Position First Name Last Name Country Events World Cups Points 1

Document technical information

Format pdf
Size 5.7 MB
First found Jun 9, 2017

Document content analysis

Language
English
Type
not defined
Concepts
no text concepts found

Persons

Organizations

Places

Transcript

Peer-Reviewed Journal Tracking and Analyzing Disease Trends
pages 373–586
EDITOR-IN-CHIEF
D. Peter Drotman
Managing Senior Editor
Polyxeni Potter, Atlanta, Georgia, USA
Senior Associate Editor
Brian W.J. Mahy, Atlanta, Georgia, USA
Associate Editors
Paul Arguin, Atlanta, Georgia, USA
Charles Ben Beard, Ft. Collins, Colorado, USA
David Bell, Atlanta, Georgia, USA
Charles H. Calisher, Ft. Collins, Colorado, USA
Michel Drancourt, Marseille, France
Paul V. Effler, Perth, Australia
David Freedman, Birmingham, AL, USA
Peter Gerner-Smidt, Atlanta, GA, USA
K. Mills McNeill, Kampala, Uganda
Nina Marano, Atlanta, Georgia, USA
Martin I. Meltzer, Atlanta, Georgia, USA
David Morens, Bethesda, Maryland, USA
J. Glenn Morris, Gainesville, Florida, USA
Patrice Nordmann, Paris, France
Tanja Popovic, Atlanta, Georgia, USA
Didier Raoult, Marseille, France
Pierre Rollin, Atlanta, Georgia, USA
Dixie E. Snider, Atlanta, Georgia, USA
Frank Sorvillo, Los Angeles, California, USA
David Walker, Galveston, Texas, USA
David Warnock, Atlanta, Georgia, USA
J. Todd Weber, Stockholm, Sweden
Henrik C. Wegener, Copenhagen, Denmark
Founding Editor
Joseph E. McDade, Rome, Georgia, USA
Copy Editors
Karen Foster, Thomas Gryczan, Nancy Mannikko, Beverly Merritt,
Carol Snarey, P. Lynne Stockton
Production
Carrie Huntington, Ann Jordan, Carole Liston, Shannon O’Connor,
Reginald Tucker
Editorial Assistant
Susanne Justice
www.cdc.gov/eid
Emerging Infectious Diseases
Emerging Infectious Diseases is published monthly by the Centers for Disease
Control and Prevention, 1600 Clifton Road, Mailstop D61, Atlanta, GA 30333,
USA. Telephone 404-639-1960, fax 404-639-1954, email [email protected]
The opinions expressed by authors contributing to this journal do not necessarily reflect the opinions of the Centers for Disease Control and Prevention or
the institutions with which the authors are affiliated.
All material published in Emerging Infectious Diseases is in the public domain and may be used and reprinted without special permission; proper citation,
however, is required.
Use of trade names is for identification only and does not imply endorsement
by the Public Health Service or by the U.S. Department of Health and Human
Services.
∞ Emerging Infectious Diseases is printed on acid-free paper that meets the requirements of
ANSI/NISO 239.48-1992 (Permanence of Paper)
EDITORIAL BOARD
Dennis Alexander, Addlestone Surrey, United Kingdom
Barry J. Beaty, Ft. Collins, Colorado, USA
Ermias Belay, Atlanta, GA, USA
Martin J. Blaser, New York, New York, USA
Christopher Braden, Atlanta, GA, USA
Carolyn Bridges, Atlanta, GA, USA
Arturo Casadevall, New York, New York, USA
Kenneth C. Castro, Atlanta, Georgia, USA
Thomas Cleary, Houston, Texas, USA
Anne DeGroot, Providence, Rhode Island, USA
Vincent Deubel, Shanghai, China
Ed Eitzen, Washington, DC, USA
Daniel Feikin, Baltimore, MD, USA
Kathleen Gensheimer, Cambridge, MA, USA
Duane J. Gubler, Singapore
Richard L. Guerrant, Charlottesville, Virginia, USA
Stephen Hadler, Atlanta, GA, USA
Scott Halstead, Arlington, Virginia, USA
David L. Heymann, London, UK
Charles King, Cleveland, Ohio, USA
Keith Klugman, Atlanta, Georgia, USA
Takeshi Kurata, Tokyo, Japan
S.K. Lam, Kuala Lumpur, Malaysia
Bruce R. Levin, Atlanta, Georgia, USA
Myron Levine, Baltimore, Maryland, USA
Stuart Levy, Boston, Massachusetts, USA
John S. MacKenzie, Perth, Australia
Marian McDonald, Atlanta, Georgia, USA
John E. McGowan, Jr., Atlanta, Georgia, USA
Tom Marrie, Halifax, Nova Scotia, Canada
Philip P. Mortimer, London, United Kingdom
Fred A. Murphy, Galveston, Texas, USA
Barbara E. Murray, Houston, Texas, USA
P. Keith Murray, Geelong, Australia
Stephen M. Ostroff, Harrisburg, Pennsylvania, USA
David H. Persing, Seattle, Washington, USA
Richard Platt, Boston, Massachusetts, USA
Gabriel Rabinovich, Buenos Aires, Argentina
Mario Raviglione, Geneva, Switzerland
David Relman, Palo Alto, California, USA
Ronald M. Rosenberg, Fort Collins, Colorado, USA
Connie Schmaljohn, Frederick, Maryland, USA
Tom Schwan, Hamilton, Montana, USA
Ira Schwartz, Valhalla, New York, USA
Tom Shinnick, Atlanta, Georgia, USA
Bonnie Smoak, Bethesda, Maryland, USA
Rosemary Soave, New York, New York, USA
P. Frederick Sparling, Chapel Hill, North Carolina, USA
Robert Swanepoel, Johannesburg, South Africa
Phillip Tarr, St. Louis, Missouri, USA
Timothy Tucker, Cape Town, South Africa
Elaine Tuomanen, Memphis, Tennessee, USA
John Ward, Atlanta, Georgia, USA
Mary E. Wilson, Cambridge, Massachusetts, USA
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
March 2010
On the Cover
West Nile Virus in American White
Pelicans, Montana ........................................ 406
G. Johnson et al.
William Blake (1757–1827)
The Ghost of a Flea (1819–20)
Tempera mixture panel with
gold on mahogany
(21.4 cm × 16.2 cm)
Tate, London, England
Wildlife disease investigations may help reduce
zoonotic infections.
Murine Typhus in Austin, Texas .................. 412
J. Adjemian et al.
About the Cover p. 583
Physicians should be alert for possible cases.
Chikungunya Virus Infection during
Pregnancy, Réunion, France ....................... 418
X. Fritel et al.
Outcomes did not differ between infected and
uninfected women.
Perspectives
Mumps Outbreak in Hospital,
Chicago, Illinois ............................................ 426
A.L. Bonebrake et al.
Preparing a Community Hospital
to Manage Work-related Exposures
to Infectious Agents ..................................... 373
G.F. Risi et al.
Vaccination record accessibility and testing
compliance could have minimized costs.
Enhanced isolation techniques and employee
education can improve safety and patient care.
Reservoir Hosts for Amblyomma
americanum Ticks ........................................ 433
B.F. Allan et al.
Bartonella spp. Transmission
and Ticks ....................................................... 379
S.R. Telford III and G.P. Wormser
p. 401
Data are insufficient to conclude that ticks transmit
these organisms.
Borrelia, Ehrlichia, and Rickettsia spp.
in Ticks, Texas .............................................. 441
P.C. Williamson et al.
Potential for Tick-borne Bartonelloses ...... 385
E. Angelakis et al.
Some tick-borne illnesses may pose yet-unknown
public health risks.
Although possible, tick transmission to a vertebrate
host has not been proven.
Research
p. 408
Malaria in Areas of Low
Endemicity, Somalia, 2008 ........................... 392
T. Bousema et al.
Serologic markers can identify spatial variations in
transmission patterns.
Kissing Bugs and T. cruzi, Arizona............. 400
C.E. Reisenman et al.
A survey found 41.5% of these bugs were infected
with the causative agent of Chagas disease.
Blood meal analysis identified white-tailed deer as
hosts for ticks that carry zoonotic pathogens.
Legionella pneumophila Serogroup 1
Clones, Ontario, Canada .............................. 447
N. Tijet et al.
Identifying geographic distribution can improve
surveillance and clinical testing procedures.
Invasive Haemophilus influenzae
Disease, Europe, 1996–2006........................ 455
S. Ladhani et al.
Incidence and case-fatality ratios for non–type B
infections are higher than for type B infections.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Vaccine Preventability of
Meningococcal Clone, Germany ................. 464
J. Elias et al.
March 2010
Because serogoup B disseminates slowly,
vaccination is effective.
Avian Bornavirus and Proventricular
Dilatation Disease......................................... 473
P. Gray et al.
Testing confirms this virus causes this disease in
parrots.
Cost Analysis of West Nile Virus
Outbreak, Sacramento County,
California ....................................................... 480
L.M. Barber et al.
Aerial spraying is cost-effective.
Dispatches
p. 488
534
Pandemic (H1N1) 2009 Virus Infection in
Domestic Cat
B.A. Sponseller et al.
538
School Closure and Mitigation of Pandemic
(H1N1) 2009, Hong Kong
J.T. Wu et al.
542
Global Origin of Mycobacterium
tuberculosis in the Midlands, UK
J.T. Evans et al.
546
Quinine-Resistant Malaria in Traveler
Returning from Senegal
B. Pradines et al.
549
Putative New Lineage of West Nile Virus,
Spain
A. Vázquez et al.
553
Venezuelan Equine Encephalitis and 2
Human Deaths, Peru
S. Vilcarromero et al.
487
Paenibacillus larvae Bacteremia in Injection
Drug Users
S. Rieg et al.
490
Rickettsia helvetica in Patient with
Meningitis, Sweden
K. Nilsson et al.
557
Extensively Drug-Resistant Mycobacterium
tuberculosis from Aspirates, South Africa
S.K. Heysell et al.
493
Influenza A (H3N2) Variants with Reduced
Sensitivity to Antiviral Drugs
C. Dapat et al.
561
Parvovirus 4–like Virus in Blood Products
J. Szelei et al.
497
Sarcocystis Species Lethal for Domestic
Pigeons, Germany
P. Olias et al.
500
504
507
Candidatus Bartonella mayotimonensis and
Endocarditis
E.Y. Lin et al.
p. 522
First-wave Pandemic (H1N1) 2009, Northern
California
R. Baxter
Experimental Infection of Squirrel Monkeys
with Nipah Virus
P. Marianneau et al.
CME ACTIVITY
Another Dimension
582
Sus-Pense
R.L. Bernstein
Letters
565
Rhabdomyolysis and Pandemic (H1N1) 2009
Pneumonia in Adult
566
Yersinia pseudotuberculosis and
Y. enterocolitica Infections
567
Measles Outbreak, the Netherlands, 2008
Neurologic Manifestations of Pandemic
(H1N1) 2009 Virus Infection
511
Q Fever in Greenland
A. Koch et al.
569
514
Banna Virus, China, 1987–2007
H. Liu et al.
570
Rickettsia felis, West Indies
571
Rickettsia africae, Western Africa
518
Bluetongue Virus Serotypes 1 and 4 in Red
Deer, Spain
B. Rodriguez-Sánchez et al.
573
Transmission of West Nile Virus during
Horse Autopsy
575
521
Spotted Fever Group Rickettsiosis, Brazil
M.G. Spolidorio et al.
