Profiling of 95 MicroRNAs in Pancreatic Cancer Cell Lines and

Document technical information

Format pdf
Size 405.0 kB
First found May 22, 2018

Document content analysis

Category Also themed
Language
Type
not defined
Concepts
no text concepts found

Persons

Organizations

Places

Transcript

World J Surg
DOI 10.1007/s00268-008-9833-0
Profiling of 95 MicroRNAs in Pancreatic Cancer Cell Lines
and Surgical Specimens by Real-Time PCR Analysis
Yuqing Zhang Æ Min Li Æ Hao Wang Æ
William E. Fisher Æ Peter H. Lin Æ
Qizhi Yao Æ Changyi Chen
Ó Société Internationale de Chirurgie 2008
Abstract
Background MicroRNAs (miRNAs) are involved in
cancer pathogenesis, apoptosis, and cell growth, thereby
functioning as tumor suppressors or oncogenes. However,
expression alterations and roles of these miRNAs in pancreatic cancer are largely unknown. We hypothesized that
pancreatic cancer may have a unique miRNA profile,
which may play a critical role in pancreatic cancer development, progression, diagnosis, and prognosis.
Methods Differential expression of 95 miRNAs was
analyzed by real time RT-PCR using the QuantiMir System. All 95 miRNAs chosen for the array are based on their
potential functions related to cancer biology, cell development, and apoptosis. The expression of miRNAs for
pancreatic cancer tissue samples or cancer cell lines was
normalized to U6 RNA and compared with those in relatively normal pancreatic tissues or normal human
pancreatic ductal epithelial (HPDE) cells. Human pancreatic tissue with chronic pancreatitis also was included for
analysis.
Results In the initial analysis, the expression of most 95
miRNAs was substantially changed in pancreatic cancer
Presented at the Molecular Surgeon Symposium on Personalized
Genomic Medicine and Surgery, Baylor College of Medicine,
Houston, Texas, USA on April 12, 2008. The symposium was
supported by a grant from the National Institutes of Health (R13
CA132572 to Changyi Chen).
Y. Zhang M. Li H. Wang W. E. Fisher P. H. Lin Q. Yao C. Chen (&)
Michael E. DeBakey Department of Surgery, Division of
Vascular Surgery and Endovascular Therapy, Molecular Surgeon
Research Center, Baylor College of Medicine and Michael E.
DeBakey VA Medical Center, One Baylor Plaza,
Mail stop: BCM-390, Houston, TX 77030, USA
e-mail: [email protected]
tissues (n = 5) and cell lines (n = 3) compared with relatively normal pancreatic tissues and HPDE cells.
However, each pancreatic cancer tissue or cell type had a
substantially different profiling pattern with other cases or
cell types as well as chronic pancreatitis tissue, indicating
the individual diversity of pancreatic cancer. Further
analysis was performed on 10 pancreatic cancer cell lines
and 17 pairs of pancreatic cancer/normal tissues. Eight
miRNAs were significantly upregulated in most pancreatic
cancer tissues and cell lines, including miR-196a, miR-190,
miR-186, miR-221, miR-222, miR-200b, miR-15b, and
miR-95. The incidence of upregulation of these eight genes
between normal control subjects and tumor cells or tissues
ranged from 70–100%. The magnitude of increase of these
miRNAs in pancreatic cancer samples ranged from 3- to
2018-fold of normal control subjects.
Conclusions Pancreatic cancer tissues or cell lines have a
unique miRNA profiling pattern at the individual basis
compared with relatively normal pancreatic tissues or
cells as well as pancreatitis tissue. Upregulation of eight
miRNAs occurs in most pancreatic cancer tissues and cell
types. These miRNAs may share common pathways in
pancreatic cancer pathogenesis. This study may provide
useful information for further investigations of functional
roles of miRNAs in pancreatic cancer development, progression, diagnosis, and prognosis.
Introduction
Noncoding RNAs are a class of RNAs that do not encode
proteins while possessing regulatory functions in gene
expression. Noncoding RNAs have drawn a great attention
in recent years. The discovery of small interfering RNAs
123
World J Surg
Table 1 Mature RNA sequences and real-time PCR primers for 95 miRNAs
miRNA
let-7-family
MirBase #
miRNA sequence(s)
RT-PCR primer sequence(s)
MIMAT0000062,
ugagguaguagguuguauaguu,
tgaggtagtaggttgtatagtt,
MIMAT0000064,
ugagguaguagguuguaugguu,
tgaggtagtaggttgtatggtt,
MIMAT0000065,
agagguaguagguugcauagu,
agaggtagtaggttgcatagt,
MIMAT0000067
ugagguaguagauuguauaguu
tgaggtagtagattgtatagtt
miR-7
MIMAT0000252
uggaagacuagugauuuuguug
tggaagactagtgattttgttg
miR-92
MIMAT0000092
uauugcacuugucccggccug
tattgcacttgtcccggcctg
miR-93
MIMAT0000093
aaagugcuguucgugcagguag
aaagtgctgttcgtgcaggtag
miR-9-1
MIMAT0000441
ucuuugguuaucuagcuguauga
tctttggttatctagctgtatga
miR-101-1
MIMAT0000099
uacaguacugugauaacugaag
tacagtactgtgataactgaag
miR-103
MIMAT0000101
agcagcauuguacagggcuauga
agcagcattgtacagggctatga
miR-106a
miR-106b
MIMAT0000103
MIMAT0000680
aaaagugcuuacagugcagguagc
uaaagugcugacagugcagau
aaaagtgcttacagtgcaggtagc
taaagtgctgacagtgcagat
miR-107
MIMAT0000104
agcagcauuguacagggcuauca
agcagcattgtacagggctatca
miR-10b
MIMAT0000254
uacccuguagaaccgaauuugu
taccctgtagaaccgaatttgt
miR-1-1
MIMAT0000416
uggaauguaaagaaguaugua
tggaatgtaaagaagtatgta
miR-122a
MIMAT0000421
uggagugugacaaugguguuugu
tggagtgtgacaatggtgtttgt
miR-125a
MIMAT0000443
ucccugagacccuuuaaccugug
tccctgagaccctttaacctgtg
miR-125b
MIMAT0000423
ucccugagacccuaacuuguga
tccctgagaccctaacttgtga
miR-126
MIMAT0000444
cauuauuacuuuugguacgcg
cattattacttttggtacgcg
miR-128b
MIMAT0000676
ucacagugaaccggucucuuuc
tcacagtgaaccggtctctttc
miR-132
MIMAT0000426
uaacagucuacagccauggucg
taacagtctacagccatggtcg
miR-133a
MIMAT0000427
uugguccccuucaaccagcugu
ttggtccccttcaaccagctgt
miR-134
MIMAT0000447
ugugacugguugaccagaggg
tgtgactggttgaccagaggg
miR-135b
MIMAT0000758
uauggcuuuucauuccuaugug
tatggcttttcattcctatgtg
miR-136
MIMAT0000448
acuccauuuguuuugaugaugga
actccatttgttttgatgatgga
miR-137
MIMAT0000429
uauugcuuaagaauacgcguag
tattgcttaagaatacgcgtag
miR-140
miR-141
MIMAT0000431
MIMAT0000432
agugguuuuacccuaugguag
uaacacugucugguaaagaugg
agtggttttaccctatggtag
taacactgtctggtaaagatgg
miR-142-3p
MIMAT0000434
