0.001; ns, not significant. (C) To further investigate the role of the dynein motor complex in SCV localization, the formation of
juxtanuclear microcolonies of WT Salmonella was quantified after transfection of HeLa cells with constructs for expression of p50/
dynamitin, RILP or RILP-C33. As a control, HeLa cells were transfected with the vector pEGFP-N3 and infected with WT or SPI2-deficient
Salmonella. The formation of juxtanuclear microcolonies was quantified 16 h after infection for at least 50 transfected and infected cells.
Statistical analyses of constructs versus vector transfection: *, p < 0.001; ns, not significant.
microcolonies formed in cells transfected with the RILPC33 or p50/dynamitin constructs, dynein recruitment was
not detectable (data not shown). Taken together, these
observations indicate that the function of the dynactin–
dynein motor complex is required for the formation of
juxtanuclear microcolonies of replicating Salmonella.
Functional dissection of SseF
The biological function of the SPI2 effector protein SseF is
only partially understood and the observed function of
SseF in modifying microtubule motor distribution suggested a novel role for this protein. In order to investigate
the molecular functions of SseF, a deletional analysis was
performed. We previously observed a strict association of
translocated SseF with endosomal membrane systems
containing lysosomal glycoproteins (lgp) such as LAMP-1
or LAMP-2 (19). Furthermore, subcellular fractionation
revealed the presence of translocated SseF in the membrane fraction of the host cell. Sequence analyses of SseF
indicated the presence of several hydrophobic regions that
may act as transmembrane (TM) domains (Figure 5A). To
gain further insight into the potential role of these domains
in the subcellular localization and biological function of
SseF, a series of in-frame, HA epitope-tagged deletion
mutants of SseF consisting of eight internal deletions
(SseFD1 to SseFD8) and four C-terminal deletions
(SseFDC1 to SseFDC4) were generated (see Figure 5B
for schematic representation of the deletions). The internal deletions were designed to delete, entirely or in part,
Traffic 2006; 7: 950–965
the putative TM domains. To examine whether the various
mutant proteins were synthesized by Salmonella in vitro,
the various constructs were introduced into a mutant
strain deficient in synthesis of SseF (strain HH107) and
the bacterial strains grown under conditions previously
shown to induce the expression of SPI2 genes. Western
blot analysis with an antibody to the HA epitope revealed
single bands of the predicted molecular weights for each
of the deletion constructs, barring SseFD1 and SseFD2,
which did not appear to give rise to detectable amounts of
protein under the experimental conditions used (data not
shown, results summarized in Figure 5C).
Translocation of the epitope-tagged derivatives of SseF by
intracellular Salmonella was next analyzed by confocal
microscopy following infection of HeLa cells. In accordance with previous results, full-length epitope-tagged
SseF was translocated by intracellular Salmonella, where
it was found to co-localize extensively with LAMP-1 or
LAMP-2 present in the membranes of the SCV, as well
as in SIF. A similar intracellular distribution was found for
four of the internal deletion mutants (SseFD5 to SseFD8,
see Supplementary Figure S2 for representative infected
cells). In contrast, no signal for HA-tagged proteins was
observed for mutant proteins encoding either the first
N-terminal 55 amino acids (aa) of SseF (SseFDC1), or
those lacking TM1 either in part (SseFD4) or in its entirety
(SseFD3), suggesting a lack of translocation by Salmonella
of these particular mutant proteins or their rapid
955
Abrahams et al.
TM1
A
TM2
Hydropathicity index
N
+2.18
C
0
–1.01
1
B
40
80
120
160
200
240
C
n
sio
construct
p
s
re
Ex
Deletion
TM1
TM2
an
Tr
HA
n
on
s
tio
ati
inu
fec
s
rm
n
e
t
a
CTr
c
slo
+
+
+
CP
12–49
–
–
+
nd
Δ2
39–49
–
–
+
nd
Δ3
63–110
+
–
+
nd
Δ4
87–110
+
–
+
nd
Δ5
127–212
+
+
+
CP
Δ6
148–212
+
+
+
CP
Δ7
179–212
+
+
+
CP
227–253
+
+
+
nd
ΔC1
56–260
+
–
nd
nd
ΔC2
129–260
+
+
nd
CP
ΔC3
188–260
+
+
nd
CP
ΔC4
227–260
+
+
nd
nd
WT
–
Δ1
Δ8
N
C
Figure 5: Functional dissection of SPI2 effector protein SseF. (A) Hydropathy plot of SseF and localization of putative membranespanning domains. The hydrophobicity was calculated using the Kyte–Doolittle algorithm and putative transmembrane (TM) segments
were predicted using TMpred. Two TM segments were predicted: TM1 (aa 69–96) with one TM helix and TM2 (aa 131–205) with three
TM helices. (B) Schematic representation of mutant alleles of sseF analyzed in this study. A set of plasmids was constructed harboring
wild-type (WT) sseF or various mutant alleles. In all constructs, a sequence encoding the HA tag was fused to the 3´ end of sseF. The
positions of internal deletions in sseF (sseFD1 to sseFD8) and C-terminal truncations of sseF (sseFDC1 to sseFDC4) are indicated by
arrows and dashed lines. The extent of the deletion is further specified by the first and last deleted codon. (C) Analysis of synthesis and
translocation of mutant constructs of SseF. For analyses of expression, S. typhimurium WT harboring plasmids for the expression of WT
sseF or various mutant alleles was grown in PCN (non-inducing media) and PCN-P minimal media (inducing media). Equal amounts of
bacterial cells were harvested and processed for Western blot analyses with an antibody against the HA tag. The presence or absence of
SseF-HA or mutant proteins is indicated by þ and –, respectively. For analyses of translocation, HeLa cells were infected with
S. typhimurium WT harboring the various plasmids. At 16 h p.i., the cells were fixed and processed for immunostaining of Salmonella
LPS and the HA tag. The presence or absence of translocated SseF is indicated by þ or –, respectively (for further details, refer to
Supplementary Figure S2). To determine the localization of the C terminus of SseF and derivatives, HeLa cells were infected with the
sseF-deficient strain harboring plasmids for the expression of WT sseF (WT) or various mutant alleles of sseF. Sixteen hours after
infection, cells were subjected to digitonin permeabilization and immunostaining of the HA tag was performed. CP indicates that the HA
tag at the C-terminal of SseF and derivatives was accessible to immunostaining; nd, not determined.
degradation within eukaryotic cells. The mutant alleles of
sseF were also subcloned into pTre-Tight for inducible
expression after eukaryotic cell transfection. After transfection, the constructs SseFD1 to SseFD8 were all
detected by immunofluorescence, indicating that the epitope tag of SseFD3 and SseFD4 is accessible in eukaryotic
956
cells, but that these constructs cannot be translocated by
intracellular Salmonella. We observed that SseFD1 to
SseFD8 preferentially co-localized with TGN markers
after expression by transfection vectors (Supplementary
Figure S3). Thus, the subcellular distribution of SseFD5 to
SseFD8 after bacterial translocation was different from
Traffic 2006; 7: 950–965
SseF and SCV positioning
those of transfection constructs. A similar observation of an
artificial Golgi localization after transfection has been made
for SseG (6), indicating that eukaryotic transfection may be
of limited use for the study of these particular SPI2–T3SS
effectors. To test if the various deletions result in a major
alteration of the topology of the SseF derivatives, localization of the C-terminus was probed by immunostaining for
the HA tag after selective permeabilization of the plasma
membrane. The C-terminus of WT SseF and of various
mutant proteins was accessible from the cytoplasm
(Figure 5C, Supplementary Figure S4), suggesting that the
deletions did not cause massive alterations of the topology
of SseF. For further studies, constructs SseFD5 to SseFD8
and SseFDC1 to SseFDC4 were used for functional analyses in the background of the sseF strain.