Breeding Sites of Bluetongue Virus Vectors,
Belgium
576
Two Lineages of Dengue Virus Type 2, Brazil
524
Climate Warming and Tick-borne
Encephalitis, Slovakia
M. Lukan et al.
578
Yersinia spp. Isolated from Bats, Germany
580
Human Herpesvirus 8, Southern Siberia
527
Terrestrial Rabies and Human Postexposure
Prophylaxis, New York
M. Eidson and A.K. Bingman
530
Skin Infections and Staphylococcus aureus
Complications in Children, England
S. Saxena et al.
About the Cover
583
The Flea of Fleas
496
Etymologia
Yersinia
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Preparing a Community Hospital to
Manage Work-related Exposures to
Infectious Agents in BioSafety
Level 3 and 4 Laboratories
George F. Risi, Marshall E. Bloom, Nancy P. Hoe, Thomas Arminio, Paul Carlson, Tamara Powers,
Heinz Feldmann, and Deborah Wilson
Construction of new BioSafety Level (BSL) 3 and 4 laboratories has raised concerns regarding provision of care
to exposed workers because of healthcare worker (HCW)
unfamiliarity with precautions required. When the National
Institutes of Health began construction of a new BSL-4 laboratory in Hamilton, Montana, USA, in 2005, they contracted
with St. Patrick Hospital in Missoula, Montana, for care of
those exposed. A care and isolation unit is described. We
developed a training program for HCWs that emphasized
the optimal use of barrier precautions and used pathogenspecific modules and simulations with mannequins and
fluorescent liquids that represented infectious body fluids.
The facility and training led to increased willingness among
HCWs to care for patients with all types of communicable
diseases. This model may be useful for other hospitals,
whether they support a BSL-4 facility, are in the proximity of
a BSL-3 facility, or are interested in upgrading their facilities
to prepare for exotic and novel infectious diseases.
O
ver the past decade, biomedical research performed on
agents of viral hemorrhagic fevers (VHFs) has substantially increased. These agents are members of several
virus groups, including filoviruses (Ebola virus, Marburg
virus), Old World arenaviruses (Lassa virus, Lujo virus),
New World arenaviruses (Machupo virus, Junin virus,
Sabia virus, Guanarito virus, Chapare virus), flaviviruses
(Omsk hemorrhagic fever virus, Kyasanur Forest disease
Author affiliations: Infectious Disease Specialists, PC, Missoula,
Montana, USA (G.F. Risi); St. Patrick Hospital and Health Sciences
Center, Missoula (T. Powers); National Institutes of Health, Bethesda, Maryland, USA (G.F. Risi, N.P. Hoe, T. Arminio, P. Carlson, D.
Wilson); and Rocky Mountain Laboratories, Hamilton, Montana,
USA (M.E. Bloom, H. Feldmann)
DOI: 10.3201/eid1603.091485
virus), and bunyaviruses (Crimean–Congo hemorrhagic
fever virus, Rift Valley fever virus) (1). Work with these
agents is performed in specialized containment laboratories, operating at either BioSafety Level (BSL) 3 or BSL-4.
BSL-3 denotes the potential for aerosol transmission to the
laboratory worker. An agent that also is associated with
high lethality and for which no available vaccine or specific
treatment exists is studied at BSL-4 (2). Many VHF agents
have a demonstrated potential for person-to-person transmission, including in nosocomial settings. A recent example of person-to-person transmission to hospital personnel
occurred in September and October 2008 when Lujo virus
was transmitted from the index patient to a paramedic, 2
nurses, and a member of the janitorial staff. Barrier precautions were not in place at the time of these events (3).
To provide safe work settings in which to study these
pathogens, several BSL-4 laboratories are either in operation or under construction in the United States and abroad
(Table 1) (T.G. Ksiazek, pers. comm.). Operation and management of these facilities are characterized by redundant
engineering of safety features, strict administrative oversight, biosecurity measures, and extensive training (2,4), all
designed to reduce the risk for exposure to persons working
in this environment and prevent agents from being released
into the community. Despite these safeguards, researchers
in the United States and abroad have, on occasion, sustained
occupational exposures to such agents, which rarely have
resulted in overt illness and death (Table 2) (5–11). Because of the potential for person-to-person transmission of
many VHF agents, rendering care to exposed or ill persons
requires considerations beyond the scope of traditional hospital practices. Contact and/or airborne isolation guidelines
may need to be added to standard isolation over the course
of a patient’s hospitalization (12,13).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
373
PERSPECTIVE
Table 1. BSL-4 laboratories planned or operational, 2009*
Location
Status
United States
Centers for Disease Control and Prevention,
A
Atlanta, GA, USA
Georgia State University Viral Immunology
A
Center, Atlanta
Boston University National Emerging Infectious
NA
Disease Laboratories, Boston, MA, USA
United States Army Medical Research Institute
A
of Infectious Diseases, Fort Detrick, MD, USA
NA
Department of Homeland Security National
Biodefense Analysis and Countermeasures
Center, Frederick, MD, USA
National Institute of Allergy and Infectious
Diseases
Integrated Research Facility, Frederick
NA
Rocky Mountain Laboratories, Hamilton, MT,
A
USA
Southwest Foundation for Biomedical Research,
A
San Antonio, TX, USA
University of Texas Medical Branch, Galveston,
TX, USA
Robert E. Shope MD BSL-4 Laboratory
A
Galveston National Biocontainment
A
Laboratory
Other countries
Geelong, Victoria, Australia
A
Winnipeg, Ontario, Canada
A
Taiwan
NA
London and Salisbury, UK
A, A
Lyon, France
A
Libreville, Gabon
A
Hamburg, Marburg, Berlin, and Greifswald,
A, A, A, NA
Germany
Pune, India
NA
Rome, Italy
A
Bilthoven, the Netherlands
A
Novosibirsk, Russia
A
Sandringham, South Africa
NA
Solna, Sweden
A
Geneva and Spiez, Switzerland
A, NA
*BSL-4, BioSafety Level 4; A, active; NA, nonactive.
On several occasions, persons naturally infected with
a VHF agent have sought treatment at hospitals located in
industrialized areas of the world (14–21). Often the correct
diagnosis is not considered at the time of hospitalization,
and only standard isolation is used until such time as the
diagnosis is suspected or confirmed. Despite this limitation,
nosocomial transmission of these agents is uncommon in
adequately resourced hospitals (16,18,20,21). Notably, the
medical care requirements for patients with a naturally acquired VHF illness are identical to those needed for laboratory-acquired infections with the same agents.
Because of the limited and unique settings in which
BSL-4 research has historically taken place in the United
States, hospitalization for occupational exposures to VHF
agents has typically been a dedicated facility remote from
374
a conventional hospital, e.g., the medical containment
suite (the “slammer”) at the US Army Medical Research
Institute of Infectious Diseases (USAMRIID), Frederick,
Maryland, USA, or the biocontainment patient care unit at
Emory University, Atlanta, Georgia, USA. The benefits of
a remote facility include reducing the risk for nosocomial
transmission, use of personnel who are already trained in
managing a patient in containment, and control of public
access (22). However, this approach has several serious
drawbacks, including limited access to medical specialties
and nursing staff, limited availability of medications and
blood products, and limited access to specialized equipment such as ventilators and hemodialysis machines. In
addition, increased psychological stress is experienced by
patients confined to such a facility. Finally, given that the
need to activate these facilities is extremely rare, the expense of building and maintaining a stand-alone unit poses
a substantial limitation to this approach.
In addition to physical separation of the facility, medical and support staff at the USAMRIID facility work in
positive pressure suits similar to those used in the laboratories themselves (22). Although the use of such suits provides protection to the caregiver, positive pressure suits are
cumbersome, physically demanding to work in, and require
substantial time for donning and doffing (dressing and undressing). Furthermore, venipuncture and other interventions in this unaccustomed and inconvenient setting pose a
clear exposure risk to healthcare workers (HCWs). These
factors are serious drawbacks when a HCW needs to render
care to an acutely ill patient.
Documented clinical experience from several situations clearly indicates that nosocomial transmission can be
prevented by implementing standard, contact, and airborne
isolation procedures (3,15,16,19,,20). Furthermore, all
BSL-4 research programs stress the importance of recognizing and quickly reporting potential work-related exposures and illnesses to occupational medical and safety staff.
Thus, healthcare staff will typically be informed about the
specific agent and the nature of the exposure early in the
incubation period. This will enable rapid evaluation and
timely institution of appropriate isolation precautions.
Given all these considerations, what additional enhancements are really necessary for a hospital to safely
care for patients while still enabling delivery of optimum
medical care? Because of sensational misconceptions about
VHF agents in popular media such as movies and the press,
other serious issues are the willingness of HCWs to render
care to such persons and how to determine what additional
actions would increase the likelihood of their doing so. We
offer a practical approach to dealing with these issues in the
procedures followed by a patient isolation facility located
in Missoula, Montana, USA, and its attendant training and
educational components.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Exposures to Agents in BSL-3 and BSL-4
Table 2. Infections caused by laboratory exposure to hemorrhagic fever viruses*
Virus
Incident
Ebola
Fingerstick while manipulating infected guinea pig tissue, 1977 (5); percutaneous exposure to
blood from a Zaire Ebola virus–infected rodent, 2004 (7)
Marburg
3 laboratory acquired infections since the mid-1980s; 1 death occurred in Russia; no details
available (8)
Crimean–Congo hemorrhagic fever
8 cases before 1980 compiled by SALS; no details available (9)
Lassa
1 case reported in 1970 with limited details provided (10)
Junin
21 cases before 1980 compiled by SALS; no details available (9)
Machupo
1 person exposed to aerosolized blood from a broken test tube (11)
*SALS, Subcommittee on Arbovirus Laboratory Safety.
Care and Isolation Unit
The Division of Intramural Research of the National
Institute of Allergy and Infectious Diseases (NIAID) recently completed construction of an integrated research
facility with BSL-4 research space at its Rocky Mountain
Laboratories (RML) in Hamilton, Montana. As part of the
project, NIAID contracted with St. Patrick Hospital and
Health Sciences Center (SPH), a regional referral medical center located in Missoula, Montana, for provision and
staffing of a patient isolation facility to support the RML
BSL-4 research program. The facility, known as a care and
isolation unit (CIU) (23) was designed to care for RML
workers who had either known or had potential exposure
to, or illness from, work-related diseases. The facility had to
be located within 75 miles of RML, had to provide the full
range of standard in-patient care, including intensive care,
and had to meet the facility design guidelines of the National Institutes of Health, Division of Occupational Health and
Safety (NIH DOHS) (24). Furthermore, the hospital had to
supply the personnel to provide the full range of medical
and nursing care and to be able to accept a patient within 8
hours (this would entail notification of key members of the
hospital hierarchy, transferring patients if the rooms were
currently occupied, securing adequate nursing and support
staff, and carrying out systems checks to ensure that air
handling systems and autoclaves were operational). In addition to the physical facility, a training program for critical
care nurses, physicians, and other medical personnel was a
major component of the contract.
To satisfy the NIH requirements for the CIU, the following elements were needed: 1) access control, i.e., the
ability to restrict entrance into the CIU to authorized persons only; 2) three separate stand-alone rooms, each with
a bathroom and shower, separate air handling, and an anteroom separating the patient room from the hallway; 3)
directional air flow from the hallway into the anteroom and
from the anteroom into the patient room; 4) a dedicated
exhaust system providing >12 air exchanges per hour to the
patient rooms (including >2 outside air changes per hour);
5) passage of exhaust through a HEPA filter to the building
exterior >8 feet above the rooftop and well removed from
air intake ducts; 6) room surfaces constructed of seamless
materials amenable to topical disinfection; 7) the capability
for the full range of intensive care unit (ICU) monitoring and support, including the ability to perform limited
surgery, hemodialysis or peritoneal dialysis, Swan-Ganz
catheter placement, and hemodynamic monitoring; and 8)
a separate autoclave within the CIU for sterilizing all items
that come out of a patient room.