uguaguguuuccuacuuuaugga
tgtagtgtttcctactttatgga
miR-143
MIMAT0000435
ugagaugaagcacuguagcuca
tgagatgaagcactgtagctca
miR-145
MIMAT0000437
guccaguuuucccaggaaucccuu
gtccagttttcccaggaatccctt
miR-146a
MIMAT0000449
ugagaacugaauuccauggguu
tgagaactgaattccatgggtt
miR-149
MIMAT0000450
ucuggcuccgugucuucacucc
tctggctccgtgtcttcactcc
miR-150
MIMAT0000451
ucucccaacccuuguaccagug
tctcccaacccttgtaccagtg
miR-151
MIMAT0000757
acuagacugaagcuccuugagg
actagactgaagctccttgagg
miR-153
MIMAT0000439
uugcauagucacaaaaguga
ttgcatagtcacaaaagtga
miR-154
MIMAT0000452
uagguuauccguguugccuucg
taggttatccgtgttgccttcg
miR-155
MIMAT0000646
uuaaugcuaaucgugauagggg
ttaatgctaatcgtgatagggg
miR-15a
MIMAT0000068
uagcagcacauaaugguuugug
tagcagcacataatggtttgtg
miR-15b
MIMAT0000417
uagcagcacaucaugguuuaca
tagcagcacatcatggtttaca
miR-16
MIMAT0000069
uagcagcacguaaauauuggcg
tagcagcacgtaaatattggcg
miR-17-3p
miR-17-5p
MIMAT0000071
MIMAT0000070
acugcagugaaggcacuugu
caaagugcuuacagugcagguagu
actgcagtgaaggcacttgt
caaagtgcttacagtgcaggtagt
miR-181a
MIMAT0000256
aacauucaacgcugucggugagu
aacattcaacgctgtcggtgagt
miR-181b
MIMAT0000257
aacauucauugcugucgguggg
aacattcattgctgtcggtggg
miR-181c
MIMAT0000258
aacauucaaccugucggugagu
aacattcaacctgtcggtgagt
miR-181d
MIMAT0002821
aacauucauuguugucgguggguu
aacattcattgttgtcggtgggtt
miR-183
MIMAT0000261
uauggcacugguagaauucacug
tatggcactggtagaattcactg
123
World J Surg
Table 1 continued
miRNA
MirBase #
miRNA sequence(s)
RT-PCR primer sequence(s)
miR-185
MIMAT0000455
uggagagaaaggcaguuc
tggagagaaaggcagttc
miR-186
MIMAT0000456
caaagaauucuccuuuugggcuu
caaagaattctccttttgggctt
miR-188
MIMAT0000457
caucccuugcaugguggagggu
catcccttgcatggtggagggt
miR-18a
MIMAT0000072
uaaggugcaucuagugcagaua
taaggtgcatctagtgcagata
miR-190
MIMAT0000458
ugauauguuugauauauuaggu
tgatatgtttgatatattaggt
miR-191
MIMAT0000440
caacggaaucccaaaagcagcu
caacggaatcccaaaagcagct
miR-192
MIMAT0000222
cugaccuaugaauugacagcc
ctgacctatgaattgacagcc
miR-194
MIMAT0000460
uguaacagcaacuccaugugga
tgtaacagcaactccatgtgga
miR-195
MIMAT0000461
uagcagcacagaaauauuggc
tagcagcacagaaatattggc
miR-196a
MIMAT0000226
uagguaguuucauguuguugg
taggtagtttcatgttgttgg
miR-197
MIMAT0000227
uucaccaccuucuccacccagc
ttcaccaccttctccacccagc
miR-198
MIMAT0000228
gguccagaggggagauagg
ggtccagaggggagatagg
miR-199a?b
MIMAT0000231,
MIMAT0000263
cccaguguucagacuaccuguuc,
cccaguguuuagacuaucuguuc
cccagtgttcagactacctgttc,
cccagtgtttagactatctgttc
miR-30b
MIMAT0000420
uguaaacauccuacacucagcu
tgtaaacatcctacactcagct
miR-19a?b
MIMAT0000073,
ugugcaaaucuaugcaaaacuga,
tgtgcaaatctatgcaaaactga,
MIMAT0000074
ugugcaaauccaugcaaaacuga
tgtgcaaatccatgcaaaactga
miR-95
MIMAT0000094
uucaacggguauuuauugagca
ttcaacgggtatttattgagca
miR-20a
MIMAT0000075
uaaagugcuuauagugcagguag
taaagtgcttatagtgcaggtag
miR-200a
MIMAT0000682
uaacacugucugguaacgaugu
taacactgtctggtaacgatgt
miR-200b
MIMAT0000318
uaauacugccugguaaugaugac
taatactgcctggtaatgatgac
miR-200c
MIMAT0000617
uaauacugccggguaaugaugg
taatactgccgggtaatgatgg
miR-202
MIMAT0002811
agagguauagggcaugggaaaa
agaggtatagggcatgggaaaa
miR-203
MIMAT0000264
gugaaauguuuaggaccacuag
gtgaaatgtttaggaccactag
miR-204
MIMAT0000265
uucccuuugucauccuaugccu
ttccctttgtcatcctatgcct
miR-205
MIMAT0000266
uccuucauuccaccggagucug
tccttcattccaccggagtctg
miR-206
MIMAT0000462
uggaauguaaggaagugugugg
tggaatgtaaggaagtgtgtgg
miR-21
miR-210
MIMAT0000076
MIMAT0000267
uagcuuaucagacugauguuga
cugugcgugugacagcggcuga
tagcttatcagactgatgttga
ctgtgcgtgtgacagcggctga
miR-214
MIMAT0000271
acagcaggcacagacaggcag
acagcaggcacagacaggcag
miR-215
MIMAT0000272
augaccuaugaauugacagac
atgacctatgaattgacagac
miR-372
MIMAT0000724
aaagugcugcgacauuugagcgu
aaagtgctgcgacatttgagcgt
miR-373
MIMAT0000726
gaagugcuucgauuuuggggugu
gaagtgcttcgattttggggtgt
miR-218
MIMAT0000275
uugugcuugaucuaaccaugu
ttgtgcttgatctaaccatgt
miR-219
MIMAT0000276
ugauuguccaaacgcaauucu
tgattgtccaaacgcaattct
miR-22
MIMAT0000077
aagcugccaguugaagaacugu
aagctgccagttgaagaactgt
miR-488
MIMAT0002804
cccagauaauggcacucucaa
cccagataatggcactctcaa
miR-221
MIMAT0000278
agcuacauugucugcuggguuuc
agctacattgtctgctgggtttc
miR-222
MIMAT0000279
agcuacaucuggcuacugggucuc
agctacatctggctactgggtctc
miR-223
MIMAT0000280
ugucaguuugucaaauacccc
tgtcagtttgtcaaatacccc
miR-224
MIMAT0000281
caagucacuagugguuccguuua
caagtcactagtggttccgttta
miR-23a
MIMAT0000078
aucacauugccagggauuucc
atcacattgccagggatttcc
miR-24
MIMAT0000080
uggcucaguucagcaggaacag
tggctcagttcagcaggaacag
miR-25
miR-26a
MIMAT0000081
MIMAT0000082
cauugcacuugucucggucuga
uucaaguaauccaggauaggc
cattgcacttgtctcggtctga
ttcaagtaatccaggataggc
miR-26b
MIMAT0000083
uucaaguaauucaggauagguu
ttcaagtaattcaggataggtt
miR-27a?b
MIMAT0000084,
uucacaguggcuaaguuccgc,
ttcacagtggctaagttccgc,
MIMAT0000419
uucacaguggcuaaguucugc
ttcacagtggctaagttctgc
123
World J Surg
Table 1 continued
miRNA
MirBase #
miRNA sequence(s)
RT-PCR primer sequence(s)
miR-30c
MIMAT0000244
uguaaacauccuacacucucagc
tgtaaacatcctacactctcagc
miR-29a?b?c
MIMAT0000086,
uagcaccaucugaaaucgguu,
tagcaccatctgaaatcggtt,
MIMAT0000100,
uagcaccauuugaaaucaguguu,
tagcaccatttgaaatcagtgtt,
MIMAT0000681
uagcaccauuugaaaucggu
tagcaccatttgaaatcggt
miR-30a-3p
MIMAT0000088
cuuucagucggauguuugcagc
ctttcagtcggatgtttgcagc
miR-30a-5p
MIMAT0000087
uguaaacauccucgacuggaag
tgtaaacatcctcgactggaag
miR-296
MIMAT0000690
agggcccccccucaauccugu
agggccccccctcaatcctgt
U6 snRNA
NCBI: X07425.1
caccacguuuauacgccggug
caccacgtttatacgccggtg
(siRNAs) and microRNAs (miRNAs) has substantially
impacted gene regulation. miRNAs are a novel class of
short (typically 18–23 nucleotides), single-stranded RNAs,
which are identified as a new family of regulatory molecules involved in cancer development [1–4]. miRNAs
cause posttranscriptional gene silencing by inducing target
mRNA degradation or by repressing the translation process
upon binding to the 30 -untranslational region (UTR) of
their target mRNAs [5]. Mature miRNAs are excised from
stem-loop precursors, which are transcribed as part of
longer primary transcripts. These primary miRNAs appear
to be first processed by the RNase Drosha in the nucleus,
after which the precursor miRNAs are exported to the
cytoplasm where the RNase Dicer further processes them.