A hydrophobic region in SseF is essential for effector
functions
The formation of SIF in Salmonella-infected HeLa cells was
shown to be dependent on a functional SPI2–T3SS. Although
the sseF strain induced the formation of filamentous structures in infected cells, these displayed only a punctate distribution of lgp markers, as opposed to the continuous
distribution found in cells infected with the WT strain. This
phenotype was referred to as pseudo-SIF (19). Consistent
with previous results, cells infected with strain HH107 expressing WT sseF induced SIF that displayed a continuous distribution of LAMP-2 (Supplementary Figure 2). In contrast, an
sseF mutant strain was severely compromised in its ability to
induce the continuous distribution of LAMP-2 along SIF. The
formation of SIF was fully restored in the sseF mutant strain
by complementation with a plasmid harboring the epitopetagged, full-length version of sseF. In order to determine
whether the translocated mutant proteins were impaired in
their ability to form SIF, HeLa cells were infected with WT and
various mutant strains and the formation of SIF and pseudoSIF was quantified (Figure 6A,B). Similar to results observed
for plasmid-borne WT SseF, SIF were predominantly
observed when cells were infected with strains harboring
the SseFD8 or SseFDC4 constructs. In contrast, the number
of SIF observed in Salmonella strains translocating proteins
that lacked part of, or the entire, TM2 (SseFD5 to SseFD7 and
SseFDC2 and SseFDC3) was markedly reduced, a phenomenon that was accompanied by an increase in the number of
pseudo-SIF formed.
The infection of HeLa cells with WT Salmonella also
induced the formation of massive bundles of microtubules
in a fraction of the host cells, and previous work demonstrated that this phenotype is dependent on the function
of the SPI2–T3SS and a subset of SPI2 effectors including
SseF (6). In accordance with the previous study, SPI2–
T3SS effectors other than SseF and SseG did not contribute to this phenotype (Figure 6C,D and data not shown).
We analyzed the effect of deletions of various domains of
SseF for the induction of microtubule bundling (Figure 6D).
The deletion of sseF could be complemented by plasmidborne WT SseF as well as by SseFD8 or SseFDC4.
Traffic 2006; 7: 950–965
Translocation of SseF derivatives with deletions affecting
the TM2 domain, however, resulted in highly reduced
microtubule bundling. These observations indicate that the
TM2 domain is essential for the effector function of SseF.
A hydrophobic domain in SseF is essential for
positioning of intracellular Salmonella and
recruitment of dynein to Salmonella-containing
vacuoles
In order to investigate the molecular requirements of SseF in
the positioning of the SCV, we investigated the effect of
mutations in SseF on the formation of juxtanuclear microcolonies in HeLa cells (Figure 7A,C). The reduced appearance
of microcolonies was restored to WT levels by complementation with plasmid-borne WT SseF. Microcolony formation
similar to that in WT Salmonella-infected cells was also
observed for the sseFD8 and sseFDC4 alleles, while the
strains expressing other sseF alleles showed a highly
reduced appearance of microcolonies (Figure 7C).
Our initial observations (Figures 1 and 3) suggested a
relationship between the SPI2-dependent recruitment of
dynein to the SCV and the formation of juxtanuclear microcolonies. To further investigate this correlation, we established whether strains translocating any of the mutant
SseF derivatives were defective in their ability to recruit
dynein to the Salmonella microcolonies (Figure 7B). The
percentage of microcolonies associated with this motor
protein in cells infected with the sseF strain harboring
plasmids for expression of WT sseF or mutant alleles
was enumerated (Figure 7D). Whereas the sseF strain
translocating SseFD8 recruited dynein at levels similar to
the complemented sseF mutant strain, deletion mutants
lacking regions located within TM2 showed reduced levels
of dynein association at the SCV as found in the sseF
mutant strain. Reduced dynein recruitment was observed
for all mutant SseF derivatives including sseFD7 with the
smallest deletion within the TM domain (Figure 7D).
Taken together, these data demonstrate that the integrity
of the hydrophobic TM2 domain of SseF is crucial for
the recruitment of dynein to the SCV, the subcellular localization of the SCV and the ability to form replicative clusters
of bacteria in a juxtanuclear position within host cells.
Discussion
The intracellular life of Salmonella depends on a highly
dynamic interaction with transport processes of the host
cell. Internalized bacteria have to avoid the default endocytic
pathway and the effect of antimicrobial mechanisms of the
host cells. In addition, the successful intracellular phase of
Salmonella requires the access to nutrients and a constant
supply of membrane compartments to allow for extension
of the SCV. In this work, we demonstrate that intracellular
WT Salmonella can manipulate the positioning of the SCV in
such a manner that the formation of juxtanuclear
957
Abrahams et al.
A
B
SIF
pseudo-SIF
*
ns
80
ns
ns
*
*
*
60
40
*
*
*
*
*
*
*
*
se
eF
]
FΔ
5
[s
se ]
FΔ
6
[s
se ]
FΔ
7
[s
se ]
FΔ
[s
se 8]
FΔ
C
[s
se 1]
FΔ
C
[s
se 2]
FΔ
C
[s
se 3]
FΔ
C
4]
ns *
[s
[s
s
ss
eI
eJ
ss
eG
eF
ss
ss
W
T
aV
**
0
*
*
ns
ns
20
*
*
*
ss
% infected cells positive
100
D
70
60
ns
ns
ns
ns
50
40
30
*
20
10
*
*
*
*
*
*
*
*
F
[s Δ5]
se
FΔ
6
[s
se ]
FΔ
7
[s
se ]
FΔ
[s
se 8]
FΔ
C
[s
se 1]
FΔ
C
[s
se 2]
FΔ
C
[s
se 3]
FΔ
C
4]
se
[s
[s
s
eF
]
eI
ss
eJ
ss
eG
ss
eF
ss
ss
W
aV
0
T
% infected cells with MT bundling
C
Figure 6: A short hydrophobic segment in SseF is essential for SseF-mediated phenotypes. To investigate the role of SseF and its
deletion derivatives in Salmonella-induced filament (SIF) formation and microtubule bundling, HeLa cells were infected with
S. typhimurium wild-type (WT) or mutant strains deficient in ssaV, sseF, sseG, sseI or sseJ (A,C), or the sseF strain harboring plasmids
for the expression of WT sseF or various mutant alleles (B,D). Sixteen hours post-infection (p.i.), cells were fixed and processed for
immunostaining of S. typhimurium and LAMP-2, and the formation of SIF (filled bars) or pseudo-SIF (open bars) was enumerated by
confocal microscopy (A,B). SIF and pseudo-SIF formation was enumerated for at least three experiments with at least 50 infected cells
per infecting strain, and the values shown are the average the standard deviation for four experiments. For analyses of Salmonellainduced microtubule bundling, cells were fixed 16 h p.i. and processed for immunostaining of Salmonella and b-tubulin (C,D). Cells
infected with Salmonella were analyzed for the appearance of the microtubule (MT) cytoskeleton and cells showing massive bundles of
MT were scored as positive for MT bundling. For each strain, at least 50 infected cells were scored and the percentage of infected cells
showing bundling of microtubules is given. Statistical analyses in A and C of mutant strains versus WT, and in B and D of the sseF strain
complemented with various mutant alleles versus WT sseF: *, p < 0.001; ns, not significant.