SPH was selected to provide these services and facilities. SPH is a not-for-profit medical center under the sponsorship of the Sisters of Providence. It has 195 acute care
beds, and >10,000 patient admissions per year. The full
range of standard specialty medical care is available within
the hospital, including 24 hour, 7 day/week availability of
specialists in critical care, infectious disease, and all surgical subspecialties.
SPH retrofitted 3 adjacent rooms within the existing
medical ICU (MICU) to create the CIU. A set of doors
was installed to control access to the CIU from the MICU,
and these would remain open when the CIU was not in use
(Figure). A separate fully equipped nursing station was constructed, with closed circuit television monitoring for each of
the 3 rooms. After construction, the CIU was inspected and
Autoclave
Nurse’s
station
Laboratory
Controlled
access
Directional
airflow
Controlled
access
Each room
with separate air
handling
Figure. Floor plan of the Care and Isolation Unit, St. Patrick Hospital
and Health Sciences Center, Missoula, MT, USA.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
375
PERSPECTIVE
approved by officials from NIH DOHS. Under normal circumstances, the CIU operates either as 3 conventional MICU
rooms or as isolation rooms for patients with community-acquired illnesses for which isolation of airborne pathogens is
needed. If a patient from RML should require admission, any
current occupants would be transferred, and access would be
limited by closing off that section of the MICU.
In addition to the physical aspects of the CIU, several
other elements were developed. Specific policies and procedures were written that deal with all aspects from admission to discharge, including unique aspects such as clean up
of infected bodily spills, donning and doffing of personal
protective equipment (PPE), and use of the autoclave. Support of hospital administration, physicians, nurses, and support personnel was critical. This backing was enlisted primarily by mounting an educational campaign that stressed
the true risk for nosocomial transmission of these agents,
as well as the recognition that the increased resources that
would be provided to the hospital could greatly enhance
capacity for handling community-acquired infections.
One feature dealt with preparing the hospital staff to
care for such exposed persons. To accomplish this feature,
we developed a detailed curriculum, which can be presented during a 1-day training workshop. This workshop
includes didactic information, patient care scenarios discussed in group settings, and hands-on training. Simulation
of various patient care activities (hand hygiene, donning
and doffing of PPE, cleanup of body fluids, and rendering
ICU level care to a patient) is conducted by using programmable mannequins and either tonic water or Glo Germ
(Glo Germ, Moab, UT, USA), both of which fluoresce
under ultraviolet light, to simulate infectious body fluids.
Continuing education credits are granted for participation.
Competence is maintained with quarterly demonstration of
proper technique, review of CIU-specific policies and procedures, and required utilization of a series of online problem-oriented patient care scenarios. Training videos have
been developed that demonstrate proper technique for spill
cleanup, donning and doffing of PPE, processing of patient
specimens, and processing of biohazardous waste, including use of the autoclave. Finally, detailed educational modules have been developed for each of the BSL-4 pathogens.
These modules are designed to provide a nurse, emergency
medical technician, or critical care physician with critical
information that is quickly accessible as well as an extensive discussion of all aspects of the agent. The modules are
in a standard format with extensive references and websites
for further reading. All of this information is available for
review any time both in hard copy as well as on the hospital’s intranet site in the form of slide presentations, videos,
or PDF files. The SPH staff has been generous in supplying feedback on the training and has been instrumental in
refining the curriculum. Acquisition of knowledge has been
376
documented with the use of pretesting and posttesting. After
completion of the training, SPH staff members expressed
increased confidence in caring for patients with all types of
communicable infectious diseases, including VHFs.
To maintain readiness, a series of drills and exercises
have been performed and will continue, in collaboration
with RML and local emergency medical services providers.
These readiness exercises have encompassed all aspects of
care from arrival to the hospital through discharge.
Discussion
Engineering and administrative controls as well as
PPE and standard operating procedures that are in place
in modern BSL-4 laboratories have been associated with a
greatly reduced incidence of occupational exposures to infectious agents (23,25). However, exposures, now primarily by the percutaneous route, still occur. USAMRIID recently published a review of potential laboratory exposures
to agents of bioterrorism at their facility during 1989–2002
(26). During that time, 12 evaluations were made for potential exposures to filoviruses (Ebola virus or Marburg
virus), 3 to arenaviruses, and 4 to Crimean–Congo hemorrhagic fever virus. Although none of these incidents
was deemed a high enough risk to warrant isolation of the
exposed persons, 2 laboratory workers were given investigational antiviral agents. One exposure at USAMRIID
in 2004 resulted in isolation when a scientist received a
puncture injury through a gloved hand while manipulating
a mouse that had been experimentally exposed to Ebola virus (22). Fortunately, none of these situations resulted in
infection. However, workers have been infected by agents
of VHF from laboratory accidents elsewhere (Table 2).
Nosocomial transmission of VHF is infrequently described outside of resource-poor settings. With rare exception, such events have occurred because of the lack of recognition that the index patient had such an infection (3,18).
The Centers for Disease Control and Prevention (CDC) has
published guidelines for management of patients infected
with viral hemorrhagic fevers in the conventional hospital setting (12,13). Notably, medical care has been safely
rendered by using conventional barrier precautions alone
to persons infected with VHF viruses, including Ebola virus (5,18), Marburg virus (19,20), Lassa fever virus (27),
Machupo virus (11), Sabia virus (28), and Crimean–Congo
hemorrhagic fever virus (21).
Nevertheless, even well-trained HCWs may make
mistakes due to anxiety, fatigue, or other stressors, so additional facility enhancements that augment safety are desirable when dealing with potentially lethal infectious diseases. Furthermore, the recognition of a patient with an exotic
or unfamiliar contagious disease may engender trepidation
among the medical community as well as the public. Such
concerns have at times resulted in reluctance on the part
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Exposures to Agents in BSL-3 and BSL-4
of HCWs to care for persons infected with such agents as
monkeypox virus (29), Yersinia pestis (plague) (30), and
others. When a sample of 1,000 physicians were surveyed
(526 responses), 80% indicated a willingness to care for patients in the event of an outbreak of an unknown but potentially deadly illness, but only 21% felt adequately prepared
to do so (31). Reluctance is often out of proportion to the
true risks and results from concerns for personal and family member safety. These concerns are likely to be reduced
if the HCW perceives that the facility has taken additional
precautions and instituted additional training.
To maximize safety as well as to address provider concerns of HCWs and other staff, we have developed the CIU
and our accompanying training program. Our pragmatic
and practical approach provides a well-designed facility
that enhances safety not only for the care of a patient infected with a laboratory-acquired VHF virus infection, but
also for serious transmissible community-acquired disease
or for exotic diseases contracted while traveling.
As international tourism and work assignments continue to expand, the importation of exotic diseases is almost
certain to increase and to appear in unexpected locations.
Recent instances of infection have occurred with Marburg
virus in Colorado (19) and the Netherlands (20); with Lassa
fever virus in New Jersey (15), the United Kingdom (16),
and Germany 6 (16); with Y. pestis (32) in New York, New
York; and with (initially thought) extensively drug-resistant Mycobacterium tuberculosis in Atlanta, Georgia (33).
Finally, in the United States, 1,356 BSL-3 laboratories
are registered with either CDC or the US Department of
Agriculture select agent programs (34). For these reasons,
relatively low-cost facilities ($624,000.00 for design and
construction of our unit) like the CIU may become more
critical. Furthermore, training programs, similar to the
one we have implemented, with emphasis on such practical infection control issues as the proper use of PPE, hand
hygiene, and proper spill cleanup, has broad application.
Other communities might consider the benefits of our approach, whether or not infectious disease research laboratories are constructed in their area.
This work was supported by the NIH Division of Occupational Health and Safety (G.R., N.H., T.A., P.C., D.W.), and the
NIAID Division of Intramural Research (M.B., H.F.).
Dr Risi is in private practice in Missoula, Montana, and is the
president of Infectious Disease Specialists, PC. He is the infectious disease clinical consultant to the Rocky Mountain Laboratories and the infectious disease advisor to the care and isolation unit
of St. Patrick Hospital and Health Sciences Center. His research
interests include clinical management of exposures to and illness
from BSL-3 and BSL-4 agents as well as vaccine development for
select agents and community-acquired infectious diseases.
References
1.
2.
3.
4.
5
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
Peters CJ, Zaki SR. Overview of viral hemorrhagic fevers. In: Guerrant RL, Walker DH, Weller PF, editors. Tropical infectious diseases.
Principles, pathogens, and practice. 2nd ed. Philadelphia: Elsevier
Churchill Livingstone; 2006. p. 726–33.
Wilson DE, Chosewood LC, editors. Biosafety in microbiological
and biomedical laboratories. 5th ed. Washington: US Government
Printing Office; 2007 [cited 2009 Aug 5]. http://www.cdc.gov/od/
ohs/biosfty/bmbl5/bmbl5toc.htm
Paweska JT, Sewlall NH, Ksiazek TG, Blumberg LH, Hale MJ, Lipkin WI, et al. Nosocomial outbreak of novel arenavirus infection,
South Africa. Emerg Infect Dis. 2009;15:1598–602.
Le Duc JW, Anderson K, Bloom ME, Estep JE, Feldmann H, Geisbert JB, et al. Framework for leadership and training of Biosafety
Level 4 laboratory workers. Emerg Infect Dis. 2008;14:1685–8.
DOI: 10.3201/eid1411.080741
Emond RT, Evans B, Bowen ET, Lloyd G. A case of Ebola virus
infection. BMJ. 1977;2:541–4. DOI: 10.1136/bmj.2.6086.541
Formenty P, Hatz C, Le Guenno B, Stoll A, Rogenmoser P, Widmer
A. Human infection due to Ebola virus, subtype Côte d’Ivoire: clinical and biologic presentation. J Infect Dis. 1999;179(Suppl 1):S48–
53. DOI: 10.1086/514285
Akinfeeva A, Akisonova O Vasilevich I, Ginko ZI, Zarkov KA,
Zubavichene NM, et al. A case of Ebola hemorrhagic fever [in Russian]. Infektsionnie Bolezni. 2005;3:85–8.
Falzarano D, Feldmann H. Marburg virus. In: Mahy BW, Regenmortel MH, editors. Encyclopedia of virology, 3rd ed. Oxford (UK):
Elsevier; 2008. p. 272–80.
Subcommittee on Arbovirus Laboratory Safety. Laboratory safety
for arboviruses and certain other viruses of vertebrates. Am J Trop
Med Hyg. 1980;29:1359–81.
Leifer E, Gocke DJ, Bourne H. Lassa fever, a new virus disease of
man from West Africa. II. Report of a laboratory acquired infection
treated with plasma from a person recently recovered from the disease. Am J Trop Med Hyg. 1970;19:676–9.
Centers for Disease Control and Prevention. International notes.
Bolivian hemorrhagic fever—El Beni Department, Bolivia, 1994.
MMWR Morb Mortal Wkly Rep. 1994;43:943–6.
Centers for Disease Control and Prevention. Management of patients
with suspected viral hemorrhagic fever. MMWR Morb Mortal Wkly
Rep. 1988;37:1–15.
Centers for Disease Control and Prevention. Update: management
of patients with suspected viral hemorrhagic fever—United States.
MMWR Morb Mortal Wkly Rep. 1995;44:475–9.
Atkin S, Anaraki S, Gothard P, Walsh A, Brown D, Gopal R, et al.
The first case of Lassa fever imported from Mali to the United Kingdom. Eurosurveillance. 2009;14:1–3.
Centers for Disease Control and Prevention. Imported Lassa
fever—New Jersey, 2004. MMWR Morb Mortal Wkly Rep.
2004;53:894–7.
Haas WH, Breuer T, Pfaff G, Schmitz H, Kohler P, Asper M, et
al. Imported Lassa fever in Germany: surveillance and management of contact persons. Clin Infect Dis. 2003;36:1254–8. DOI:
10.1086/374853
Günther S, Emmerich P, Laue T, Kühle O, Asper M, Jung A, et al.