Regulation of miRNA expression has been demonstrated to play a key role in development, cell growth, and
differentiation processes in a variety of eukaryotic organisms [6, 7]. Usually, miRNAs are dysregulated in cancers.
Some miRNAs are temporally overexpressed in the early
stage of cancer progression and they act like oncogenes by
promoting proliferation and/or repressing apoptosis. Conversely, some miRNAs with tumor-repressor functions are
downregulated in cancers. miRNA expression profiles may
be unique in different tumors and from different origins.
Both normal and malignant cancer tissues may have specific miRNA expression signatures and show differential
expression across tumor types. Several studies have demonstrated altered miRNA expression profile in various
hematological and solid tumor entities [1, 2]. For example,
a unique expression signature of only 13 miRNAs differentiated more aggressive form of chronic lymphocytic
leukemia from the benign one and was found to be associated with the cancer progression [8]. Expression
alterations of specific miRNAs appear to be correlated with
clinically malignancy or metastatic phenotypes and predict
the clinical outcome even better than the mRNA expression
data [9–11].
Pancreatic cancer is the fourth leading cause of cancer
death in the United States [12]. In the United States in
2007, 37,170 new cases were diagnosed, and
123
Fig. 1 Expression pattern of 95 miRNAs in chronic pancreatitis, c
pancreatic cancer cell lines, and surgical specimens. MiRNAs of
tissues and cultured cells were extracted and purified using mirVana
miRNA Isolation kit and converted to cDNAs with the QuantiMirTM
RT System. Differential expression was analyzed by RT-PCR using
QuantiMir 95 microRNAs array System. U6 primer also was included
in the array as a normalization control. After normalizing to the
control U6 in all samples, the fold change in 95 miRNAs was
calculated by comparing the pancreatic cancer tissue or cell lines with
normal pancreatic tissues or HPDE cells. a Chronic pancreatitis
versus normal pancreatic tissue (n = 1). b Pancreatic cancer cell lines
versus HPDE cells (n = 3). c Surgical specimens of pancreatic cancer
tissues versus their adjacent normal pancreatic tissues (n = 5)
approximately 33,370 deaths caused by pancreatic adenocarcinoma [13]. Although surgical resection provides a
potential cure, approximately 70% patients still develop
early recurrence within 6–12 months after surgery. Due to
lack of reliable early detection markers, pancreatic tumors
are usually in the advanced stage when diagnosed. Moreover, pancreatic tumors have a predilection for early
vascular dissemination and metastasis to distant organs.
Clearly, the discovery of miRNA alterations in pancreatic
cancer not only helps us to better understand the biology of
this disease, but more importantly provides new prognostic
and diagnostic strategies. Because of the high stability of
miRNAs even in poorly preserved specimens, they are
expected to be a valuable tool in clinical research and
biomarkers discovery.
By Northern blotting analysis, several studies have
shown that particular miRNAs were altered in pancreatic
cancer tumor tissues [14–20]. However, these data are
incomplete for many miRNAs or not consistent among
studies because of limitations of methodologies and/or
different conditions and sample sizes of cancer tissues and
cell lines. In the current study, we used real-time quantitative PCR—a more reliable detection method—to detect
the expression levels of 95 cancer-related miRNAs in wellcontrolled pancreatic cancer specimens and cell lines as
well as pancreatitis tissues. This study may discover a
unique miRNA profiling pattern for pancreatic cancer and
0.1000
0.0100
1.0000
T7
0.0010
100000.0000
1000.0000
T22
10.0000
1.0000
0.1000
10.0000
T33
0.1000
0.0010
T35
1.0000
0.0100
0.0010
0.0010
100000.0000
1.0000
1.0000
let-7-family
miR-7
miR-92
miR-93
mi R-9-1
miR-101-1
miR-103
miR-106a
miR-106b
miR-107
miR-10b
miR-1-1
miR-122a
miR-125a
miR-125b
miR-126
mi R-128b
miR-132
miR-133a
miR-134
miR-135b
miR-136
miR-137
miR-140
miR-141
miR-142-3p
miR-143
miR-145
miR-146a
miR-149
miR-150
miR-151
miR-153
miR-154
miR-155
miR-15a
miR-15b
miR-16
miR- 17-3p
miR-17-5p
miR-181a
miR-181b
miR-181c
miR-181d
miR-183
miR-185
miR-186
miR-188
miR-18a
miR-190
miR-191
miR-192
miR-194
miR-195
miR-196a
miR-197
miR- 198
miR-199a+b
miR-30b
miR-19a+b
miR-95
miR-20a
miR-200a
miR-200b
miR-200c
miR-202
miR-203
miR-204
miR-205
miR-206
miR-21
miR-210
miR-214
miR-215
miR-372
mi R-373
miR-218
miR-219
miR-22
miR-488
miR-221
miR-222
miR-223
miR-224
miR-23a
miR-24
miR-25
mi R-26a
miR-26b
miR-27a+b
miR-30c
miRmiR-30a-3p
miR-30a-5p
miR-296
10.0000
Fold Change
10.0000
miR-16
miR-17-3p
miR-17-5p
miR-181a
miR-181b
miR-181c
miR-181d
miR-183
miR-185
miR-186
miR-188
miR-18a
miR-190
miR-191
miR-192
miR-194
miR-195
miR-196a
miR-197
miR-198
miR-199a+b
miR-30b
miR-19a+b
miR-95
miR-20a
miR-200a
miR-200b
miR-200c
miR-202
miR-203
miR-204
miR-205
miR-206
miR-21
miR-210
miR-214
miR-215
miR-372
miR-373
miR-218
miR-219
miR-22
miR-488
miR-221
miR-222
miR-223
miR-224
miR-23a
miR-24
miR-25
mi R-26a
miR-26b
miR-27a+b
miR-30c
miRmiR-30a-3p
mi R-30a-5p
miR-296
100.0000
C
let-7-family
miR-7
miR-92
miR-93
miR-9-1
miR-101-1
miR-103
miR-106a
miR-106b
miR-107
miR-10b
miR-1-1
miR-122a
miR-125a
miR-125b
miR-126
miR-128b
miR-132
miR-133a
miR-134
miR-135b
miR-136
miR-137
miR-140
miR-141
miR- 142-3p
miR-143
miR-145
miR-146a
miR-149
miR-150
miR-151
miR-153
miR-154
miR-155
miR-15a
miR-15b
miR-16
miR-17-3p
miR-17-5p
miR-181a
miR-181b
miR-181c
miR-181d
miR-183
miR-185
miR-186
miR-188
miR-18a
miR-190
miR-191
miR-192
miR-194
miR-195
miR-196a
miR-197
miR-198
miR-199a+b
miR-30b
miR-19a+b
miR-95
miR- 20a
miR-200a
miR-200b
miR-200c
miR-202
miR-203
miR-204
miR-205
miR-206
miR-21
miR-210
miR-214
miR-215
miR-372
miR-373
miR-218
miR-219
miR-22
miR-488
miR-221
miR-222
miR-223
miR-224
miR-23a
miR-24
miR-25
miR-26a
miR-26b
miR-27a+b
miR-30c
miRmiR-30a-3p
miR-30a-5p
miR-296
1.0000
T2
Fold Change
1.0000
Fold Change
Pancreatitis tissue P2 vs. N2 MicroRNA expression fold changes
Fold Change
B
100.0000
let-7-family
miR-7
miR-92
miR-93
miR-9-1
miR-101-1
miR-103
miR-106a
miR-106b
miR-107
miR-10b
miR-1-1
miR-122a
miR-125a
miR-125b
miR-126
miR-128b
miR-132
miR-133a
miR-134
miR-135b