microcolonies is favored, while mutant strains with defects
in intracellular pathogenesis predominantly showed a dispersed distribution of SCV containing single bacteria.
A number of recent studies have demonstrated that intracellular Salmonella interferes with both microtubule- and
motor protein-dependent functions, and that this interference plays an essential role in ensuring the proper maturation of the SCV (5,8,10). In line with these observations,
our group observed that a subset of effector proteins of
the SPI2–T3SS, including SseF and SseG, is targeted to
microtubules and are involved in the alteration of the
structure of the microtubule cytoskeleton, which can
lead to the formation of massive bundles of microtubules
(6). The data presented in this study suggest that the SCV
behaves in a manner analogous to that of many other
958
cellular organelles, in that its intracellular positioning is
controlled in a host cell motor protein-dependent manner.
By following the fate of WT Salmonella and various
mutant strains in infected cells, we could show that the
bacteria assume a juxtanuclear location 2 h after infection.
It was reported that the dynactin–dynein complex is
required for the initial juxtanuclear localization of the SCV
(5) and we observed that this process was independent
from the SPI2 phenotype of the infecting strain. While the
majority of WT Salmonella remained in the juxtanuclear
region where replicative clusters developed, strains deficient in the SPI2–T3SS frequently assumed an aberrant
intracellular position. The SCV containing the SPI2 strain
frequently displayed a dispersed distribution within the
cytoplasm, in stark contrast to the focal microcolonies
formed by WT Salmonella during intracellular growth.
Traffic 2006; 7: 950–965
SseF and SCV positioning
A
sseF [sseF]
sseF [sseFΔ8]
sseF [sseFΔ5]
Salmonella
Dynein
Merge
B
sseF
[sseF]
sseF
[sseFΔ5]
sseF
[sseFΔ8]
D
*
0
40
20
*
*
*
*
*
*
0
]
Δ5
se ]
F
[s Δ6
se ]
F
[s Δ7
se ]
F
[s
se Δ8]
F
[ s ΔC
se 1
F ]
[s ΔC
se 2
F ]
[ s ΔC
se 3
FΔ ]
C
4]
20
*
[s
*
*
F
*
se
*
eF
40
ns
60
[s
s
60
ns
80
[s
ns
% microcolonies with
dynein accumulation
100
ns
80
[s
s
[s eF
se ]
[s FΔ
se 5]
[s FΔ6
se ]
[s FΔ7
s
[s eFΔ ]
se 8
[s FΔC ]
se 1
[s FΔC ]
se 2
[s FΔC ]
se 3
FΔ ]
C
4]
% infected cells with
juxtanuclear microcolonies
C
Figure 7: A hydrophobic domain in SseF is required for dynein recruitment to the SCV and intracellular positioning. HeLa cells
were infected with the sseF mutant strain harboring plasmids for the expression of wild-type (WT) sseF or various mutant alleles. (A)
Immunostaining was performed for Salmonella LPS (green) and TGN (stained for Golgin97, red) as described in the legend to Figure 1.
Micrographs of merged images with the phase contrast image show the typical appearance of Salmonella in infected cells. Scale bar: 10 mm
(B) Immunostaining for Salmonella LPS (green) and dynein (red) was performed with cells fixed 16 h p.i. The distribution of dynein is shown
in representative cells infected with the sseF strain complemented with sseF, sseFD5 or sseFD8 with microcolony formation. (C) The
formation of juxtanuclear microcolonies as shown in panel (A) was quantified. The histograms show the mean values with standard deviation
obtained from at least three independent experiments. (D) Dynein accumulation at microcolonies was quantified after infection with the sseF
harboring plasmids for the expression of WT sseF or various mutant alleles. Representative infected cells observed after infection with sseF
[sseFD5] or sseF [sseFD8] are shown in (B). For each infecting strain, 50 host cells harboring microcolonies were scored for dynein
distribution. The average the standard deviation was enumerated for at least three independent experiments. Statistical analyses of the
sseF strain complemented with various mutant sseF alleles versus WT sseF: *, p < 0.001; ns, not significant.
This phenotype was found to specifically depend on the
effector proteins SseF and SseG, as mutant strains deficient in the translocation of other effector proteins, other
than SifA, behaved in a manner similar to the WT strain
with respect to their intracellular localization.
Traffic 2006; 7: 950–965
Our results demonstrate that the function of SseF is
required for the recruitment of dynein to the SCV.
Dynein recruitment also required the function of SseG,
an effector protein previously described as being required
for the targeting of Salmonella to the Golgi apparatus in
959
Abrahams et al.
A
12–49
TM1
63–110
TM2
128–179
227–253
N
role of domain:
C
Chaperone
binding?
Secretion No apparent role in localization
translocation contributes to effector functions
B
+
(a)
(b)
WT
(c)
(d)
sifA
–
sseF/sseG
Golgi
Nucleus
Microtubules
Dynein
Kinesin
lgp
Intracellular cargo
Figure 8: Models for the organization of functional domains in SseF and the role of SseF in the intracellular fate of Salmonella.
(A) Functional domains in SseF. Based on the mutational analyses and functional assays, a domain structure of SseF is proposed. An
N-terminal region (aa 12–49) is essential for the stability of SseF. SscB, the specific chaperone of SseF may bind in this region. Domain
TM1 (aa 63–110) is required for the secretion and translocation of SseF. Essential effector functions of SseF are located in the TM2
domain (aa 128–179). However, this domain is not important for the subcellular localization of SseF. No important function was attributed
to the C-terminal part (aa 210–260), and this region appeared dispensable for stability, translocation and all cellular phenotypes analyzed
here. (B) Model for inference of intracellular Salmonella with microtubule motor proteins. Dynein and kinesin motors mediate minus-endand plus-end-directed transport of cellular cargo along microtubules, respectively (a). After internalization, endosomes containing
Salmonella enter a subcellular localization in juxtaposition to the nucleus and Golgi. By activities of effectors of the SPI2–T3SS, the
SCV is modified and replication initiates (b). The function of SifA is required to interfere with kinesin activity and the integrity of the SCV
containing a sifA mutant strain is lost (c). Effector proteins SseF and SseG are required to maintain the SCV in a juxtanuclear position.