Imported Lassa fever in Germany: molecular characterization of
a new Lassa virus strain. Emerg Infect Dis. 2000;6:466–76. DOI:
10.3201/eid0605.000504
Richards GA, Murphy S, Jobson R, Mer M, Zinman C, Taylor
R, et al. Unexpected Ebola virus in a tertiary setting: clinical and
epidemiological aspects. Crit Care Med. 2000;28:240–4. DOI:
10.1097/00003246-200001000-00041
Paddock C. CDC confirms first case of Marburg fever in Colorado.
Med News Today. Feb 9, 2009.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
377
PERSPECTIVE
20.
21.
22.
23.
24.
25.
26.
27.
378
Timen A, Koopmans MP, Vossen AC, van Doornum GJ, Gunther
S, van den Berkmortel F, et al. Response to imported case of
Marburg hemorrhagic fever, the Netherlands. Emerg Infect Dis.
2009;15:1171–5. DOI: 10.3201/eid1508.090051
Ergonul O, Zeller H, Celikbas A, Dokuzoguz B. The lack of Crimean-Congo hemorrhagic fever virus antibodies in healthcare workers in an endemic region. Int J Infect Dis. 2007;11:48–51. DOI:
10.1016/j.ijid.2005.10.009
Kortepeter MG, Martin JW, Rusnak JM, Cieslak TJ, Warfield KL,
Anderson EL, et al. Managing potential laboratory exposure to Ebola virus by using a patient Biocontainment care unit. Emerg Infect
Dis. 2008;14:881–7. DOI: 10.3201/eid1406.071489
Jahrling P, Rodak C, Bray M, Davey RT. Triage and management of
accidental laboratory exposures to BioSafety level-3 and -4 agents.
Biosecur Bioterror. 2009;7:1–8.
Department of Occupational Health and Safety, National Institutes of Health [cited 2009 Aug 5]. http://orf.od.nih.gov/PoliciesAndGuidelines/BiomedicalandAnimalResearchFacilitiesDesignPoliciesandGuidelines/policy-index.htm
Collins CH, Kennedy DA. Laboratory-acquired infections. History,
incidence, causes and preventions. 4th ed. Oxford (UK): Butterworth-Heinemann; 1999. p. 1–37.
Rusnak JM, Kortepeter MG, Aldis J, Boudreau E. Experience
in the medical management of potential laboratory exposures to
agents of bioterrorism on the basis of risk assessment at the United States Army Medical Research Institute of Infectious Diseases
(USAMRIID). J Occup Environ Med. 2004;46:801–11. DOI: 10.1097/
01.jom.0000135539.99691.4e
Helmick CG, Webb PA, Scribner CL, Krebs JW, McCormick JB. No
evidence for increased risk of Lassa fever infection in hospital staff.
Lancet. 1986;2:1202–5. DOI: 10.1016/S0140-6736(86)92206-3
28.
29.
30.
31.
32.
33.
34.
Armstrong LR, Dembry LM, Rainey PM, Russi MB, Khan AS, Fischer SH, et al. Management of a Sabiá virus infected patient in a
US hospital. Infect Control Hosp Epidemiol. 1999;20:176–82. DOI:
10.1086/501607
Anderson MG, Frenkel LD, Homann S, Guffey J. A case of severe monkeypox virus disease in an American child: emerging
infections and changing professional values. Pediatr Infect Dis J.
2003;22:1093–8. DOI: 10.1097/01.inf.0000101821.61387.a5
Garrett L. Filth and decay. Pneumonic plague hits India and the
world ill responds. In: Garrett L. Betrayal of trust. The collapse of
global public health. New York: Hyperion; 2000. p. 15–49.
Alexander GC, Wynia MK. Ready and willing? Physicians’ sense of
preparedness for bioterrorism. Health Aff (Millwood). 2003;22:189–
97. DOI: 10.1377/hlthaff.22.5.189
Centers for Disease Control and Prevention. Imported plague—New
York City, 2002. MMWR Morb Mortal Wkly Rep. 2003;52:725–8.
Smith M. Man infected with XDR TB is quarantined in Atlanta. Med
Page Today. 2007 May 29.
Rhodes K. High-containment biosafety laboratories: preliminary observations on the oversight of the proliferation of BSL-3 and BSL-4
laboratories in the United States. GAO testimony before the Subcommittee on Oversight and Investigations, Committee on Energy
and Commerce, House of Representatives, October 4, 2007. GAO08–108T [cited 2009 Aug 6]. http://www.gao.gov/products/GAO-08
-108T
Address for correspondence: George F. Risi, Infectious Disease Specialists,
PC, 614 W Spruce St, Missoula, MT 59802, USA; email: [email protected]
gov
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Bartonella spp. Transmission by
Ticks Not Established
Sam R. Telford III and Gary P. Wormser
Bartonella spp. infect humans and many animal species. Mainly because PCR studies have demonstrated Bartonella DNA in ticks, some healthcare providers believe that
these microorganisms are transmitted by ticks. B. henselae,
in particular, is regarded as being present in and transmissible by the Ixodes scapularis tick. The presence of a microbial agent within a tick, however, does not imply that the
tick might transmit it during the course of blood feeding and
does not confer epidemiologic importance. After a critical
review of the evidence for and against tick transmission, we
conclude that transmission of any Bartonella spp. by ticks,
to animals or humans, has not been established. We are
unaware of any well-documented case of B. henselae transmission by I. scapularis ticks.
I
nfections with Bartonella spp. appear to be widespread
in many animal species besides cats (1). Some evidence
has been advanced in support of the possibility of tick
transmission. Such findings have resulted in diagnostic
testing and empiric therapies directed at B. henselae infection that are of dubious value with respect to illnesses
thought to be caused by deer tick exposure. We critically
examined the reported findings regarding tick transmission of Bartonella spp.
Bartonella spp. are common bacterial hemoparasites
of mammals; for as long as 100 years, 2 species have been
known to cause infections of public health significance.
Trench fever, caused by B. quintana (formerly Rochalimaea
quintana) and transmitted by body lice, affected hundreds
Author affiliations: Tufts University Cummings School of Veterinary
Medicine, North Grafton, Massachussetts, USA (S.R. Telford III);
and New York Medical College, Valhalla, New York, USA (G.P.
Wormser)
DOI: 10.3201/eid1603.090443
of thousands of soldiers or displaced persons during World
War I and to this day affects homeless persons. Oroya fever (and its chronic manifestation verruga peruana), caused
by infection with B. bacilliformis and transmitted by phlebotomine sandflies, is a potentially severe febrile disease.
Although it is geographically restricted to the high altitudes
of the Andes and affects only a relatively small number of
persons, the high case-fatality rate brought attention to this
apparent anthroponosis as early as the late 1800s.
B. henselae causes cat-scratch disease, the most common Bartonella spp. infection in the United States (2). The
hallmark of cat-scratch disease is enlargement and tenderness of lymph nodes draining the site of inoculation of the
microorganism (3). In addition, a skin or mucous membrane
lesion may be observed at the site of inoculation for 25%
to >90% of patients (3,4). Extranodal clinical manifestations (e.g., encephalopathy, neuroretinitis, arthritis, and
lytic bone lesions) occur in ≈10% of patients (3–6). Cats
are the main reservoir of B. henselae. In a study from San
Francisco, 25 (41%) of 61 pet, pound, or stray cats (Felis
domesticus) were found to have B. henselae bacteremia (7).
Bites or scratches from infected cats are associated with
development of cat-scratch disease. The gut of cat fleas is
commonly infected, and exposure to feces of infected fleas
is the presumed route of transmission to uninfected cats and
a possible route of transmission to humans.
Parasitologists focusing on blood parasites have long
noted the ubiquity of Bartonella spp. within mammals, particularly rodents, and by the late 1960s nearly 2 dozen species had been described within the genus Grahamella (8).
The genera Rochalimaea and Grahamella were subsumed
into the genus Bartonella (9), and many of the validly published Grahamella spp. have been excluded from the list of
approved bacterial taxa (10). These actions tended to foster
ignorance of the history of the diversity of Bartonella spp.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
379
PERSPECTIVE
and to promote a fallacy in pathogen discovery (11); namely, if a DNA sequence is not present in GenBank, surely
it must represent something novel, the extensive classical
literature on a likely identical organism known only by
morphology notwithstanding. The significance of such a
fallacy is that a large body of literature that may provide
critical details on the biology of a “novel” agent is completely overlooked or dismissed.
Vector Relationships
Seminal studies by Richard Pearson Strong and the
members of the American Red Cross trench fever commission (12) conclusively demonstrated biological as opposed to mechanical transmission of the trench fever agent
by body lice. Feeding experiments on human volunteers
established that lice may transmit by bite or by fecal contamination of abraded skin; that an infected louse remains
infectious for at least 2 weeks; that the agent is not inherited by the progeny of infected lice; and that transmission
may be extremely efficient, causing trench fever in 75% of
volunteers after 1 exposure to a feeding box containing ≈50
lice that had previously fed on patients with trench fever.
Although initially Oroya fever was epidemiologically
associated with ticks (13), it rapidly became evident that
phlebotomine sandflies (particularly Lutzomyia verrucarum) were the vectors. Sandflies were the only bloodfeeding arthropods that were peridomestic in their habits
and occurred in the “bartonella zone,” >2,000 m elevation.
Experimentally, sandflies acquired infection from bloodsmear positive patients and transmitted infection by bite to
those without evidence of Bartonella spp. infection (14).
Grahamellae (now bartonellae) of rodents have long
been known to be transmitted by fleas (15–17). Such studies have noted the difficulty with which experimental infections may be established by means other than inoculation
of flea homogenates, the persistence within the rectal sac of
the flea, and the likely mode of perpetuation of the bacteria
by larval fleas ingesting dried infected blood. In addition,
grahamellae-infected rodents were noted to exist in the absence of ticks, demonstrating that ticks were not required to
perpetuate these particular bacteria.
Ticks as Vectors
Ticks are notorious vectors of a variety of agents that
cause zoonotic infections (11), including viruses, bacteria,
and protozoans. Like all animals, ticks have a diverse microflora. Recent analyses, using cloning and sequencing
broad-range 16S rDNA amplification products, have documented a large bacterial flora within northeastern populations of Ixodes scapularis ticks that bite humans as nymphs,
hereafter referred to as deer ticks (18,19). Amebas, mycoplasma, fungi, and helminths have been detected in these
ticks by microscopy or other standard methods. However,
380
the presence of a microbial agent within a tick does not imply that the tick might transmit it during the course of blood
feeding or that it is pathogenic.
During early investigations of the causes of Oroya fever, Noguchi (20) demonstrated that B. bacilliformis could
be experimentally transmitted between monkeys by the
bites of Dermacentor andersoni ticks. However, the ticks
that had been fed for a few days on infected monkeys were
removed and allowed to reattach and complete their blood
meal on uninfected animals, which became infected. Noguchi concluded that mechanical transmission had been
demonstrated (perhaps by contamination of mouthparts or
by regurgitation of the infectious partial blood meal), but
persistence of viable bacteria or transstadial passage had
not, and thus ticks were not biologic vectors.
Based on the volume of studies, the most compelling
argument in favor of a tick vector for Bartonella spp. is
that these microorganisms are sometimes detected in fieldcollected ticks (Table 1) (15). Although at least 20 studies
have provided evidence for the presence of Bartonella spp.
in primarily Ixodes spp. ticks collected at various locations
in the United States and Europe, only 1 study has confirmed
the presence of Bartonella spp. by culture (15,21,22). Caution is warranted when interpreting such data, however, because acquisition of Bartonella spp. from animal sources
through a blood meal would be anticipated given the ubiquity of the microorganism in domestic animals and wildlife. In New England, as many as 60% of white-footed mice
are blood-smear positive for Grahamella spp. (now Bartonella), regardless of collection site, including those trapped
within the house of 1 of the authors where a tick life cycle
was not present (S.R. Telford III, unpub. data); prevalence
would probably reach unity if more sensitive modes of detection were used. The mere presence of Bartonella spp.
or their DNA in ticks does not prove vector competence or
Table 1. Reasons that Bartonella species might be transmitted by
ticks
• Certain other arthropods can transmit Bartonella species.