miR-136
miR-137
miR-140
miR-141
miR-142-3p
miR-143
miR-145
miR-146a
miR-149
miR-150
miR-151
miR-153
miR-154
miR-155
miR-15a
miR-15b
BxPC3
Fold Change
A
Fold Change
Panc-1
Fold Change
MIA
Fold Change
P2
Fold Change
World J Surg
100.0000
PACA tissue T2 vs. N2 MicroRNA expression fold changes
10.0000
1.0000
0.1000
1000.0000
0.0100
100.0000
MIA vs. HPDE MicroRNA expression fold changes
100.0000
10.0000
0.1000
1.0000
0.1000
0.0100
10000.0000
0.0100
10000.0000
1000.0000
100.0000
10.0000
0.1000
0.0100
100.0000
10000.0000
1000.0000
100.0000
10.0000
0.0100
0.1000
1000.0000
0.0100
100.0000
10.0000
0.1000
123
World J Surg
identify important molecular targets for further functional
investigations and for the developments of new diagnostic
tools and therapeutic strategies.
Materials and methods
Statistical analysis
The expressions of eight miRNAs in cancer tissues or cells
and normal tissues or cells were compared with paired
Student’s t test. Data are presented as means ± standard
deviation (SD). p \ 0.05 was considered statistically
significant.
Cell cultures and tissue collections
Human pancreatic cancer cell lines, Panc-1, MIA PaCa-2,
BxPC-3, Hs766T, ASPC-1, Capan-1, Capan-2, Panc3.27,
HPAF-II, and PL45, were purchased from the American
Type Culture Collection (ATCC, Rockville, MD). The
human pancreatic ductal epithelium (HPDE) cells were
provided as a generous gift from Dr. Ming-Sound Tsao [21,
22]. All cells were cultured as previously described [23–
26]. Human pancreatic adenocarcinoma specimens and
their adjacent normal pancreatic tissues (17 pairs) and one
pancreatic tissue sample with chronic pancreatitis were
collected from patients who underwent surgery according
to an approved human protocol at the Baylor College of
Medicine (Houston, TX).
miRNA extraction and reverse-transcription
Total miRNAs of tissues and cultured cells were
extracted and purified using mirVana miRNA Isolation
kit (Applied Biosystems/Ambion, Austin, TX) following
the manufacturer’s instructions. Five microliters of RNA
was directly converted to cDNA with the QuantiMirTM
RT System (SBI System Biosciences, Mountain View,
CA).
Real-time RT-PCR
Differential expression of 95 miRNAs was analyzed by
RT-PCR using the QuantiMir System (SBI System Biosciences). All 95 miRNAs chosen for the array are based
on their potential roles in cancer, cell development, and
apoptosis. The array plate also included the U6 transcript
as a normalization signal. The miRNA sequences and
primer sequences used in RT-PCR are listed in Table 1.
cDNAs from different cell lines and tissue samples were
mixed with SYBRÒ Green Mastermix (Bio-Rad Laboratories, Hercules, CA) plus the universal reverse primer.
Specific primers (1 ll) were added each well of the
qPCR plate. Expression levels of each mature miRNA
were evaluated using comparative threshold cycle (Ct)
method as normalized to that of U6 (2 - DCt). The fold
change of each miRNA was calculated from the
expression levels between tumor tissues/cells and normal
tissues/cells.
123
Results
Expression of 95 miRNAs in chronic pancreatitis,
pancreatic cancer cell lines, and surgical specimens
Initially, the expression of 95 miRNAs in 1 pancreatitis
tissue, 5 pancreatic cancer tissues and their adjacent benign
tissues, 3 human pancreatic cancer cell lines (MIA PaCa-2,
Panc-1, and BxPC-3), and HPDE cells was determined by
real-time PCR. After normalization to the control U6
expression, differential expression of miRNAs of pancreatitis tissue compared with normal pancreatic tissues,
pancreatic cancer tissues compared with normal pancreatic
tissues, and pancreatic cancer cell lines compared with
HPDE cells was determined (Fig. 1; Table 2). Substantial
differences of the expression profile of 95 mRNAs were
observed between cancer and normal tissues or between
cancer cell lines and normal HPED cells at the individual
basis, indicating potential roles of miRNAs in the cancer
formation. These differences indicate the individual characteristics and variability of each case compared with other
cases. The relative expression values for these mature
miRNAs spanned 6-logs (from 0.01–10,000). A number of
miRNAs were increased in most pancreatic cancer tissues
and cell types but not in normal tissues and cells as well as
the pancreatitis sample.
Validation of eight overexpressed miRNAs in more
pancreatic cancer cell lines and surgical specimens
From 95 miRNAs, 8 miRNAs (miR-196a, miR-190, miR186, miR-221, miR-222, miR-200b, miR-15b, and miR-95)
were identified to have high expression levels more than
3.3-fold both in pancreatic cancer tissue samples and cell
lines compared with that in normal pancreatic tissues and
HPED cells. The expression of these miRNAs was further
analyzed in more samples of pancreatic cancer and normal
pancreatic tissue pairs (n = 17) as well as more pancreatic
cancer cell lines (n = 10) by real-time PCR. The incidence
of expression increase and average-fold increase of eight
miRNAs are shown in Fig. 2 and Table 3. Compared with
normal HPDE cells, the incidence of 10 pancreatic cancer
cell lines exhibited elevated levels of miR-196a (100%),
miR-190 (100%), miR-186 (90%), miR-221 (100%), miR-
World J Surg
Table 2 Expression of 95 miRNAs in chronic pancreatitis, pancreatic cancer cell lines,a and surgical specimensb
miRNA
P2
MIA
Panc-1
BxPC-3
T2
T7
T22
T33
T35
let-7-family
0.476319
0.3737123
1.494849
1.328686
0.186856
0.707107
9.3178687
146.0178
106.89125
miR-7
0.065154
0.6328783
0.432269
5.098243
0.151774
1.156688
39.396621
0.210224
1.1095695
miR-92
0.721965
0.4537596
1.292353
2.789487
0.339151
2.158456
0.5212329
4.287094
6.2333166
miR-93
1.827663
1.3755418
3.24901
4.40762
4.69134
2.948538
6.6345564
58.89201
10.556063
miR-9-1
1.569168
0.0245183
1.717131
0.008201
0.358489
0.82932
0.1780063
6.233317
51.268472
miR-101-1
3.226567
0.9930925
0.823591
0.835088
1.265757
1.337928
0.4863275
1.148698
1.4948492
miR-103
3.5801
1.4742692
3.89062
6.276673
4.316913
1.853176
2.9690471
11.87619
3.810552
miR-106a
2.514027
0.7120251
1.569168
2.828427
2.297397
3.317278
21.406841
27.47409
12.996038
miR-106b
2.42839
1.2483305
3.031433
3.506423
3.630077
1.337928
0.8010699
2.86791
0.463294
miR-107
3.810552
1.6245048
4.823231
7.674113
4.027822
1.79005
2.5315132
14.82541
5.464161
miR-10b
miR-1-1
3.363586
17.87659
6.7739625
?