SseF is required for the recruitment of dynein to the SCV and SCV containing the sseF strains are displaced to the cell periphery (d).
Formation of an SCV allowing Salmonella replication requires a fine-tuned balance between recruitment of dynein and kinesin by the
concerted activity of SifA, SseF and SseG.
infected cells (7). While a subset of sseF- and sseGdeficient Salmonella was still able to form microcolonies
in a juxtanuclear position, the SCV containing these strains
were mostly devoid of detectable levels of dynein recruitment. In contrast, SCV harboring clusters of WT
Salmonella usually displayed a distinct accumulation of
dynein in the immediate vicinity of the SCV. As dynein is
the major minus-end-directed motor protein responsible
for the transport to, and subsequent retention of organelles in the juxtanuclear region of the cell, our results
suggest that the dispersal of these strains arises due to
their inability to actively recruit dynein to the membrane of
the SCV. Support for this hypothesis was provided by the
observation that that inhibition of dynein motor activity
results in the reduced formation of juxtanuclear microcolonies, resembling the phenotypes observed for an sseFor sseG-deficient strain.
960
Based on these findings, we propose that the recruitment
of dynein to the SCV is associated with the proper positioning of the SCV in infected cells, a process that facilitates
and promotes the intracellular replication and formation of
microcolonies of Salmonella. The retrograde movement of
bacteria towards the microtubule-organizing center (MTOC)
was demonstrated for several facultative intracellular pathogens such as Campylobacter jejuni (24), Orientia tsutsugamushi (29) and Chlamydia trachomatis (30,31) and an
involvement of dynein was observed. In the latter example,
transport of C. trachomatis inclusions to the juxtanuclear
region was, however, shown to occur independently of the
dynactin complex, seeing that overexpression of p50/
dynamitin had no effect on the juxtanuclear positioning of
intracellular bacteria. This led to the proposal that chlamydial proteins are involved in the recruitment of dynein to the
membrane of the inclusion in a manner that is independent
Traffic 2006; 7: 950–965
SseF and SCV positioning
of the cargo-binding subunits of dynactin. Previous observations by Harrison et al. (5) indicated that, following invasion of host cells, the dynactin–dynein complex is required
for initial transport of the SCV to a juxtanuclear location. A
similar requirement for recruitment of the dynactin–dynein
complex in the maintenance of the SCV within the juxtanuclear region was observed in this study, because
increased bacterial dispersal was observed in response to
overexpression of either RILP-C33 or p50/dynamitin. This
would suggest that the recruitment of dynein to the SCV
occurs in a manner mechanistically distinct from that
observed for C. trachomatis. At present, the molecular
mechanisms underlying the SseF- and SseG-mediated
recruitment of dynein to the SCV are unknown. Possible
explanations could be the modification of the vacuolar
membrane that increases its affinity for the dynein motor
protein or, alternatively, the interaction with upstream
effectors involved in the recruitment of dynein to membrane-bound cargo. Further work aimed at distinguishing
between these possibilities is currently underway.
We performed a mutational analysis of SseF to identify
domains of this effector important for the intracellular phenotypes. SseF derivatives with deletions in the N-terminal
region, i.e., aa 12–49 or 39–49 (SseFD1 and SseFD2,
respectively) were neither detectable in Salmonella nor
translocated into host cells, but expressed after transfection. Recent work by Dai and Zhou (32) demonstrated that
SscB functions as chaperone for SseF and is required for
the stability of SseF in the bacterial cytoplasm as well as for
the efficient secretion. The deletions of N-terminal regions
of SseF may interfere with SscB binding and render the
protein sensitive to proteolysis.
Our previous studies have demonstrated that translocated
SseF is targeted to both the SCV and SIF. The first 127 aa of
SseF are sufficient to mediate translocation and subsequent
targeting of SseF to these intracellular compartments.
Mutations affecting the integrity of TM1 (aa 63–110) also
affected the translocation of the mutant protein or their
stability after translocation (e.g., compare SseFDC1 with
SseFDC2 or SseFD3 and SseFD4 with SseFD5, Figure 6)
and prevented further analyses of this region with respect to
host cell phenotypes. It is likely that aa 60–127 play a critical
role in the translocation of SseF. A possible role of the region
aa 1–127 in functioning either as targeting determinants or in
additional modulation of SseF activity following translocation
will have to be addressed by future mutagenesis experiments that alter the primary sequence of SseF without
compromising its stability and/or translocation.
Our functional dissection of SseF further revealed that the
effector functions critically depend on the integrity of a
complex hydrophobic domain encompassed by TM2 (for a
model, see Figure 8A). Even a short deletion of 33 aa
located within TM2 resulted in the loss of SseF-dependent
phenotypes. While another experimental setup was used
for analysis of SseG, an effector sharing 30% identity with
Traffic 2006; 7: 950–965
SseF, a hydrophobic region was found to be essential for
the function of this effector (7). Interestingly, deletions in
the TM2 region of SseF not only affected the recruitment
of dynein and consequently the intracellular positioning of
the SCV, but also other SseF-dependent phenotypes such
as SIF formation and microtubule bundling (6,19). This
may indicate that the loss of SseF-mediated phenotypes
is due to the same basic defect in SseF function. While
the actual function of TM2 is unknown, it is possible that
disruption of TM2 interferes with the ability of SseF
to interact with host cell proteins required for its proper
function, or with other SPI2–T3SS effectors. Alternatively,
this region may be important for the proper integration of
SseF into endosomal membranes. These possibilities will
need to be addressed by further studies.
Many organelles possess the ability to move in a bidirectional manner along microtubules and regulate their cellular
positioning by controlling the recruitment or relative activities of motor proteins [reviewed by Welte (33)]. A recent
study by Boucrot et al. (10) described the role of SifA,
another SPI2–T3SS effector protein, in preventing the
excessive accumulation of kinesin at the SCV. This effect
was mediated by the recruitment of SKIP by SifA, and the
interference of the SKIP–SifA complex with kinesin accumulation. Furthermore, the recruitment of kinesin to the
SCV was postulated to be an active process mediated by
SPI2-encoded translocated effector proteins other than
SifA, given that kinesin accumulation to the SCV was only
rarely observed in a strain deficient for the translocation of
all known SPI-2 effectors. In contrast to the study of
Boucrot et al. (10), we observed a prominent recruitment
of dynein to the SCV containing WT Salmonella. Dynein
accumulation was reduced on SCV containing a SPI2–
T3SS null mutant strain or mutants deficient in sseF or
sseG, but dynein was present on SCV containing strains
deficient in other effectors of the SPI2–T3SS. Taken
together, these observations suggest that the positioning
and the integrity of the SCV depend on the SPI2-dependent
modulation of both dynein and kinesin recruitment. The
proper intracellular localization of SCV and intracellular replication requires the recruitment of the minus-end-directed
motor protein dynein through the action of SseF and SseG
and the prevention of plus-end-directed motor protein
through the action of SifA. Only the interference with
both motor activities allows for the proper positioning of
the SCV and efficient replication within host cells.