• Seropositivity to B. vinsonii subsp. berkhoffii in dogs correlates
with tick exposure and with seropositivity to other tick-borne
pathogens. Seropositivity to B. henselae in feral cats in the
United Kingdom correlated with seropositivity to Borrelia
burgdorferi.
• Bartonella spp. DNA is present in ticks.
• Cases of B. henselae infection with preceding tick bite have
been reported.
• Transstadial transmission of B. henselae in Ixodes ricinus ticks
and transmission by I. ricinus ticks during a blood meal using
an artificial feeding system have been shown.
• Case control study of cat-scratch disease found a significant
association with having had a tick on the body, but this
association lost statistical significance on a bivariate analysis
controlling for kitten exposure.
• Bartonella spp. are commonly present in Peromyscus
leucopus mice, a major host for deer ticks and a main
reservoir of B. burgdorferi.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Bartonella spp. and Ticks
confer epidemiologic significance (15), but it should serve
as the impetus to rigorously perform the studies necessary
to establish vector competence of ticks. At the least, viability should be established for bartonellae detected within
ticks by means of in vitro cultivation.
To date, no report has documented transmission of
B. henselae or any other Bartonella spp. to an animal after a tick bite (Table 2). The strongest evidence that ticks
might be competent vectors for bartonellae was reported
in a recent study in which I. ricinus ticks were infected
with B. henselae in spiked (artificially infected) ovine
blood by using an artificial feeding system (23). The ticks
maintained infection throughout the molt, thereby establishing transstadial transmission. The experimentally infected ticks were also able to transmit B. henselae during
a subsequent blood meal, again through the artificial feeding system; the dissected salivary glands from such ticks,
when introduced into a cat, produced typical B. henselae infection, proving viability. Serious questions exist,
however, as to whether these experiments are relevant to
establishing vector competence. The ticks were fed continuously on blood meals with 109 CFU/mL, representing
a bacteremia that would rarely be seen in natural infections of cats. Given that Ixodes spp. nymphs ingest a total of ≈15 μL blood (24), each nymph may have ingested
106–107 bacteria, a large dose. In addition, the Houston-1
strain of B. henselae used in this study may not represent
strains found in nature. It is highly adapted to the laboratory and readily grows in vitro, whereas primary isolates
are extremely fastidious and grow slowly.
A more straightforward experiment to establish vector
competence would be to feed an uninfected Ixodes sp. tick
on a B. henselae–infected cat and then, after the tick has
molted, determine whether B. henselae can be transmitted
by tick bite to an uninfected cat. However, even if such
an experiment were to prove vector competence, additional
data would be needed to conclude that Ixodes spp. ticks are
epidemiologically relevant as B. henselae vectors.
Do epidemiologic data that support tick transmission
of Bartonella spp. in animals exist? One study correlated
canine seropositivity to B. vinsonii subsp. berkhoffii with
tick exposure and with seropositivity to other tick-borne
pathogens (25). However, the dogs in that study were
also heavily exposed to fleas, and according to findings
with cats, flea transmission is as likely a possibility as tick
transmission in dogs, if not more so (15,25,26). A study
in the United Kingdom reported an association between
seropositivity to B. henselae and to Borrelia burgdorferi
in feral cats (27). The method used to detect antibodies to
B. burgdorferi was not precisely described. However, the
fact that the rate of seropositivity to B. henselae was nearly
the same for domestic and feral cats, despite domestic cats
having much less tick exposure than feral cats, raises ques-
Table 2. Reasons that transmission of Bartonella henselae by
deer ticks is unlikely or unproven
• Typical cat-scratch disease after a recognized deer tick bite
has not been observed.
• Cat-scratch disease has a different seasonal pattern from that
of Lyme disease.
• Appropriate seroepidemiologic studies have not been done.
• Vector competence of ticks for B. henselae in an animal
system has not been proven.
• No convincing evidence of B. henselae in deer ticks has been
reported.
• The Bartonella species present in Peromyscus leucopus mice
is not B. henselae.
• The US cases with convincing evidence of B. henselae
infection after a tick bite occurred in areas where Lyme
disease is not endemic.
tions about the epidemiologic relevance of tick transmission. In another study, a “novel” Bartonella subspecies
was detected more often in white-footed mice concurrently
infected with the tick-borne pathogens B. burgdorferi or
Babesia microti (1), but this analysis failed to compare the
likelihood that the Bartonella spp. might also commonly
co-occur with rodent trypanosomes, which are maintained
by fleas. Epidemiologic arguments must carefully control
for confounding, and none to date argues convincingly for
tick transmission of Bartonella spp.
Studies of Humans
Certain authors have interpreted their studies as providing epidemiologic support for tick transmission of Bartonella spp. These data are, however, largely anecdotal and
inconclusive (28,29). Culture-confirmed B. henselae infection was reported in 3 US patients who had been bitten by
a tick within a few weeks of onset of illness (28,30); 2 of
these patients had been in contact with a cat and may have
been infected by this animal or its fleas. The tick species
causing the bites was not identified for any of the patients
but was unlikely to have been deer ticks because of the locations (Arkansas, Oklahoma, and probably North Carolina) (30), in which deer tick bites would be rare. Bartonella
spp. have rarely (2 of ≈500 ticks) been detected in Amblyomma americanum ticks, the most common tick species to
parasitize humans in these 3 states (22), but the finding was
based on 1 PCR and not confirmed with a second target or
any other assay.
A more recent study described 3 patients from Europe
for whom a scalp eschar and neck lymphadenopathy were
attributed to tick transmission of B. henselae (31). Molecular detection of the microorganism by PCR of a biopsy
specimen from the eschar, in conjunction with a high serum
antibody titer by immunofluorescence assay, document B.
henselae infection for 2 of the patients; a tick bite at the
lesion site was presumed but not proven for either patient.
Both had been in contact with cats that may well have
transmitted this infection because the clinical features were
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
381
PERSPECTIVE
indistinguishable from those of cat-scratch disease. The
third patient, who had no cat exposure, had a documented
bite from a Dermacentor marginatus tick that had PCR evidence of B. henselae infection. Whether the patient actually
had B. henselae infection is questionable because PCR testing of tissue from the eschar was negative and antibodies to
B. henselae could not be detected by immunofluorescence
assay. The sole stated basis for the diagnosis was a positive Western blot result, but neither the interpretive criteria
used nor the specificity of this testing were provided. When
associated with a documented tick bite, the most common
cause for a scalp eschar and neck lymphadenopathy is Rickettsia slovaca, but other rickettsia and even Francisella tularensis are possible causes, and in at least 25% of cases no
pathogen can be identified (31).
Univariate analysis in a case–control study of catscratch disease in Connecticut found a significant association between having found a tick on the body and catscratch disease (32). This association, however, did not
remain significant on multivariate (bivariate) analysis after
controlling for exposure to kittens.
A 2001 report from New Jersey described 3 patients
believed to have nervous system co-infection with B. henselae and B. burgdorferi (33). The authors suggested that
bartonellae were transmitted by infected deer ticks because
of the co-infection with B. burgdorferi and because the investigators detected B. henselae in a deer tick found in the
household of 1 of these co-infected patients and in several
deer ticks found on the pet cat of a fourth patient believed
to have only B. henselae infection. PCR detection of DNA
of both B. burgdorferi and B. henselae in the cerebrospinal
fluid of these patients was the primary basis for the diagnosis of co-infection. An accompanying editorial, however,
raised concerns about the validity of the diagnosis of both
neuroborreliosis and neurobartonellosis in these patients
(34). The clinical features were atypical for either infection,
and the laboratory test results in support of these infections
showed inconsistencies. In addition, 2 of the 3 authors had
a potential conflict of interest; they were associated with a
commercial laboratory that stood to gain financially from
laboratory testing for B. henselae. The PCRs used by these
investigators and others need careful scrutiny. In a later publication (35), the authors of the original NJ report conceded
that the primers that they had used to amplify B. henselae
DNA were insufficiently specific to warrant the conclusion
that B. henselae was detected. BLAST (www.ncbi.nlm.nih.
gov/blast/Blast.cgi) analysis of their primer P12B demonstrates identity with mouse mitochondrial DNA; also, what
might be amplified if the PCR reaction were not stringent
enough (e.g., lower annealing temperature) is not clear.
In addition, their primer P24E contains a large proportion
of α-proteobacterial 3′ terminus 16S rDNA consensus sequence. Because the specificity of PCR testing depends on
382
target selection and reaction conditions, molecular detection
using current primer sets may identify yet-undescribed genera of environmental bacteria distinct from Bartonella spp.
Future examination of field-collected ticks for Bartonella
spp. DNA should use a minimum of 2 independent PCR
targets, preferably those that include larger portions of phylogenetically informative genes; to demonstrate viability,
Bartonella spp. cultures should be attempted from all DNApositive ticks. The deer ticks were unlikely to have been
actually infected with B. henselae unless one postulates that
feral cats serve as common hosts to larval or nymphal deer
ticks. Indeed, the relatively high prevalence of reported Bartonella spp. infection (35) suggests that these ticks feed on
cats as frequently as they do on mice. Although cats certainly serve as hosts for deer ticks of all stages, their contribution to feeding these vectors relative to all other animals
remains to be defined and is likely to be minimal compared
with rodents or birds. Given how frequently deer ticks feed
on mice, B. vinsonii arupensis (previously known as Grahamella peromysci), which was isolated from a febrile,
encephalopathic patient as well as from a patient who died
from endocarditis, should more commonly infect persons in
Lyme disease–endemic sites. This agent, however, has not
been detected in deer ticks in any survey to date. Nevertheless, that B. henselae infection is a potential deer tick-transmitted co-infection in patients with possible Lyme disease
is still widely accepted by the “chronic Lyme disease” counterculture (i.e., those physicians, patients, and activists who
believe that patients with unexplained subjective symptoms
have chronic B. burgdorferi infection even in the absence of
exposure to a disease-endemic area or credible laboratory
evidence of infection) (36).
Anecdotal accounts of B. henselae co-infection with
B. burgdorferi in patients have been reported from Poland
(37), Russia (29), and North Carolina (38). The report from
North Carolina relied solely on immunoglobulin (Ig) M
seroreactivity to B. burgdorferi to support a diagnosis of
neuroborreliosis (38). The relatively poor specificity of
IgM serologic testing (39) and the fact that the case was
from outside Lyme disease–endemic regions of the United
States raise concerns about the validity of the diagnosis of
B. burgdorferi infection in this patient.
A straightforward approach to address whether B.
henselae is transmitted by deer ticks would be seroepidemiologic studies to compare the prevalence of B. henselae
antibodies in patients with Lyme disease with those in appropriate control groups, but such studies have not been
performed. A study in Slovenia found that only 1 of the 86
children in whom febrile illness developed after a tick bite
had Lyme disease in conjunction with seroconversion for
IgG antibodies to both B. henselae and B. quintana (40).
In the United States alone, >20,000 cases of Lyme
disease and about the same number of cases of cat-scratch
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Bartonella spp. and Ticks
disease occur annually (2). Thus, co-infections may occur
occasionally by chance alone, without cotransmission by a
tick vector. If the bite of a deer tick is a common route for
B. henselae transmission, the absence of reports of the typical lymph node findings of cat-scratch disease proximal to
the bite site of this tick species seems puzzling. The seasonality of cat-scratch disease, in which most cases in temperate regions occur in autumn and early winter (when peak
breeding of cat fleas and birth of kittens occur), provides
further evidence against a major role for ticks in transmission of B. henselae (32).