153.2773
11268.44
10.33882
2.657372
1.777685
10.26741
5.063026
165.4212
3.732132
0.016176
95.00951
286.0255
10.126053
28724.616
miR-122a
0.19751
0.2793218
1.347234
1.494849
0.047696
1.918528
?
3.680751
3.4822023
miR-125a
0.784584
0.8408964
4.756828
4.594793
1.265757
0.632878
2.4794154
70.0348
36.758347
miR-125b
1.905276
0.1088188
4.198867
2.770219
2.80889
0.907519
33.128478
11.00433
12.295001
miR-126
2.514027
3.4822023
6.868523
3.458149
0.126745
0.946058
100.42676
4.112455
5.5021673
miR-128b
0.432269
2.3949574
8.339726
2.989698
0.876606
2.751084
0.283221
2.17347
4.5630549
miR-132
2.639016
0.3977682
1.729074
5.61778
0.61132
0.707107
0.3391511
3.732132
1.9724654
miR-133a
1.385109
0.5864175
3.758091
1.840375
1.827663
2.07053
9.9176616
0.959264
0.4506252
miR-134
0.316439
0.5358867
7.110741
2.462289
0.211686
0.578344
2.1584565
2.80889
0.5471469
miR-135b
1.375542
1.2570134
0.384219
1.265757
9.781122
7.012846
0.3321715
11.23556
37.271475
miR-136
0.80107
1.1647336
23.58831
3.052518
0.225313
0.41466
0.0133224
0.406126
?
miR-137
0.042689
23.917588
0.503478
0.795536
0.570382
1.658639
0.0025772
1.140764
261.3791
miR-140
2.234574
2.0562277
3.160165
0.628507
5.540438
0.993092
0.0066612
14.92853
4.9588308
miR-141
0.246558
0.0113592
0.028756
1.375542
0.493116
0.309927
0.6285067
0.323088
0.4413515
miR-142-3p
45.25483
0.2812646
0.406126
1.205808
19.83532
2.657372
0.0418102
10.12605
19.835323
miR-143
miR-145
3.917681
10.48315
0.5212329
0.289172
1.214195
1.319508
1.526259
1.231144
13.73705
10.12605
8.168097
4.316913
3.4105396
2.6390158
23.75238
67.64915
22.943284
38.054628
miR-146a
16.56424
0.1486509
2.013911
1.958841
3.271608
1.214195
11.551434
24.93327
31.77896
miR-149
1.356604
2.250117
6.773962
5.028053
0.376312
1.057018
2.0139111
5.169411
0.1582196
miR-150
15.03236
0.1396609
0.63728
6.408559
0.784584
1.717131
0.4444213
17.14838
5.5789747
miR-151
0.806642
0.9726549
4.469149
3.97237
0.441351
0.920188
0.0674518
3.07375
?
miR-153
0.473029
25.457167
18.12614
0.790041
0.144586
1.580083
0.0083732
0.687771
?
miR-154
0.673617
1.0352649
5.278032
2.969047
0.395021
0.554785
0.7219646
4.112455
0.4383029
miR-155
15.03236
0.0060872
0.395021
0.835088
2.158456
2.732081
5.6177795
52.34573
48.840295
miR-15a
1.375542
2.6026837
4.789915
5.426417
1.802501
0.870551
18.507011
5.979397
7.674113
miR-15b
0.90125
1.5583292
5.388934
4
0.395021
1.547565
8.6338259
29.04061
28.442966
miR-16
0.403321
3.6807506
6.020987
4.563055
0.411796
0.721965
27.09585
7.568461
4.4382779
miR-17-3p
1.729074
0.4537596
1.729074
2.828427
0.566442
1.729074
1.0352649
1.866066
1.1095695
miR-17-5p
1.301342
0.8066418
1.591073
2.751084
2.281527
3.482202
7.061624
20.11221
13.269113
miR-181a
0.463294
0.2660925
0.532185
0.876606
0.535887
0.320856
1.3286858
2.549121
7.1107414
miR-181b
miR-181c
1.071773
0.450625
0.2016604
0.2284579
1.717131
0.607097
3.271608
4.346939
0.888843
0.316439
0.632878
3.317278
18.635737
2.5847057
10.62949
6.868523
12.728584
6.4531341
miR-181d
1.257013
0.25
2.12874
3.5801
1.802501
0.632878
2.8088898
21.70567
11.235559
miR-183
0.05366
1.5052467
6.821079
8.168097
0.075363
0.913831
0.1111053
6.19026
6.1475007
miR-185
2.34567
0.7169776
2.828427
2.969047
4.626753
2.313376
0.3634931
13.73705
2.6390158
miR-186
0.97942
2.907945
7.727491
9.38268
2.361985
1.109569
?
3.09513
1.4640857
123
World J Surg
Table 2 continued
miRNA
P2
MIA
Panc-1
BxPC-3
T2
T7
T22
T33
T35
miR-188
0.539614
0.7474246
2.445281
3.97237
0.10083
0.779165
14.928528
0.246558
0.4600938
miR-18a
1.385109
0.4569157
0.496546
1.515717
5.61778
3.863745
0.2973018
20.25211
18.126142
miR-190
0.659754
1.1647336
5.35171
25.63424
7.835362
3.294364
0.1907824
?