Based on our results on the role of SseF, and previous
studies on SifA and SseG we propose a model for the
concerted action of the three effector proteins (Figure 8B).
Translocated SifA interferes with the excessive recruitment of kinesin to the SCV and this activity prevents the
displacement of the SCV towards the cell periphery, as
well as the disruption of the SCV by the pulling force of
the plus-end-directed kinesin motor complex. SseF and
SseG counteract this activity by recruiting dynein as a
motor protein with an opposite, minus-end-directed
961
Abrahams et al.
activity. The simultaneous activity of these effector proteins results in the correct balance of plus- and minus-enddirected activities being maintained, thereby ensuring the
steady-state positioning of the SCV in a predominantly
juxtanuclear location. A defect in the translocation of
either one of these translocated effector proteins results
in plus-end-directed activity predominating, which manifests itself in the increased centrifugal movement of the
SCV. We therefore postulate that the successful intracellular proliferation of Salmonella depends on the prevention
of microtubule-dependent movement of the SCV that will
lead to dispersal of the bacteria.
It is well established that the maturation of the SCV occurs
via selective interactions with the endocytic pathway.
Recent observations in our laboratory have indicated that
Salmonella is also capable of interfering with exocytic
events in an SPI2-dependent manner (34), an activity that
may contribute to the biogenesis of the SCV. The ability of
Salmonella to manipulate the microtubule cytoskeleton and
its associated motor proteins to traffic towards, and subsequently establish a replication niche near the minus-ends of
microtubules, is likely to place the SCV in close apposition to
a variety of organelles such as late endosomes, lysosomes
and the Golgi apparatus, which maintain a predominantly
juxtanuclear position at steady state. Such an arrangement
would allow Salmonella to interfere with both endocytic and
exocytic trafficking events, thereby allowing it to gain privileged access to membrane compartments required for
vacuolar membrane biogenesis and SIF formation, as well
as nutrients required for intracellular growth that may otherwise be limiting within the intracellular environment.
Further evaluation of the mechanisms by which SPI2encoded effector proteins exploit both host cell motor
proteins and intracellular trafficking pathways to facilitate
its own growth and replication is likely to provide a better
understanding of intracellular bacterial pathogenesis and
of basic eukaryotic cell functions.
Materials and Methods
Bacterial strains
Bacterial strains and plasmids used in this study are listed in Table 1.
Salmonella enterica serotype typhimurium (S. typhimurium) strain 12023
was used as the WT strain and all mutant strains used are isogenic
derivatives thereof. Routine cloning and plasmid propagation were performed using Escherichia coli strains DH5-a or XL-1 blue. Bacteria were
routinely cultured in LB broth or on LB agar plates supplemented with
carbenicillin (50 mg/mL) and/or kanamycin (50 mg/mL) when required. To
test the expression of sseF alleles, cultures were grown in non-inducing
(PCN) and inducing (PCN-P) minimal media as previously described (35).
Recombinant DNA methods
DNA manipulations were performed according to standard procedures
(36). DNA restriction and modification enzymes were purchased from
MBI Fermentas (St Leon-Rot, Germany) and used in accordance with the
manufacturer’s instructions. PCR reactions were performed using proofreading polymerases (‘High Fidelity PCR Enzyme Mix’, MBI Fermentas) so
962
as to minimize the introduction of errors during the amplification process.
Genomic DNA, plasmids, PCR products, and DNA fragments were purified
using Qiagen (Hilden, Germany) kits according to the instructions of the
manufacturer. Plasmid constructs were introduced into E. coli and
S. typhimurium competent cells by electroporation.
For the creation of a p50/dynamitin-GFP-expressing plasmid, HeLa cDNA
was generated using total RNA extracted from HeLa cells with the Total
RNA Isolation Kit (MBI Fermentas) and the first-strand synthesis kit (MBI
Fermentas). The complete p50/dynamitin cDNA was subsequently PCR
amplified using primers p50-Dynamitin-EcoRI-For and p50-DynamitinBamHI-Rev, into which the appropriate restriction sites for cloning were
introduced. The resulting PCR product was cloned between the EcoRI and
the BamHI sites of the pEGFP-N3 vector (BD Clontech, Heidelberg,
Germany) and confirmed by DNA sequencing.
Generation of epitope-tagged derivatives of SseF
The construction of p2643, which encodes a full-length version of SseF
harboring a C-terminal HA epitope tag from the low-copy vector pWSK29,
has been previously described (6). The construction of in-frame deletion
derivatives of sseF was performed by the ‘splice-by-overlap-extension’
PCR method, using p2643 as a template. Oligonucleotides are listed in
Table 2. Briefly, first-round PCR reactions were performed using primer
SscB109-SmaI-For in conjunction with the relevant reverse primers
[SseF12-Rev, SseF39-Rev (for SseFD1 and SseFD2, respectively) SseF63Rev, SseF87-Rev (for SseFD3 and SseFD4, respectively), SseF127-Rev,
SseF148-Rev, SseF179-Rev (for SseFD5, SseFD6 and SseFD7, respectively) or SseF227-Rev (for SseFD8)], or with the T7-terminator primer in
conjunction with the relevant forward primer [SseF49-For (for SseFD1 and
SseFD2), SseF110-For (for SseFD3 and SseFD4), SseF212-For (for SseFD5,
SseFD6 and SseFD7) or SseF253-For (for SseFD8)]. PCR fragments generated in the first-round PCR were gel purified, and those containing the
corresponding overlapping ends were combined and used as a template in
a second-round PCR using the SscB109-SmaI-For and T7-terminator primer
as the forward and reverse primers, respectively. For generation of
C-terminal deletions of SseF, primer SscB109-SmaI-For was used in conjunction with primer SseF60-HA-XbaI-Rev, SseF120-HA-XbaI-Rev,
SseF180-HA-XbaI-Rev or SseF210-HA-XbaI-Rev. Each of the resulting
PCR products were gel purified, digested with SmaI and XbaI and cloned
into SmaI/XbaI-digested plasmid p2643 from which the WT sseF gene had
been excised. All of the constructions were confirmed by DNA sequencing.
Cell culture
The human epithelial cell line HeLa were obtained from ATCC and used
between passage numbers 5 and 25. Cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, PAA Laboratories, Cölbe, Germany) supplemented with 10% heat-inactivated fetal calf serum (FCS, Sigma, Taufkirchen,
Germany) and 2 mM glutamine at 37 C in an atmosphere of 5% CO2.