Conclusion
Tick transmission of any Bartonella spp. to either animals or humans has not been established. B. henselae in particular is unlikely to be transmitted by deer ticks, and, to our
knowledge, no well-documented case of transmission by this
tick species in humans or animals has been reported.
6.
7.
8.
9.
10.
11.
12.
Acknowledgments
We thank Lisa Giarratano and Lenise Banwarie for their
assistance.
S.R.T. is supported by National Institutes of Health RO1
AI 064218.
Dr Telford is an associate professor in the Division of Infectious Diseases at the Cummings School of Veterinary Medicine at
Tufts University. His research interests are related to the evolutionary ecology of tick-transmitted infections, with an emphasis
on tick-pathogen interactions.
Dr Wormser is chief of the Division of Infectious Diseases,
vice chairman of the Department of Medicine, and professor of
medicine and pharmacology at New York Medical College. He
is also chief of the Section of Infectious Diseases at Westchester
Medical Center and director and founder of the Lyme Disease
Diagnostic Center. His main research interests are Lyme disease,
human granulocytic anaplasmosis, and babesiosis.
13.
14.
15.
16.
17.
18.
19.
References
1.
2.
3.
4.
5.
Hofmeister EK, Kolbert CP, Abdulkarim AS, Magera JM, Hopkins
MK, Uhl JR, et al. Cosegregation of a novel Bartonella species with
Borrelia burgdorferi and Babesia microti in Peromyscus leucopus. J
Infect Dis. 1998;177:409–16. DOI: 10.1086/514201
Jackson LA, Perkins BA, Wenger JD. Cat scratch disease in the
United States: an analysis of three national databases. Am J Public
Health. 1993;83:1707–11. DOI: 10.2105/AJPH.83.12.1707
Carithers HA. Cat scratch disease. An overview based on a study of
1,200 patients. Am J Dis Child. 1985;139:1124–33.
Margileth AM, Wear DJ, English CK. Systemic cat-scratch disease:
report of 23 patients with prolonged or recurrent severe bacterial
infection. J Infect Dis. 1987;155:390–402.
Wheeler SW, Wolf SM, Steinberg EA. Cat-scratch encephalopathy.
Neurology. 1997;49:876–8.
20.
21.
22.
23.
Maman E, Bickels J, Ephros M, Paran D, Comaneshter D, MetzkorCotter E, et al. Musculoskeletal manifestations of cat scratch disease. Clin Infect Dis. 2007;45:1535–40. DOI: 10.1086/523587
Koehler JE, Glaser CA, Tappero JW. Rochalimaea henselae infection: a new zoonosis with the domestic cat as a reservoir. JAMA.
1994;271:531–5. DOI: 10.1001/jama.271.7.531
Kreier JP, Ristic M. Haemobartonellosis, eperythrozoonosis, grahamellosis, and ehrlichiosis. In: Weinman D, Ristic M, editors. Infectious blood diseases of man and animals, Vol. II. New York: Academic Press; 1968. p 387–472.
Birtles RJ, Harrison TG, Saunders NA, Molyneux DH. Proposals
to unify the genera Grahamella and Bartonella, with descriptions
of Bartonella talpae comb. nov., Bartonella peromysci comb. nov.,
and three new species, Bartonella grahamii sp. nov., Bartonella taylorii sp. nov., and Bartonella doshiae sp. nov. Int J Syst Bacteriol.
1995;45:1–8.
Skerman VBD, McGowan V, Sneath PHA. Approved lists of bacterial names (amended edition). Washington: American Society for
Microbiology; 1989.
Telford SR, Goethert HK. Emerging and emergent tick borne infections. In: Bowman AS, Nuttall PA, editors. Ticks: biology, disease
and control. New York: Cambridge University Press; 2008. p. 344–
76.
Strong RP, Tyzzer EE, Brues CT, Sellards AW, Gastiaburu JC.
Report of the first expedition to South America, 1913. Cambridge
(MA): Harvard University Press; 1915.
Townsend CHT. The possible and probable etiology and transmission of verruga fever. J Econ Entomol. 1913;6:211–25.
Hertig M. Phlebotomus and Carrión’s disease. Am J Trop Med.
1942;22(suppl):2–81.
Billeter SA, Levy MG, Chronel BB, Breitschwerdt EB. Vector transmission of Bartonella species with emphasis on the potential for
tick transmission. Med Vet Entomol. 2008;22:1–15. DOI: 10.1111/
j.1365-2915.2008.00713.x
Krampitz HE, Kleinschmidt A. Grahamella brumpt. Biologische und morphologische untersuchungen. Z Tropenmed Parasitol.
1911;11:336–52.
Fay FG, Rausch RL. Parasitic organisms in the blood of arvicoline rodents in Alaska. J Parasitol. 1969;55:1258–65. DOI:
10.2307/3277271
Benson MJ, Gawronski JD, Eveleigh DE, Benson DR. Intracellular symbionts and other bacteria associated with deer ticks (Ixodes
scapularis) from Nantucket and Wellfleet, Cape Cod, Massachusetts. Appl Environ Microbiol. 2004;70:616–20. DOI: 10.1128/
AEM.70.1.616-620.2004
Moreno CX, Moy F, Daniels TJ, Godfrey HP, Cabello FC. Molecular analysis of microbial communities identified in different developmental stages of Ixodes scapularis ticks from Westchester and
Dutchess Counties, New York. Environ Microbiol. 2006;8:761–72.
DOI: 10.1111/j.1462-2920.2005.00955.x
Noguchi H. Etiology of Oroyo fever: V. the experimental transmission of Bartonella bacilliformis by ticks (Dermacenter andersoni). J
Exp Med. 1926;44:729–34. DOI: 10.1084/jem.44.5.729
Kruszewska D, Tylewska-Wierzbanowska S. Unknown species of
rickettsiae isolated from Ixodes ricinus tick in Walcz. Rocz Akad
Med Bialymst. 1996;41:129–35.
Billeter SA, Miller MK, Breitschwerdt EB, Levy MG. Detection of
two Bartonella tamiae–like sequences in Amblyomma americanum
(Acari: Ixodidae) using 16S–23S intergenic spacer region–specific
primers. J Med Entomol. 2008;45:176–9. DOI: 10.1603/0022-2585(2008)45[176:DOTBTS]2.0.CO;2
Cotté V, Bonnel S, Le Rhun D, Le Naour E, Chauvin A, Boulouis
HJ, et al. Transmission of Bartonella henselae by Ixodes ricinus.
Emerg Infect Dis. 2008;14:1074–80. DOI: 10.3201/eid1407.071110
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
383
PERSPECTIVE
24.
25.
26.
27.
28.
29.
30.
31.
32.
384
Balashov YS. Blood sucking ticks (Ixodoidea)—vectors of diseases
of man and animals. Miscellaneous publications of the Entomological Society of America. 1972;8:161–376.
Pappalardo BL, Correa MT, York CC, Peat CY, Breitschwerdt EB.
Epidemiologic evaluation of the risk factors associated with exposure and seroreactivity to Bartonella vinsonii in dogs. Am J Vet Res.
1997;58:467–71.
Sreter-Lancz Z, Tornyai K, Szell Z, Sreter T, Marialigeti K. Bartonella infections in fleas (Siphonaptera: Pulicidae) and lack of
bartonellae in ticks (Acari: Ixodidae) from Hungary. Folia Parasitol
(Praha). 2006;53:313–6.
Barnes A, Bell SC, Isherwood DR, Bennett M, Carter SD. Evidence
of Bartonella henselae infection in cats and dogs in the United Kingdom. Vet Rec. 2000;147:673–7.
Lucey D, Dolan MJ, Moss CW, Garcia M, Hollis DG, Wegner S, et
al. Relapsing illness due to Rochalimaea henselae in immunocompetent hosts: implication for therapy and new epidemiologic associations. Clin Infect Dis. 1992;14:683–8.
Morozova OV, Chernovsova NY, Morozov IV. Detection of the Bartonella DNA by the method of nested PCR in patients after tick bites
in Nov-Osibirsk region. Mol Gen Mikrobiol Virusol. 2005;4:14–7.
Breitschwerdt EB, Maggi RG, Nicholson WL, Cherry NA, Woods
CW. Bartonella sp. bacteremia in patients with neurological and
neurocognitive dysfunction. J Clin Microbiol. 2008;46:2856–61.
DOI: 10.1128/JCM.00832-08
Angelakis E, Pulcini C, Waton J, Imbert P, Socolovschi C, Edourard
S, et al. Scalp eschar and neck lymphadenopathy caused by Bartonella henselae after tick bite. Clin Infect Dis. 2010 Jan 13; [Epub
ahead of print].
Zangwill KM, Hamilton DH, Perkins BA, Regnery RL, Plikaytis
BD, Hadler JL, et al. Cat scratch disease in Connecticut. Epidemiology risk factors and evaluation of a new diagnostic test. N Engl J
Med. 1993;329:8–13. DOI: 10.1056/NEJM199307013290102
33.
34.
35.
36.
37.
38.
39.
40.
Eskow E, Rao R-VS, Mordechai E. Concurrent infection of the central nervous system by Borrelia burgdorferi and Bartonella henselae. Evidence for a novel tick-borne disease complex. Arch Neurol.
2001;58:1357–63. DOI: 10.1001/archneur.58.9.1357
Halperin JJ, Wormser GP. Of fleas and ticks on cats and mice….
Arch Neurol. 2001;58:1345–7. DOI: 10.1001/archneur.58.9.1345
Adelson ME, Rao R-VS, Tilton RC, Cabets K, Eskow E, Fein L, et
al. Prevalence of Borrelia burgdorferi, Bartonella species, Babesia
microti and Anaplasma phagocytophila in Ixodes scapularis ticks
collected in northern New Jersey. J Clin Microbiol. 2004;42:2799–
801. DOI: 10.1128/JCM.42.6.2799-2801.2004
Feder HM Jr, Johnson BJ, O’Connell S, Shapiro ED, Steere AC,
Wormser GP et al. A critical appraisal of “chronic Lyme disease.” N
Engl J Med. 2007;357:1422–30. DOI: 10.1056/NEJMra072023
Podsiadly E, Chmielewski T, Tylewska-Wierzbanowska S. Bartonella henselae and Borrelia burgdorferi infections of the central
nervous system. Ann N Y Acad Sci. 2003;990:404–6. DOI: 10.1111/
j.1749-6632.2003.tb07400.x
Gupta PK, Patel R, Bhatti MJ. Neuroretinitis secondary to concurrent infection with cat scratch disease and Lyme disease. Eye (Lond).
2009;23:1607.
Weinstein A. Editorial commentary: laboratory testing for Lyme
disease: time for a change? Clin Infect Dis. 2008;47:196–7. DOI:
10.1086/589316
Arnez M, Luznik-Bufon T, Avsic-Zupanc T, Ruzic-Sabljic E,
Petrovec M, Lotric-Furlan S, et al. Causes of febrile illnesses after a
tick bite in Slovenian children. Pediatr Infect Dis J. 2003;22:1078–
83. DOI: 10.1097/01.inf.0000101477.90756.50
Address for correspondence: Gary P. Wormser, New York Medical College,
Division of Infectious Diseases, Munger Pavilion, Rm 245, Valhalla, NY
10595, USA; email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Potential for Tick-borne
Bartonelloses
Emmanouil Angelakis, Sarah A. Billeter, Edward B. Breitschwerdt, Bruno B. Chomel,
and Didier Raoult
As worldwide vectors of human infectious diseases,
ticks are considered to be second only to mosquitoes.