?
miR-191
2.12874
1.9724654
22.94328
7.78124
1.164734
1.086735
49.52208
15.13692
5.5021673
miR-192
0.554785
0.659754
0.986233
2.297397
0.363493
4.257481
781.44471
1.79005
0.0973956
miR-194
1.021012
0.4796321
0.946058
1.42405
3.182146
6.773962
55.330383
2.828427
0.1111053
miR-195
0.664343
3.2716082
5.464161
3.837056
0.528509
0.716978
1.2657566
9.57983
10.777869
miR-196a
0.301452
1.8150383
349.7063
21.85664
27.09585
168.897
2.0139111
5.314743
152.21851
miR-197
1.071773
1.0210121
2.361985
3.758091
0.732043
1.474269
0.6643429
4.112455
8.1116758
miR-198
2.042024
0.2414841
0.049037
0.198884
1.474269
1.753211
0.1755556
1.591073
2.7894873
miR-199a?b
16.56424
0.6925547
3.458149
2.732081
18.50701
0.888843
3.0314331
51.62507
33.824577
miR-30b
1.101905
1.8150383
5.696201
2.969047
0.578344
0.482968
8.8152409
18.50701
10.852835
miR-19a?b
miR-95
1.70527
0.065154
0.6029039
6.1050368
0.737135
4.027822
0.913831
2.013911
0.297302
0.175556
1.94531
2.042024
4.3771748
58.89201
1.071773
40.22443
1.3472336
24.933267
miR-20a
0.959264
0.5904963
1.028114
2.188587
2.158456
2.989698
26.354913
18.76536
14.723002
miR-200a
0.486327
0.0079767
0.986233
3.41054
0.993092
1.866066
2.8878584
1.239708
2.2815274
miR-200b
0.325335
0.017337
0.052193
4.316913
0.180491
1.958841
464.64981
1.515717
5.8158901
miR-200c
0.153893
0.0044253
0.008669
3.07375
0.060371
0.441351
41.642939
0.835088
0.9265881
miR-202
0.835088
0.6285067
0.598739
1.042466
0.204476
1.148698
12.906268
1.028114
0.6551967
miR-203
0.895025
0.0915054
0.05672
6.868523
2.12874
16.67945
0.0429857
52.34573
33.590934
miR-204
0.11908
0.417544
1.189207
1.101905
0.063813
0.208772
0.5823668
3.89062
2.0849315
miR-205
0.716978
0.0024381
0.004809
2.828427
0.334482
0.80107
0.7071068
2.496661
268.72747
miR-206
0.80107
0.5946036
2.084932
7.210004
0.139661
1.109569
0.1425955
0.926588
0.952638
miR-21
3.732132
0.6198538
2.789487
1.753211
2.013911
1.958841
6888.6234
27.66519
256
miR-210
2.620787
2.1584565
2.80889
3.160165
2.17347
1.972465
0.5
8.633826
16
miR-214
2.86791
3.1166583
1.658639
2.265768
4.563055
0.732043
16
2.770219
3.09513
miR-215
0.353553
0.7900413
?
2.188587
0.514057
4.890561
2005.8528
3.41054
0.208772
miR-372
miR-373
0.264255
0.264255
0.6029039
1.1809927
1.385109
3.031433
2.042024
2.188587
0.125869
0.153893
0.668964
0.939523
0.2448551
0.060371
1.70527
0.687771
1.6586391
0.2102241
miR-218
2.114036
0.0112028
1.079228
5.314743
0.594604
0.747425
0.0824692
11.31371
16
miR-219
0
1.1647336
2.751084
1.972465
0.134904
0.678302
0.1073207
1.231144
0.5034778
miR-22
0.993092
0.4263174
1.347234
1.879045
3.138336
0.582367
1.8531761
3.863745
2.6026837
miR-488
0.403321
0.5509526
1.515717
2.639016
0.102238
0.011518
0.8585654
0.303549
0.0940779
miR-221
2.602684
3.6553258
3.340352
6.680703
9.12611
2.07053
0.3977682
28.05138
19.159659
miR-222
1.972465
2.2657678
1.765406
3.758091
3.271608
3.630077
0.2016604
43.71329
54.1917
miR-223
4.14106
0.3535534
2.566852
10.05611
4.723971
4.469149
79.341293
13.54792
13.737047
miR-224
1.148698
0.0021373
0.003262
2.86791
1.36604
6.868523
14.025692
168.897
45.886568
miR-23a
0.655197
0.8408964
4.626753
4.169863
0.241484
1.569168
?
101.1253
95.670352
miR-24
0.702222
0.8293195
3.944931
3.605002
3.031433
1.840375
62.682899
13.8326
4.6913398
miR-25
0.707107
0.7791646
1.815038
2.445281
0.279322
1.453973
52.709825
48.50293
12.295001
miR-26a
0.479632
0.8293195
3.434262
4.531536
0.29937
0.61132
22.161751
26.72281
23.26356
miR-26b
0.586417
1.0717735
6.498019
5.205367
0.325335
1.042466
29.040613
56.49299
43.411338
miR-27a?b
0.496546
0.6417129
3.605002
3.732132
1.494849
1.214195
19.027314
24.42015
9.3178687
miR-30c
miR-29a?b?c
0.450625
1.972465
1.591073
0.8408964
5.426417
1.729074
1.931873
0.993092
0.539614
0.566442
0.423373
1.22264
37.530718
704.27741
14.02569
3.5801
8.168097
8.3977335
miR-30a-3p
0.140632
1.4948492
5.540438
1.879045
0.065154
0.376312
15.242208
2.188587
1.1647336
miR-30a-5p
0.273573
2.2657678
5.314743
3.706352
0.389582
0.435275
2.3133764
1.375542
0.528509
123
World J Surg
Table 2 continued
miRNA
P2
MIA
Panc-1
BxPC-3
T2
T7
T22
T33
T35
miR-296
0.539614
0.1103379
0.432269
1.310393
1.013959
1.505247
1.4539725
5.028053
1.4640857
Chronic pancreatitis tissue (P2). Pancreatic cancer cell lines (MIA-CaPa2, Panc-1, and BxPC-3). Surgical specimens of pancreatic cancer tissues
(T2, T7, T22, T33, and T35). ? the miRNA was increased in cancer tissues or cells, whereas normal control subjects had no expression. The
expression of all miRNAs was normalized to the U6 level in all tissue samples and cell types
a
Compared with the relatively normal human pancreatic ductal epithelium (HPDE)
b
Compared with the relatively normal pancreatic tissues
Table 3 Eight commonly increased miRNAs in more pancreatic cancer cell linesa and surgical specimensb
Sample
miR-196a
miR-190
miR-186
miR-221
miR-222
miR-200b
miR-15b
miR-95
1
P2
0.301452
0.659754
0.97942
2.602684
1.972465
0.325335
0.90125
0.065154
2
Panc-1
349.7063
5.35171
7.727491
3.340352
1.765406
0.052193
5.388934
4.027822
3
MIA
1.815038
1.164734
2.907945
3.655326
2.265768
0.017337
1.558329
6.105037
4
BxPC-3
21.85664
25.63424
9.38268
6.680703
3.758091
4.316913
4
2.013911
5
ASPC-1
234.753
?
21.18542
19.63016
13.54792
21.55574
11.75335
273.4247
6
Capan1
13.68952
?
4.228072
2.505329
1.802501
8.724062
0.737135
11.08088
7
Capan2
7.43844
?
1.918528
7.361501
7.210004
11.3924
1.840375
9.849155
8
Panc3.27
9.849155
?
1.328686
2.799172
1.898684
1.765406
1.068065
0.747425
9
Hs766T
36.12686
?
27.28432
14.17228
10.81529
0.031577
2.838247
16.39291
10
PL45
2.666597
?
0.70466
2.694467
2.099433
1.252664
1.630145
4.084049
11
12
HPAFII
T7
117.784
168.897
?
3.294364
10.30305
1.109569
11.71269
2.07053
8.969329
3.630077
19.15966
1.958841
1.879045
1.547565
8.724062
2.042024
13
T13
648.0674
21.63057
6.680703
17.75311
21.70567
9.000468
15.03236
7.412704
14
T18
0.353553
0.503478
0.018517
25.45717
0.63728
10.30305
261.3791
61.60604
15
T19
1.094294
4.773343
1.500039
1.69937
2.313376
3.680751
9.986644
9.094536
16
T22
2.013911
0.190782
?
0.397768
0.20166
464.6498
8.633826
58.89201
17
T29
1.125058
4.890561
2.020903
3.271608
2.531513
1.01748
1.261377
1.049717
19
T31
101.8287
8.574188
1.287882
1.986185
2.938337
0.784584
4.789915
1.248331
20
T32
7.727491
6.083915
1.168777
1.419123
1.404445
1.132884
1.314943
0.787308
21
T33
5.314743
?