Bacterial infection of HeLa cells
For infection experiments, HeLa cells were seeded on glass coverslips in
24-well tissue culture plates at a density of about 8 104 cells/well 24 h
before infection. Salmonella typhimurium strains were grown in LB broth
containing the necessary antibiotics at 37 C with agitation to stationary
phase. The cultures were then diluted 1:30 with fresh LB broth and
incubated for another 3.5 h at 37 C with agitation to reach late logarithmic
phase. The OD600 of the cultures was adjusted with LB to 0.2 and the
bacteria were washed once with phosphate-buffered saline (PBS). Cells
were then diluted in DMEM containing FCS and glutamine and added to
the HeLa cells at a multiplicity of infection of 10. The bacteria were
centrifuged onto the cells at 500 g for 5 min and incubated for 25 min
at 37 C in 5% CO2. After infection, the epithelial cells were washed three
times with PBS and incubated for 1 h in medium containing FCS, glutamine and 100 mg/mL gentamicin. The medium was replaced with medium
containing FCS, glutamine and 10 mg/mL gentamicin for the remainder of
the experiment. At least 50 infected host cells were quantified for each
condition in each experiment, and all experiments were repeated three
times. For the quantification for intracellular proliferation, the same infection procedure was used but at various time points after infection, cells
Traffic 2006; 7: 950–965
SseF and SCV positioning
Table 1: Bacterial strains and plasmids used in this study
Strain or plasmid
Salmonella enterica serovar typhimurium strains
NCTC 12023
P2D6
HH107
HH108
MvP373
MvP377
MvP378
Plasmid
p2643
p3009
p3010
p3011
p3012
p3013
p3014
p3015
p3016
p3093
p3094
p3095
p3096
p3153
pEGFP-RILP
pEGFP-RILP-C33
Relevant characteristics
Reference
Wild-type
ssaV::mTn5
DsseF::aph
DsseG::aph
DsscB sseFG::aph
DsseJ::aph
DsseI::aph
NCTC, Colindale
(38)
(39)
(39)
(6)
(40)
(40)
PsseA sscB sseF::HA in pWSK29
PsseA sscB sseFD1::HA in pWSK29
PsseA sscB sseFD2::HA in pWSK29
PsseA sscB sseFD3::HA in pWSK29
PsseA sscB sseFD4::HA in pWSK29
PsseA sscB sseFD5::HA in pWSK29
PsseA sscB sseFD6::HA in pWSK29
PsseA sscB sseFD7::HA in pWSK29
PsseA sscB sseFD8::HA in pWSK29
PsseA sscB sseFDC1::HA in pWSK29
PsseA sscB sseFDC2::HA in pWSK29
PsseA sscB sseFDC3::HA in pWSK29
PsseA sscB sseFDC4::HA in pWSK29
p50/dynamitin in pEGFP-N3
EGFP-RILP
EGFP-RILP-C33
(6)
This
This
This
This
This
This
This
This
This
This
This
This
This
(8)
(8)
were washed with PBS and lysed by addition of 1 mL PBS containing 0.1%
Triton-X-100. Serial dilutions of the lysates were plated onto Mueller–
Hinton agar plates to determine the number of viable intracellular bacteria.
Transfection of HeLa cells
HeLa cells were seeded on glass coverslips in 24-well tissue culture plates
24 h before transfection at a density of 4 104 cells/well. Cells were
transiently transfected with Polyfect Transfection Reagent (Qiagen) using
0.2–0.4 mg DNA according to the manufacturer’s instructions. Cells were
subsequently incubated at 37 C in 5% CO2 for the indicated time periods
prior to fixation and antibody staining.
Immunofluorescence
For immunofluorescence, cells were fixed in 3% p-formaldehyde in PBS for
15 min at room temperature. For immunostaining of dynein, cells were fixed
in methanol for 5 min at 20 C, and then washed three times with PBS.
Antibodies were diluted in a blocking solution consisting of 2% bovine serum
albumin (BSA)/2% goat serum and 0.1% saponin (Sigma) in PBS. Cells were
incubated with primary antibodies at the recommended dilution for 1–3 h at
RT, washed three times with PBS, and incubated for 1 h with the appropriate
Cy2-, Cy3- or Cy5-conjugated secondary antibodies. Coverslips were
mounted on Fluoroprep (bioMèrieux, Nürtingen, Germany) and sealed with
Entellan (Merck, Darmstadt, Germany). Samples were analyzed using a confocal laser scanning microscope (TCS-NT Leica, Bensheim, Germany) or with
an Axiovert 200 microscope equipped with an Axiocam MR and an Apotome
(Zeiss, Göttingen, Germany). Image analyses were performed using AXIOVISION
4.3 software (Zeiss) and Adobe Photoshop.
Selective permeabilization of the plasma membrane
with digitonin
To analyze the localization of the HA epitope-tagged C terminus of WT
SseF and mutant proteins, the previously described digitonin treatment
(37) was modified. All incubation steps were carried out on ice in ice-cold
solutions. The cells were washed twice in KHM buffer (110 mM KAc,
Traffic 2006; 7: 950–965
study
study
study
study
study
study
study
study
study
study
study
study
study
20 mM Hepes pH 7.2, 2 mM MgAc) and then incubated for 5 min in
KHM, containing 10 mg/mL digitonin (Fluka, Taufkirchen, Germany). The
detergent was removed and the cells were incubated for 20 min in KHM
without digitonin to allow permeabilization. After a further washing step
with KHM, fixation was performed with 3% PFA. The subsequent immunostaining was carried out in blocking solution without saponin. To control
the procedure, immunostaining of Salmonella within the SCV was performed after permeabilization with digitonin or saponin.
Antibodies
The following primary antibodies were used at the specified dilutions: rabbit
anti-Salmonella-O4 Bacto testsera (Difco by BD, Heidelberg, Germany),
1:1000; rat anti-HA (Roche, Mannheim, Germany), 1:500; 1:300; mouse antihuman LAMP-1, 1:100 (clone A4H3, DSHB, Iowa City, IA, USA); mouse antihuman LAMP-2 (clone H4B4, DSHB), 1:500; mouse anti-human LAMP-3 (clone
H5C6, DSHB), 1:500; mouse anti-dynein (clone 1618, Chemicon, Chandlers
Ford, UK) 1:100; mouse anti-b-tubulin Cy3 (Sigma), 1:200; mouse anti-human
Golgin97 (Molecular Probes by Invitrogen, Karlsruhe, Germany), 1:300.
Fluorochrome-conjugated secondary antibody were obtained from Dianova
(Hamburg, Germany) and used at the following dilutions: donkey anti-rat Cy2,
1:500; goat anti-rabbit Cy2 at 1:1000; goat anti-mouse Cy3 1:500; goat anti-rat Cy5
at 1:200; goat anti-mouse Cy2 at 1:300; rabbit and goat anti-mouse Cy5, 1:200.
Statistical analyses
Statistical analyses were performed by one-way ANOVA using SIGMASTAT 3.1.
Statistical significance was defined as p < 0.001.
Acknowledgments
This work was supported by grants HE1964/9-1 and 9-2 as part of the
priority program ‘Signal pathways to the cytoskeleton and bacterial pathogenicity’ of the Deutsche Forschungsgemeinschaft. GLA was a recipient of
963
Abrahams et al.