Each tick species has preferred environmental conditions
and biotopes that determine its geographic distribution, the
pathogens it vectors, and the areas that pose risk for tickborne diseases. Researchers have identified an increasing
number of bacterial pathogens that are transmitted by ticks,
including Anaplasma, Borrelia, Ehrlichia, and Rickettsia
spp. Recent reports involving humans and canines suggest
that ticks should be considered as potential vectors of Bartonella spp. To strengthen this suggestion, numerous molecular surveys to detect Bartonella DNA in ticks have been
conducted. However, there is little evidence that Bartonella
spp. can replicate within ticks and no definitive evidence of
transmission by a tick to a vertebrate host.
artonella spp. are gram-negative bacilli or coccobacilli
that belong to the α-2 subgroup of Proteobacteria. According to 16S rDNA gene comparisons, they are closely
related to the genera Brucella and Agrobacterium (1). A
remarkable feature of the genus Bartonella is the ability
of a single species to cause either acute or chronic infection that can cause either vascular proliferative lesions or
suppurative and granulomatous inflammation. The pathologic response to infection with Bartonella spp. varies
substantially with the status of the host’s immune system;
vasoproliferative lesions are most frequently reported for
immunocompromised patients. To date, 13 Bartonella species and subspecies have been associated with an increas-
B
Author affiliations: Université de la Méditerranée, Marseille, France
(E. Angelakis, D. Raoult); North Carolina State University College
of Veterinary Medicine, Raleigh, North Carolina, USA (S.A. Billeter,
E.B. Breitschwerdt); and University of California School of Veterinary Medicine, Davis, California, USA (B.B. Chomel)
DOI: 10.3201/eid1603.091685
ing spectrum of clinical syndromes in humans, including
cat-scratch disease and chronic bacteremia (B. henselae),
bacillary angiomatosis (B. henselae, B. quintana), peliosis hepatitis (B. henselae), bacteremia and/or endocarditis
(B. henselae, B. quintana, B. elizabethae, B. vinsonii subsp. arupensis, B. vinsonii subsp. berkhoffii, B. koehlerae,
and B. alsatica), Carrión disease (B. bacilliformis), trench
fever (B. quintana), retinitis and uveitis (B. henselae, B.
grahamii), myocarditis (B. vinsonii subsp. berkhoffii, B.
washoensis), splenomegaly (B. bacilliformis, B. henselae,
B. rochalimae), and fever and fatigue (B. henselae, B. vinsonii subsp. berkhoffii, B. tamiae) (1–3).
Ticks
Ticks were first identified as potential vectors of Babesia bigemina, the agent of Texas cattle fever, in 1893 (4).
There are 2 major tick families (≈865 tick species worldwide): the Ixodidae, or hard ticks, characterized by a
sclerotized dorsal plate, and the Argasidae, or soft ticks,
characterized by their flexible cuticle. A third family, the
Nuttalliellidae, is represented by a single species that is
confined to southern Africa. The genus Ixodes, family Ixodidae, contains >200 species, of which 14 make up the I.
ricinus complex (4). Among these 14 species, I. scapularis,
I. pacificus, I. ricinus, and I. persulcatus ticks are involved
in the transmission of the Borrelia burgdorferi complex,
which is a prevalent cause of Lyme disease in persons in
the Northern Hemisphere.
Ticks in various regions of the world are vectors for
bacterial, viral, and protozoal pathogens (5). Ticks may act
not only as vectors but also as reservoirs of tick-transmitted
bacteria that are transmitted transstadially and transovarially in a tick species (e.g., certain Rickettsia spp. and Borrelia spp.) (5). When feeding on an infected small-mammal
host, larvae and nymphs can ingest >1 pathogens while
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
385
PERSPECTIVE
obtaining a blood meal. Some organisms are then passaged
to the next stage in the tick life cycle and can be transmissible during the subsequent blood meal (5). For each tick
species, the optimal environmental conditions determine
the geographic distribution; the spectrum of tick-borne
pathogens; and as a result, the geographic areas of risk for
tick-borne diseases, particularly when ticks are both vectors and reservoirs of specific pathogens.
Hard ticks are the primary vectors of a variety of bacterial pathogens, including Anaplasma spp., Borrelia spp.,
Ehrlichia spp., Coxiella burnetii, and Rickettsia spp (5–7).
Anaplasma phagocytophilum is transmitted by I. persulcatus–complex ticks, including I. scapularis, I. pacificus,
and I. ricinus, whereas Ehrlichia chaffeensis and Ehrlichia
ewingii are transmitted by Amblyomma americanum ticks
(5,6). Although some pathogens are carried by a single or
limited number of tick species, other organisms such as
Coxiella burnetii have been identified in >40 tick species
(7). Lyme disease, caused by B. burgdorferi, is transmitted by I. scapularis and I. pacificus ticks within the United
States, by I. ricinus ticks in Europe, and by other Ixodes
spp. ticks in the Northern Hemisphere (5,8). Although
specific Bartonella spp. are transmitted by blood-sucking
arthropods, including fleas, lice, or sandflies, the only evidence to support the possibility of tick-borne transmission
is indirect.
We present an overview of the various Bartonella spp.
that have been detected in ticks and discuss human cases
of Bartonella infection that are suggestive of tick transmission. Because of the rapidly expanding number of reservoir
host–adapted Bartonella spp. that have been discovered in
recent years, efforts to clarify modes of transmission are
relevant to public health in terms of interrupting the transmission process. As evolving evidence supports the ability of this genus to induce chronic intravascular infections
in humans, improved understanding of vector competence
could facilitate efforts to block pathogen transmission,
which would help improve human health (9).
Host Associations and Specificity
Bartonella spp. have a natural cycle of chronic intravascular infection in a reservoir host and a sustained
pattern of bacterial transmission by a defined and evolutionarily well-adapted vector from the reservoir hosts
to new susceptible hosts. Current information leads to
the presumption of a long-standing and highly adapted
species-specific association between a given Bartonella
sp. and the preferred animal host and vector (10). Inadvertent infection of persons with at least 13 Bartonella
spp. has resulted in a wide spectrum of disease manifestations. After primary infection of the natural mammalian
host, a chronic, relapsing, nonclinical bacteremia occurs.
At times, in wild and stray animal populations, including
386
cats, cows, and various rodent species, the prevalence of
infection within the population can approach 100% (1).
Although the geographic distribution of a specific Bartonella sp. may reflect the geographic distribution of its
hosts or vectors, knowledge related to vector transmission
of Bartonella organisms remains inadequate.
Bartonella spp. DNA in Ticks
As an initial effort to define tick species that might
serve as competent vectors for transmission of Bartonella
spp., molecular epidemiology surveys to identify Bartonella spp. DNA in ticks have been conducted (2). Bartonella
spp. have mostly been identified by PCR using primers targeting either specific Bartonella genes like the citrate synthase gene (gltA) gene, the riboflavin synthase gene, the
heat shock protein gene (groEL), the 16S–23S intergenic
spacer, the heme binding protein gene, and the cell division
protein gene or the 16S rDNA gene (Table 1). Summarized
results indicate that the proportion of ticks harboring Bartonella DNA can vary from low prevalences of 0.43% among
questing A. americanum ticks examined in the southeastern
United States (3) and 1.2% of I. ricinus ticks collected in
the Czech Republic (24) to a prevalence as high as 60%
in I. ricinus ticks from roe deer in the Netherlands (20)
(Table 1). Bartonella spp. from various locations tend to
differ. For example, Bartonella DNA related to B. doshiae,
B. rattimassiliensis, and B. tribocorum has been identified in ticks only in Asia, B. bacilliformis–like DNA and
B. capreoli in ticks only in Europe, and B. washoensis, B.
tamiae–like DNA, and B. vinsonii subsp. berkhoffii in ticks
only in the United States (Figure).
Evidence for Co-infections in Ticks
In recent years, emphasis on the potential transmission
of multiple pathogens by an individual tick after attachment
to an animal or person has grown. While studying different
tick populations throughout the world, several researchers
have identified Bartonella DNA in conjunction with known
tick-transmitted organisms. Adelson et al. tested for the
prevalence of B. burgdorferi, Babesia microti, A. phagocytophilum, and Bartonella spp. in 107 I. scapularis ticks
collected in New Jersey (27). A large percentage of ticks
(45.8%) contained DNA from at least 1 of these organisms, and 34.5% of ticks screened harbored Bartonella spp.
DNA. Of the ticks positive for Bartonella by PCR, 9 (8.4%)
contained B. burgdorferi DNA, 1 (0.9%) contained B. microti DNA, 1 (0.9%) contained A. phagocytophilum DNA,
1 (0.9%) contained both B. burgdorferi and A. phagocytophilum DNA, and 1 (0.9%) contained B. microti and A.
phagocytophilum DNA (27). Although the primers in this
study were originally selected for the species-specific amplification of B. henselae, this region of the Bartonella 16S
rDNA gene is highly conserved among many Bartonella
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Potential for Tick-borne Bartonelloses
spp. In a study performed in France, Halos et al. screened
92 questing I. ricinus ticks and determined that 9.8% contained Bartonella DNA by using gltA-specific primers
(22). Bartonella schoenbuchensis–like DNA (96% homology) was detected in 1 of the adult ticks tested. The authors
also reported that 1% of the ticks contained Bartonella spp.
and B. burgdorferi DNA, 4% contained Bartonella and
Babesia spp. DNA, and 1% contained Bartonella spp., B.
burgdorferi, and Babesia spp. DNA (22). Of 168 questing
adult I. pacificus ticks from Santa Cruz County, California, screened for Bartonella DNA, 11 (6.55%) contained
Table 1. Ticks in which Bartonella spp. DNA has been found*
Prevalence of Bartonella spp.
DNA in ticks, %/no.
Tick genus and species
0.43/466 individuals
Amblyomma americanum
3.2/31 individuals
Carios kelleyi
8.3/12 pools
Dermacentor occidentalis
21.4/84 individuals
D. reticulatus
D. variabilis
Haemaphysalis flava
H. longicornis
H. longicornis
Ixodes nipponensis
I. pacificus
14.3/ 7 pools
2.7/74 pools
4.4/1,173 pools
36/150 groups (60 individual fed
adults, 30 pools of 2 unfed adults,
and 60 pools of 5 nymphs)
5.0/20 pools
19.2 of 151 individuals
I. pacificus
I. persulcatus
11.6/224 pools
37.6/125 individuals
I. persulcatus
44/50 individuals in 2002 and
38/50 individuals in 2003
33.3/3 pools
1.48/271 individuals
4.9/102 individuals
60/121 individuals
A pool/12 ticks
9.8/92 individuals
I. persulcatus
I. ricinus
I. ricinus
I. ricinus
I. ricinus
I. ricinus
B. henselae genotype I DNA (31). Of the Bartonella–positive ticks, 1.19% also harbored B. burgdorferi DNA and
2.98% harbored A. phagocytophilum DNA (31). Loftis et
al. tested Carios kelleyi ticks, argasid tick species found on
bats, from residential and community buildings in Iowa, for
Anaplasma, Bartonella, Borrelia, Coxiella, and Rickettsia
spp. One tick was found to contain Bartonella and Rickettsia DNA, and the DNA sequence was most closely related
to B. henselae (11). Recently, Sun et al. examined Haemaphysalis longicornis and I. sinensis from the People’s Republic of China for Borrelia, Bartonella, Anaplasma, and
Identified Bartonella spp.
B. tamiae–like
Resembling B. henselae
Bartonella spp.
B. henselae (99% homology) and
B. quintana (90% homology)
Bartonella spp.
Bartonella spp.
Bartonella spp.; 1 pool harbored B.
rattimassiliensis (99.2%), 1 pool
harbored B. tribocorum (98.3%)
Bartonella spp.
Target gene
IGS
IGS
gltA
groEL
Reference
(3)
(11)
(12)
(13)
gltA
16S rRNA
16S rRNA
(12)
(14)
(14)
gltA
(15)
Bartonella spp.