3.09513
28.05138
43.71329
1.515717
29.04061
40.22443
22
T34
0.809442
6.940309
7.412704
21.03908
6.84476
6.750526
3.193194
31.45026
23
T35
152.2185
?
1.464086
19.15966
54.1917
5.81589
28.44297
24.93327
24
T36
11.31371
174.8532
8.196455
32.1111
22.08508
1.086735
62.03455
19.7667
25
T37
140.0696
32.67239
18.37917
76.63864
325.1587
61.1805
68.35619
21.78103
26
T38
1557.482
?
11.91742
292.0355
40.64483
150.6441
33806.19
7669.942
27
T39
2.938337
1.433955
1.172835
0.760489
1.132884
1.85961
0.750019
0.78187
28
29
T40
T2
401.7071
27.0958
21.48116
7.8356
3.797368
2.362
7.210004
9.1261
8.969329
3.2716
9.679953
0.1805
0.604997
0.395
0.982821
0.1756
Chronic pancreatitis tissue (row 1). Pancreatic cancer cell lines (rows 2–11). Surgical specimens of pancreatic cancer tissues (rows 12–29). ? the
miRNA was increased in cancer tissues or cells, whereas normal control subjects had no expression. The expression of all miRNAs was
normalized to the U6 level in all tissue samples and cell types
a
b
Compared with the relatively normal human pancreatic ductal epithelium (HPDE)
Compared with the relatively normal pancreatic tissues
222 (100%), miR-200b (70%), miR-15b (90%), and miR95 (90%), and the increase levels ranged from 3.3- to 79fold (p \ 0.01, n = 10; Fig. 2a). For the pancreatic cancer
tissues compared with normal pancreatic tissues, the
expression increases (incidence and fold increase) of miR196a (82% and 190), miR-190 (88% and 21), miR-186
123
World J Surg
miRNA Levels (Fold Increase)
(Normalized to U6 RNA)
A
140
120
10 cancer cell lines
p<0.01 over HPDE
79
100
80
34
60
40
11
20
0
miRNA
196a
190
8.7
7.5
5.4
6.8
186
221
222
200b
3.3
15b
95
Incidence (100%) (100%) (90%) (100%) (100%) (70%) (90%) (90%)
miRNA Levels (Fold Increase)
(Normalized to U6 RNA)
B
2018
17 cancer tissues
p<0.01 over normal tissues
2000
1500
1000
500
468
190
0
miRNA 196a
21
4.5
32
32
43
190
186
221
222
200b
15b
95
Incidence (82%) (88%) (94%) (88%) (88%) (76%) (82%) (71%)
Fig. 2 The expression of eight miRNAs in more pancreatic cancer
cell lines and surgical specimens. Expression of 8 miRNAs (miR196a, miR-190, miR-186, miR-221, miR-222, miR-200b, miR-15b,
and miR-95) selected from the 95 miRNAs was determined in 10
pancreatic cancer cell lines and 17 pairs of pancreatic cancer tissues
and their adjacent normal pancreatic tissues. a Expression of eight
miRNAs were significantly increased in pancreatic cancer cell lines
compared with HPDE cells (n = 10; p \ 0.01). b Expression of eight
miRNAs were significantly increased in pancreatic cancer tissues
compared with their adjacent normal pancreatic cancer tissues
(n = 17, p \ 0.01)
(94% and 4.5), miR-221 (88% and 32), miR-222 (88% and
32), miR-200b (76% and 43), miR-15b (82% and 2018),
and miR-95 (71% and 468) also were observed (p \ 0.01,
n = 17; Fig. 2b). These data indicate that these miRNAs
may share common pathways in the pancreatic cancer
pathogenesis.
Discussion
In the current study, a unique 95 miRNA expression profile
was observed in human pancreatic cancer tissues and cell
lines, and eight miRNAs (miR-196a, miR-190, miR-186,
miR-221, miR-222, miR-200b, miR-15b, and miR-95)
were significantly increased in the most of pancreatic
cancer tissues and cell lines compared with normal pancreatic tissues and cells. Many of these miRNAs have not
123
been reported in pancreatic cancer. This study provides
new opportunities for studying novel molecular pathways
of pancreatic cancer pathogenesis and for developing new
strategies for pancreatic cancer diagnosis and treatment.
The mechanism of action of a specific miRNA is usually
involved in its nucleotide complementary pairing to the 30
UTR of its specific targeting mRNAs, primarily functioning as a negative regulator by repressing target mRNA
translation. miRNAs may directly regulate tissue or organ
development and cell differentiation as well as maintain
normal functions of many organ systems [27]. The alterations in miRNA expression may play an important role in
many diseases, including pancreatic cancer formation.
Using the QuantiMirTM RT Kit, we tagged and converted
mature miRNAs into detectable and quantifiable cDNAs.
We used a highly sensitive real-time PCR analysis to
profile 95 cancer-related miRNAs. This method is more
reliable and accurate for detection of miRNA expression
and has much less technical noise but has greater reproducibility than traditional cDNA microarray or northern
blot analysis. All 95 miRNAs chosen for the array have
functional implications with regard to their potential roles
in cancer, cell development, and apoptosis. Our expression
profiling data indicate a large number of miRNAs that are
aberrantly expressed in pancreatic cancer tissues and cell
lines compared with normal pancreatic tissues and cells.
From these profiling data, we observed a diversity nature of
miRNA expression among individual pancreatic cancer
tissues or cells, which may support the concept of personalized medicine in care of these patients. However, we
also observed the expression pattern of many miRNAs was
reserved in the most pancreatic cancer tissues and cell lines
studied in the current study. For example, eight miRNAs
(miR-196a, miR-190, miR-221, miR-222, miR-200b, miR15b, and miR-95) were consistently increased in the
majority of pancreatic cancer tissues and cell lines. These
data indicate that pancreatic cancer may share some common pathways for cancer pathogenesis by regulation of
miRNAs. Many of these miRNAs have not been reported
before in pancreatic cancer and their biological functions
are largely unknown in pancreatic cancer pathogenesis.
Bloomston et al. [16] reported that the high expression
of miR-196a-2 was found to predict poor survival in
patients with pancreatic cancer. miR-196a involves organ
development by negatively regulating Hoxb8 [28]. miR190 was found to be upregulated in human hepatocellular
carcinomas [7]. The miR-200 family has been shown to
regulate epithelial to mesenchymal transition (EMT) by
targeting ZEB1 and SIP1. However, miR-200b was
markedly downregulated in cells that had undergone EMT
in response to transforming growth factor (TGF)-beta or to
ectopic expression of the protein tyrosine phosphatase Pez
[29]. Overexpression of miR-15b sensitized human gastric
World J Surg
cancer cells to anticancer drugs by targeting BCL2 [30].
Inhibition of miR-95 decreased cell growth in HeLa cells
[31]. miR-221 was reported to be overexpressed in glioblastoma [32] and in thyroid cancer [33]. miR-221 and
miR-222 are clustered on the X chromosome, and both of
them are predicted to regulate cell cycle by targeting on kit
[33] and p27Kip1 [8]. Our data showed that miR-222 was
increased in pancreatic cancers at the level similar to miR221. Based on the miRNA profiling and their functional
studies, miRNA/RNAi-based therapeutics could be attractive strategies for pancreatic cancer treatment.