Table 2: Primers used in this study
Designation
Sequence (5´3´)
SseF12-Rev
SseF39-Rev
SseF49-For
SseF63-Rev
SseF87-Rev
SseF110-For
SseF127-Rev
SseF148-Rev
SseF179-Rev
SseF212-For
SseF227-Rev
SseF253-For
SseF60-HA-XbaI-Rev
ATCCCTCTGCTGCCTTATTTGTTCTATATTACTTGCCGCTGACGGAAT
ATCCCTCTGCTGCCTTATTTGTTCGGTGCCAGGCGCTGGAATTTCAGG
GAACAAATAAGGCAGCAGAGGGAT
TATCGATTGATAATTATGATACGCTTGCATAAAATGTATCGCATAATC
TATCGATTGATAATTATGATACGCCCCGCCAGAAATTACCGCTGCAGC
GCGTATCATAATTATCAATCGATA
ATTTTCCTGATCGTCGCCAGAGGGGGCGGTTTGTAATGGCTCCTTTTG
ATTTTCCTGATCGTCGCCAGAGGGGCAGTTAAGACTTGCCCCACATTT
ATTTTCCTGATCGTCGCCAGAGGGCGCGGGCAGTGGAAACTGTAGGGG
CCCTCTGGCGACGATCAGGAAAAT
TCCCCGAGATGTATGATCAGAACTATCGGCATGAAGTTCATCAACAGA
AGTTCTGATCATACATCTCGGGGA
GAGTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTACCTCTGC
TGCCTTATTTG
GAGTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTAACTGG
CGGTTTGTAATG
GAGTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTACAAAG
AGGCCGCAATATTT
GAGTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTAGGCATGAA
GTTCATCAAC
TATGCTAGTTATTGCTCAG
GGAACCCGGGTTGGCGAGAG
ATAGAATTCATGGCGGACCCTAAATACGCC
ATAGGATCCCTTTCCCAGCTTCTTCATCCG
SseF120-HA-XbaI-Rev
SseF180-HA-XbaI-Rev
SseF210-HA-XbaI-Rev
T7 terminator primer
SscB109-SmaI-For
p50-Dynamitin-EcoRI-For
p50-Dynamitin-BamHI-Rev
a post-doctoral fellowship from the National Research Foundation of South
Africa. MH likes to thank the ‘Fonds der Chemischen Industrie’ for support.
The initial observations on dynein recruitment were made by Volker Kuhle
and his contribution is kindly acknowledged. We like to thank Cecillia Bucci
and Trina Schroer for providing plasmids for transfection.
Supplementary Material
Figure S1. Overexpression of human p50 Dynamitin-EGFP affects
Golgi organization and subcellular localization of endosomes. HeLa
cells were transfected with a plasmid for the expression of a p50/
Dynamitin-EGFP fusion (green). Cells were fixed 16 h after transfection
and processed or immunostaining for LAMP1 (red, upper panel) or
Golgin97 (red, lower panel). Note the displacement of LAMP-1-positive
compartments to the cell periphery and the disruption of peri-nuclear
trans-Golgi stack in transfected cells.
Figure S2. Translocation of SseF and mutant derivatives of SseF by
intracellular Salmonella. HeLa cells were infected with the sseF-deficient
strain harboring plasmids for the expression of wild-type sseF (WT) or
various mutant alleles of sseF. Cells were fixed 16 h after infection and
processed for immunostaining for Salmonella LPS (blue), HA-tagged SseF
(red) and LAMP-1 (green). Scale bars represent 10 mm.
Figure S3. Localization of SseF and mutant derivatives of SseF after
transfection. HeLa cells were transfected with plasmids for the expression of WT sseF::HA or various mutant alleles. The expression was
induced by addition of doxycyclin directly after transfection. Cells were
fixed 24 h after transfection and immunostained for the HA epitope tag
(red) and the TGN marker Golgin97 (green). Representative transfected
cells are shown. Note the preferential accumulation of SseF and derivatives in the Golgi. Similar observations were made with other SseF derivatives (SseFD2, SseFD4, SseFD6, SseFD7, data not shown).
964
Figure S4. Analysis of the subcellular localization of SseF and mutant
derivatives of SseF after translocation. (A) To control the selectivity of
the permeabilization procedure, HeLa cells were infected with Salmonella
typhimurium wild-type (WT) and fixed 16 h after infection. Cells were
permeabilized with 1 mg/mL saponin or 10 mg/mL digitonin as indicated.
Subsequently, immunostaining of Salmonella LPS (blue) and host cell btubulin (red) was performed. For the detection of Salmonella-infected cells,
DAPI staining was performed (purple) and intracellular bacteria are indicated by arrows. (B) S. typhimurium sseF strains harboring plasmids for the
expression of WT sseF or various mutant alleles of sseF were used to
infect HeLa cells. Infected cells were fixed 16 h after infection and subjected to permeabilization by saponin or digitonin as indicated.
Immunostaining was performed for Salmonella LPS (blue), the HA tag to
detect translocated SseF (green) and host cell b-tubulin (red).
Representative infected cells are shown. Scale bars correspond to 5 mm.
These materials are available as part of the online article from http://
www.blackwell-synergy.com
References
1. Knodler LA, Steele-Mortimer O. Taking possession: biogenesis of the
Salmonella-containing vacuole. Traffic 2003;4:587–599.
2. Holden DW. Trafficking of the Salmonella vacuole in macrophages.
Traffic 2002;3:161–169.
3. Kuhle V, Hensel M. Cellular microbiology of intracellular Salmonella
enterica: functions of the type III secretion system encoded by
Salmonella pathogenicity island 2. Cell Mol Life Sci 2004;61:2812–2826.
4. Ghosh P. Process of protein transport by the type III secretion system.
Microbiol Mol Biol Rev 2004;68:771–795.
5. Harrison RE, Brumell JH, Khandani A, Bucci C, Scott CC, Jiang X, Finlay
BB, Grinstein S. Salmonella impairs RILP recruitment to Rab7 during
maturation of invasion vacuoles. Mol Biol Cell 2004;15:3146–3154.
Traffic 2006; 7: 950–965
SseF and SCV positioning
6. Kuhle VJ, Jäckel D, Hensel M. Effector proteins encoded by
Salmonella pathogenicity island 2 interfere with the microtubule cytoskeleton after translocation into host cells. Traffic 2004;5:356–370.
7. Salcedo SP, Holden DW. SseG, a virulence protein that targets
Salmonella to the Golgi network. EMBO J 2003;22:5003–5014.
8. Guignot J, Caron E, Beuzon C, Bucci C, Kagan J, Roy C, Holden DW.
Microtubule motors control membrane dynamics of Salmonella-containing vacuoles. J Cell Sci 2004;117:1033–1045.
9. Marsman M, Jordens I, Kuijl C, Janssen L, Neefjes J. Dynein-mediated
vesicle transport controls intracellular Salmonella replication. Mol Biol
Cell 2004;15:2954–2964.
10. Boucrot E, Henry T, Borg JP, Gorvel JP, Meresse S. The intracellular
fate of Salmonella depends on the recruitment of kinesin. Science
2005;308:1174–1178.
