How DNA Determines Traits - Liberty Union High School District

Document technical information

Format doc
Size 56.8 kB
First found May 22, 2018

Document content analysis

Category Also themed
Language
English
Type
not defined
Concepts
no text concepts found

Persons

Organizations

Places

Transcript

How Does DNA Determine the Traits of an Organism
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism: the
Snork. Snorks were discovered on the planet Dee Enae in a distant solar system. Snorks only
have one chromosome with 6 genes on it. You job is to analyze the genes of its DNA and
determine what traits the organism has.
SNORK DNA AND TRAITS
mRNA triplet
Amino Acid Number
UGG
20
Amino Acid Sequence
Trait
UCG
16
20-11-13
hairless
GCU
2
20-12-13
hairy
UUG
4
16-2 - 5
4 legged
GCG
3
16-4 - 5
2 legged
CCC
5
12-7-8
round head
UCC
7
5-7-8
block head
UUU
8
AAA
9
9-8 - 8
no tail
CCA
12
9-4 - 8
tail
AUA
13
11-3-2
slanted eyes
GGG
1
11-3-3
wide round eyes
UAG
6
6-6-10
Male (blue)
GAU
10
6-6-14
Female (pink)
CCU
11
Observations and Analysis of Snork DNA: You are given a chromosome from a Snork with the following
sequence. Each gene has only 3 amino acids. Your job is to determine the sequence of amino acids for your
specimen. Write the complimentary mRNA, tRNA, the Amino acid it codes for and the related trait in the
chart below.
DNA
ACCGGTTATAGCCGAGGGTTTAACAAAGGACGCCGAGGGAGGAAAATCATCCTA
mRNA
tRNA
(AA)
Trait
Draw your Snork in the space below. Be creative!
×

Report this document