Conclusions
Pancreatic cancer may have a unique miRNA expression
pattern at each individual basis. However, common pathways for pancreatic cancer pathogenesis may exist. Our
study suggests that the expression of eight miRNAs (miR196a, miR-190, miR-221, miR-222, miR-200b, miR-15b,
and miR-95) was significantly increased in the majority of
pancreatic cancer tissues and cell lines. Further investigations are required for determination of their molecular
functions and mechanisms as well as characterization of
these miRNAs as prognostic and/or diagnostic markers in
pancreatic cancer. Because miRNAs may regulate multiple
oncogenic pathways, they may serve as potential targets for
cancer therapy. For examples, antagomirs and chemically
modified antisense nucleotides for miRNAs can be used to
silence specific endogenous miRNA in vivo [34]. This may
provide a novel strategy to treat pancreatic cancer.
Acknowledgements This study was partially supported by the
Michael E. DeBakey Department of Surgery at the Baylor College of
Medicine and the Michael E. DeBakey VA Medical Center, Houston,
Texas, USA.
References
1. Esquela-Kerscher A, Slack FJ (2006) Oncomirs: microRNAs
with a role in cancer. Nat Rev Cancer 6:259–269
2. Sevignani C, Calin GA, Siracusa LD, Croce CM (2006) Mammalian microRNAs: a small world for fine-tuning gene
expression. Mamm Genome 17:189–202
3. Barbarotto E, Schmittgen TD, Calin GA (2008) MicroRNAs and
cancer: profile, profile, profile. Int J Cancer 122:969–977
4. Kent OA, Mendell JT (2006) A small piece in the cancer puzzle:
microRNAs as tumor suppressors and oncogenes. Oncogene
25:6188–6196
5. Valencia-Sanchez MA, Liu J, Hannon GJ, Parker R (2006)
Control of translation and mRNA degradation by miRNAs and
siRNAs. Genes Dev 20:515–524
6. Hornstein E, Mansfield JH, Yekta S et al (2005) The microRNA
miR-196 acts upstream of Hoxb8 and Shh in limb development.
Nature 438:671–674
7. Datta J, Kutay H, Nasser MW et al (2008) Methylation mediated
silencing of MicroRNA-1 gene and its role in hepatocellular
carcinogenesis. Cancer Res 68:5049–5058
8. Calin GA, Ferracin M, Cimmino A et al (2005) A MicroRNA
signature associated with prognosis and progression in chronic
lymphocytic leukemia. N Engl J Med 353:1793–1801
9. Jeffrey SS (2008) Cancer biomarker profiling with microRNAs.
Nat Biotechnol 26:400–401
10. Ma L, Teruya-Feldstein J, Weinberg RA (2007) Tumour invasion
and metastasis initiated by microRNA-10b in breast cancer.
Nature 449:682–688
11. Lu J, Getz G, Miska EA et al (2005) MicroRNA expression
profiles classify human cancers. Nature 435:834–838
12. Saif MW (2006) Pancreatic cancer: highlights from the 42nd
annual meeting of the American Society of Clinical Oncology,
2006. JOP 7:337–348
13. Jemal A, Tiwari RC, Murray T et al (2004) Cancer statistics,
2004. CA Cancer J Clin 54:8–29
14. Sun M, Estrov Z, Ji Y et al (2008) Curcumin (diferuloylmethane)
alters the expression profiles of microRNAs in human pancreatic
cancer cells. Mol Cancer Ther 7:464–473
15. Gironella M, Seux M, Xie MJ et al (2007) Tumor protein 53induced nuclear protein 1 expression is repressed by miR-155,
and its restoration inhibits pancreatic tumor development. Proc
Natl Acad Sci USA 104:16170–16175
16. Bloomston M, Frankel WL, Petrocca F et al (2007) MicroRNA
expression patterns to differentiate pancreatic adenocarcinoma
from normal pancreas and chronic pancreatitis. JAMA 297:1901–
1908
17. Szafranska AE, Davison TS, John J et al (2007) MicroRNA
expression alterations are linked to tumorigenesis and non-neoplastic processes in pancreatic ductal adenocarcinoma. Oncogene
26:4442–4452
18. Lee EJ, Gusev Y, Jiang J et al (2007) Expression profiling
identifies microRNA signature in pancreatic cancer. Int J Cancer
120:1046–1054
19. Tsuda N, Ishiyama S, Li Y et al (2006) Synthetic microRNA
designed to target glioma-associated antigen 1 transcription factor inhibits division and induces late apoptosis in pancreatic
tumor cells. Clin Cancer Res 12:6557–6564
20. Roldo C, Missiaglia E, Hagan JP et al (2006) MicroRNA
expression abnormalities in pancreatic endocrine and acinar
tumors are associated with distinctive pathologic features and
clinical behavior. J Clin Oncol 24:4677–4684
21. Furukawa T, Duguid WP, Rosenberg L et al (1996) Long-term
culture and immortalization of epithelial cells from normal adult
human pancreatic ducts transfected by the E6E7 gene of human
papillomavirus 16. Am J Pathol 148:1763–1770
22. Ouyang H, Mou L, Luk C et al (2000) Immortal human pancreatic duct epithelial cell lines with near normal genotype and
phenotype. Am J Pathol 157:1623–3123
23. Li M, Bharadwaj U, Zhang R et al (2008) Mesothelin is a
malignant factor and therapeutic vaccine target for pancreatic
cancer. Mol Cancer Ther 7:286–296
24. Li M, Zhang Y, Liu Z et al (2007) Aberrant expression of zinc
transporter ZIP4 (SLC39A4) significantly contributes to human
pancreatic cancer pathogenesis and progression. Proc Natl Acad
Sci USA 104:18636–18641
25. Li M, Yang H, Chai H et al (2004) Pancreatic carcinoma cells
express neuropilins and vascular endothelial growth factor, but
not vascular endothelial growth factor receptors. Cancer
101:2341–2350
26. Li M, Zhai Q, Bharadwaj U et al (2006) Cyclophilin A is overexpressed in human pancreatic cancer cells and stimulates cell
proliferation through CD147. Cancer 106:2284–2294
123
World J Surg
27. Hobert O (2004) Common logic of transcription factor and
microRNA action. Trends Biochem Sci 29:462–468
28. Mansfield JH, Harfe BD, Nissen R et al (2004) MicroRNAresponsive ‘‘sensor’’ transgenes uncover Hox-like and other
developmentally regulated patterns of vertebrate microRNA
expression. Nat Genet 36:1079–1083
29. Gregory PA, Bert AG, Paterson EL et al (2008) The miR-200
family and miR-205 regulate epithelial to mesenchymal transition
by targeting ZEB1 and SIP1. Nat Cell Biol 10:593–601
30. Xia L, Zhang D, Du R et al (2008) miR-15b and miR-16 modulate multidrug resistance by targeting BCL2 in human gastric
cancer cells. Int J Cancer 123:372–379
123
31. Cheng AM, Byrom MW, Shelton J, Ford LP (2005) Antisense
inhibition of human miRNAs and indications for an involvement
of miRNA in cell growth and apoptosis. Nucleic Acids Res
33:1290–1297
32. Ciafre SA, Galardi S, Mangiola A et al (2005) Extensive modulation of a set of microRNAs in primary glioblastoma. Biochem
Biophys Res Commun 334:1351–1358
33. He H, Jazdzewski K, Li W et al (2005) The role of microRNA
genes in papillary thyroid carcinoma. Proc Natl Acad Sci USA
102:19075–19080
34. Krutzfeldt J, Rajewsky N, Braich R et al (2005) Silencing of
microRNAs in vivo with ‘‘antagomirs’’. Nature 438:685–689

Similar documents

×

Report this document