11. Hirokawa N. Kinesin and dynein superfamily proteins and the mechanism of organelle transport. Science 1998;279:519–526.
12. Garcia-del Portillo F, Zwick MB, Leung KY, Finlay BB. Salmonella
induces the formation of filamentous structures containing lysosomal
membrane glycoproteins in epithelial cells. Proc Natl Acad Sci USA
1993;90:10544–10548.
13. Brumell JH, Goosney DL, Finlay BB. SifA, a type III secreted effector
of Salmonella typhimurium, directs Salmonella-induced filament (Sif)
formation along microtubules. Traffic 2002;3:407–415.
14. Beuzon CR, Meresse S, Unsworth KE, Ruiz-Albert J, Garvis S,
Waterman SR, Ryder TA, Boucrot E, Holden DW. Salmonella maintains the integrity of its intracellular vacuole through the action of sifA.
EMBO J 2000;19:3235–3249.
15. Henry T, Gorvel J-P, Meresse S. Molecular motors hijacking by intracellular pathogens. Cell Microbiol 2006;8:23–32.
16. Abrahams GL, Hensel M. Manipulating cellular transport and immune
responses: dynamic interactions between intracellular Salmonella
enterica and its host cells. Cell Microbiol 2006;8:728–737.
17. Knodler LA, Steele-Mortimer O. The Salmonella effector PipB2 affects
late endosome/lysosome distribution to mediate Sif extension. Mol
Biol Cell 2005;16:4108–4123.
18. Jiang X, Rossanese OW, Brown NF, Kujat-Choy S, Galan JE, Finlay BB,
Brumell JH. The related effector proteins SopD and SopD2 from
Salmonella enterica serovar typhimurium contribute to virulence during
systemic infection of mice. Mol Microbiol 2004;54:1186–1198.
19. Kuhle V, Hensel M. SseF and SseG are translocated effectors of the type
III secretion system of Salmonella pathogenicity island 2 that modulate
aggregation of endosomal compartments. Cell Microbiol 2002;4:813–824.
20. Guy RL, Gonias LA, Stein MA. Aggregation of host endosomes by
Salmonella requires SPI2 translocation of SseFG and involves SpvR
and the fms-aroE intragenic region. Mol Microbiol 2000;37: 1417–1435.
21. Yu XJ, Ruiz-Albert J, Unsworth KE, Garvis S, Liu M, Holden DW. SpiC
is required for secretion of Salmonella Pathogenicity Island 2 type III
secretion system proteins. Cell Microbiol 2002;4:531–540.
22. Kobayashi T, Martensen T, Nath J, Flavin M. Inhibition of dynein
ATPase by vanadate, and its possible use as a probe for the role of
dynein in cytoplasmic motility. Biochem Biophys Res Commun
1978;81:1313–1318.
23. Gibbons IR, Cosson MP, Evans JA, Gibbons BH, Houck B, Martinson
KH, Sale WS, Tang WJ. Potent inhibition of dynein adenosinetriphosphatase and of the motility of cilia and sperm flagella by vanadate.
Proc Natl Acad Sci USA 1978;75:2220–2224.
Traffic 2006; 7: 950–965
24. Hu L, Kopecko DJ. Campylobacter jejuni 81-176 associates with microtubules and dynein during invasion of human intestinal cells. Infect
Immun 1999;67:4171–4182.
25. Naranatt PP, Krishnan HH, Smith MS, Chandran B. Kaposi’s sarcomaassociated herpesvirus modulates microtubule dynamics via RhoAGTP-diaphanous 2 signaling and utilizes the dynein motors to deliver
its DNA to the nucleus. J Virol 2005;79:1191–1206.
26. Echeverri CJ, Paschal BM, Vaughan KT, Vallee RB. Molecular characterization of the 50-kD subunit of dynactin reveals function for the
complex in chromosome alignment and spindle organization during
mitosis. J Cell Biol 1996;132:617–633.
27. Cantalupo G, Alifano P, Roberti V, Bruni CB, Bucci C. Rab-interacting
lysosomal protein (RILP): the Rab7 effector required for transport to
lysosomes. EMBO J 2001;20:683–693.
28. Burkhardt JK, Echeverri CJ, Nilsson T, Vallee RB. Overexpression of
the dynamitin (p50) subunit of the dynactin complex disrupts dyneindependent maintenance of membrane organelle distribution. J Cell
Biol 1997;139:469–484.
29. Kim SW, Ihn KS, Han SH, Seong SY, Kim IS, Choi MS. Microtubuleand dynein-mediated movement of Orientia tsutsugamushi to
the microtubule organizing center. Infect Immun 2001;69:494–500.
30. Clausen JD, Christiansen G, Holst HU, Birkelund S. Chlamydia trachomatis utilizes the host cell microtubule network during early events of
infection. Mol Microbiol 1997;25:441–449.
31. Grieshaber SS, Grieshaber NA, Hackstadt T. Chlamydia trachomatis
uses host cell dynein to traffic to the microtubule-organizing center in a
p50 dynamitin-independent process. J Cell Sci 2003;116:3793–3802.
32. Dai S, Zhou D. Secretion and function of Salmonella SPI-2 effector
SseF require its chaperone, SscB. J Bacteriol 2004;186:5078–5086.
33. Welte MA. Bidirectional transport along microtubules. Curr Biol
2004;14:R525–R537.
34. Kuhle V, Abrahams GL, Hensel M. Intracellular Salmonella enterica
redirect exocytic transport processes in a Salmonella Pathogenicity
Island 2-dependent manner. Traffic 2006;7:716–730.
35. Hansen-Wester I, Stecher B, Hensel M. Type III secretion of
Salmonella enterica serovar typhimurium translocated effectors and
SseFG. Infect Immun 2002;70:1403–1409.
36. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: a Laboratory
Manual. Cold Spring Harbor, New York: Cold Spring Harbor
Laboratory; 1989.
37. Plutner H, Davidson HW, Saraste J, Balch WE. Morphological analysis
of protein transport from the ER to Golgi membranes in digitoninpermeabilized cells: role of the P58 containing compartment. J Cell
Biol 1992;119:1097–1116.
38. Shea JE, Hensel M, Gleeson C, Holden DW. Identification of a virulence locus encoding a second type III secretion system in Salmonella
typhimurium. Proc Natl Acad Sci USA 1996;93:2593–2597.
39. Hensel M, Shea JE, Waterman SR, Mundy R, Nikolaus T, Banks G,
Vazquez-Torres A, Gleeson C, Fang F, Holden DW. Genes encoding
putative effector proteins of the type III secretion system
of Salmonella Pathogenicity Island 2 are required for bacterial virulence and proliferation in macrophages. Mol Microbiol 1998;30:
163–174.
40. Chakravortty D, Hansen-Wester I, Hensel M. Salmonella pathogenicity
island 2 mediates protection of intracellular Salmonella from reactive
nitrogen intermediates. J Exp Med 2002;195:1155–1166.
965

Similar documents

×

Report this document