B. henselae, B. quintana, B.
washoensis, B. vinsonii subsp.
berkhoffii, and a Bartonella cattle
strain
Bartonella spp.
B. henselae (99% homology) and
B. quintana (90% homology)
B. henselae
16S rRNA
gltA
(14)
(16)
gltA
groEL
(12)
(13)
groEL
(17)
Bartonella spp.
16S rRNA
groEL, pap31, ftsZ
B. henselae
gltA
B. henselae
Bartonella spp
16S rRNA
Bartonella spp
16S rDNA
Bartonella spp.; 1 adult harbored B.
gltA
schoenbuchensis (96% homology)
ITS
B. capreoli
Bartonella spp
16S rRNA
Resembling B. bacilliformis†
(14)
(18)
(19)
(20)
(21)
(22)
I. ricinus
I. ricinus
I. ricinus
7.7/103 individuals
1.2/327 individuals
(23)
(24)
(25)†
I. scapularis
I. scapularis
I. scapularis
2.0/203 individuals
34.5/107 individuals
B. schoenbuchensis
Unidentified Bartonella spp.
B. henselae
gltA
16S rRNA
16S rRNA
(26)
(27)
(28)
I. sinensis
I. spp.
I. turdus
16.3/86 individuals
42.3/26 pools
11.1/9 pools
gltA
16S rRNA
16S rRNA
(15)
(17)
(14)
Rhipicephalus sanguineus
Unidentified tick species
3.2/62 individuals
Bartonella spp.
Bartonella spp.
Bartonella spp.; 1 pool harbored B.
doshiae (99.2% homology)
B. henselae
Bartonella sp.
ribC
IGS
(29)
(30)
*IGS, intergenic spacer; gltA , citrate synthase gene; groEL, heat-shock protein gene; pap31, heme-binding protein gene; ftsZ , cell-division protein gene;
ribC, riboflavin synthase gene.
†Bartonella spp. ascertained by isolation.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
387
PERSPECTIVE
I. pacificus
C. kelleyi
R. sanguineus
I. scapularis
I. ricinus
B. schoenbuchensis
I. nipponensis
H. flava
I. turdus
B. henselae
B. capreoli
B. berkhoffii
B. doshiae
B. bacilliformis
B. henselae
Figure. Worldwide locations of ticks
(blue boxes) identified with Bartonella
spp. (pink boxes). I., ixodes; C., Carios;
R., Rhipicephalus; B., Bartonella; H.,
Haemaphysalis; A., Amblyomma; D.,
Dermacentor.
Bartonella spp.
Bartonella spp.
Bartonella spp.
B. washoensis
B. quintana
B. tamiae
Resembling B. henselae
and B. quintana
B. rattimassiliensis
D. variabilis
D. occidentalis
A. americanum
B. tribocorum
B. henselae
D. reticulatus
I. persulcatus
H. longicornis
Erhlichia spp. (15). Of adult and nymphal H. longicornis
ticks collected in the cities of Benxi and Liaoyang, 36% of
150 groups (60 individual host-associated adults, 30 pools
of 2 questing adults, and 60 pools of 5 nymphs) harbored
detectable Bartonella DNA. Furthermore, 16.3% of 86 individual I. sinensis ticks (all host-associated adults) from
the cities of Tiantai, Jindong, and Jiangshan contained Bartonella DNA. One tick harbored all 4 bacteria (Borrelia,
Bartonella, Anaplasma, and Ehrlichia spp. DNA), and a
second tick pool was positive by PCR for Borrelia, Bartonella, and Ehrlichia spp (15).
Evidence of Potential Tick Bartonella spp.
Transmission to Humans
In 1992, B. henselae infection developed in 2 previously healthy, immunocompetent men within weeks of a
tick bite (32) (Table 2). Both patients reported signs and
symptoms generally associated with B. henselae infection:
fever, muscle and joint pain, headache, and photophobia.
The first patient did not recall being bitten or scratched by
a cat, the general mode of B. henselae transmission to humans. B. henselae organisms were cultured from the blood
of both patients and confirmed by PCR. To our knowledge,
this was the first case report to suggest that ticks may be
responsible for transmission of Bartonella spp. in humans.
More recently, B. henselae was isolated from a boy who
had severe intractable migraine headaches 10 days after an
attached tick was removed from his leg, although on the
basis of seroconversion, infection with B. vinsonii subsp.
berkhoffii was suspected (9). Breitschwerdt et al. concluded
that the boy was either co-infected or chronically infected
with B. henselae, the organism isolated, and subsequently
infected with B. vinsonii subsp. berkhoffii, as reflected by
the documentation of seroconversion.
388
In a clinical study, Zangwill et al. were interested in
identifying risk factors associated with development of
cat-scratch disease (33). The epidemiologic survey, performed in Connecticut, contained 56 cat-scratch disease
patients and their controls (persons who owned or had
been in contact with cats). They used a modified randomdigit dialing technique to recruit controls, and they identified 60 patients with cat-scratch disease. However, of the
60 patients whose illnesses met the case definition, 4 were
not successfully matched with controls for age and cat
ownership; therefore, 56 patients and their controls were
enrolled in the case–control study. The controls did not
differ significantly from the patients by race, sex, family
size, level of maternal education, or socioeconomic status.
Answers to questionnaires suggested that cat-scratch disease was more likely to occur in patients than in controls
if the person owned a kitten, had contact with a kitten with
fleas, or had been bitten or scratched by a kitten. Of the
56 patients, 21% were also more likely than controls to
have been bitten by a tick, although bivariate analysis did
not demonstrate a significant association between tick bite
and cat-scratch disease development (33).
Other case reports have suggested potential human coinfections with Bartonella spp. and a known tick-transmitted organism. Eskow et al. described 4 cases in which patients from central New Jersey reported several neurologic
symptoms, including headache, fatigue, insomnia, and depression, which may have resulted from Lyme disease
(caused by B. burgdorferi) (28). However, other causes for
their cognitive dysfunctions cannot be ruled out. Of these
4 patients, 2 had histories of Lyme disease, and 3 had B.
burgdorferi DNA in the cerebrospinal fluid (CSF). One
patient exhibited no laboratory evidence of Lyme disease,
suggesting that these symptoms might have been caused
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Potential for Tick-borne Bartonelloses
Table 2. Evidence of Bartonella spp. infection in persons after tick bite
Agent
Tick species
Tick bite
Animal contact
Unknown
Yes
No cat
B. henselae
Unknown
Yes
Cat
Unknown
Possibly Ixodes
scapularis
Yes
Yes
Cats and kitten
Not mentioned
B. henselae, B. burgdorferi
Possibly I.
scapularis
Yes
Not mentioned
B. henselae, B. burgdorferi
B. henselae or B. quintana
seroreactive
B. burgdorferi, B.
henselae, B. quintana
Bartonella spp. closely
related to B. henselae, B.
quintana
B. henselae and/or B.
vinsonii subsp. berkhoffii*
Unknown
Unknown
Not mentioned
Yes
Not mentioned
Not mentioned
Clinical manifestation
Fever, myalgia, arthralgia,
headaches, and light
sensitivity
Fever, myalgia, arthralgia,
headaches, and light
sensitivity
Cat-scratch disease signs
Low-grade fever,
headaches, fatigue, knee
arthralgia, and insomnia
Fever, headache,
dizziness, fatigue, and
arthralgia
Meningitis
Fever
Unknown
Yes
Not mentioned
Fever
Unknown
Yes
Unknown
Yes
Unknown
Yes
B. henselae
B. henselae
B. henselae, Borrelia
burgdorferi
B. henselae, and/or B.
vinsonii subsp. berkhoffii†
Cats, dogs,
potentially other
animal species
Cats, dogs,
other animal
species
Fatigue, insomnia,
arthralgia, myalgia,
headache, and/or tremors
Seizures, ataxia, memory
loss, tremors, fatigue,
and/or headaches
Year
1992
Reference
(32)
1992
(32)
1993
2001
(33)
(28)
2001
(28)
2003
2003
(34)
(35)
2003
(35)
2005
(36)
2007
(37)
2008
(9)
*Patients were also seroreactive to B. henselae and/or B. vinsonii subsp. berkhoffii.
†Patients were also seroreactive to B. henselae, B. vinsonii subsp. berkhoffii, and/or B. quintana.
by an agent other than B. burgdorferi. However, 2 patients
reported illness within 1 week to 3 months after being bitten by a tick. Upon further investigation, all patients were
seroreactive to B. henselae; immunofluorescence assay
showed immunoglobulin (Ig) G titers of 64–256. According to the authors, B. henselae DNA was amplified from
blood of 1 patient, from CSF of 1 patient, and from both
blood and CSF of the other 2 patients (B. burgdorferi DNA
also was detected in the CSF of these 2 patients). Ticks,
identified as I. scapularis, found in 2 patients’ homes potentially harbored both B. henselae and B. burgdorferi
DNA. Whether B. henselae was specifically detected in this
case series is unclear because sequencing of amplicons was
not performed and because the PCR primer set targeted the
Bartonella 16S rRNA, a highly conserved region. Without
sequencing of amplicons or confirmation of results by targeting a more highly variable gene, ascertaining whether B.
henselae was present in the ticks or in the patients would
be difficult. However, the results derived from these cases
are of interest because, to our knowledge, this was the first
case series to propose simultaneous detection of both B.
burgdorferi and Bartonella DNA in the CSF of patients
with neurologic signs.
In another study, 2 of 17 patients from Poland with
symptoms suggestive of neuroborreliosis seemed to be
co-infected with B. burgdorferi and B. henselae (34). B.
burgdorferi–specific antibodies were detected in a patient
whose CSF also had detectable B. henselae DNA. The
other patient was seroreactive to both B. burgdorferi and
B. henselae antigens at titers of 32. The authors speculated
that co-infection may be tick transmitted; however, contact with other arthropod species should be considered.
Although the detection of B. henselae DNA in the CSF of
these patients could be attributed to amplification of DNA
from nonviable organisms or to laboratory error, the repeated documentation of B. henselae in blood and in CSF
of a young woman with a previous diagnosis of classical
cat-scratch disease support the potential that this bacterium
can cause chronic intravascular and central nervous system
infections in immunocompetent persons (9).
In a study performed in Slovenia, 86 febrile children
were screened for serologic evidence of exposure to multiple tick-borne organisms within 6 weeks of a known tick
bite (35). Acute- and convalescent-phase serum samples
were collected from each child. Prior exposure was determined for 5 children who harbored B. henselae IgG and for
4 children who harbored B. quintana IgG. Seroconversion
of IgG to both antigens was detected for only 1 child (35).
Morozova et al. tested for Bartonella DNA in persons from
the Novosibirsk region of Russia who had been bitten by
ticks during the summers of 2003 and 2004 (38). Bartonella DNA closely related to B. henselae and B. quintana
was detected in the blood of some patients by using groELspecific primers (36). A more recent study, performed by
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
389
PERSPECTIVE
Breitschwerdt et al., screened 42 immunocompetent patients, who had had prior animal and arthropod contact, for
Bartonella spp. (37) The study included 12 women and 2
men who reported having had occupational animal contact for >10 years, including frequent animal bites, animal
scratches, and arthropod exposure (e.g., fleas, ticks, biting
flies, mosquitoes, lice, mites, chiggers). B. henselae or B.
vinsonii subsp. berkhoffii were detected by PCR or were
cultured from all patients (37). Case studies and surveys
of this type suggest that ticks may serve as competent vectors of Bartonella spp., but this supposition cannot be confirmed until experimental studies demonstrating successful
transmission have been performed.
Recently, Cotté et al. detailed the potential transmission of B. henselae by I. ricinus ticks (38). Using an artificial feeding platform made of rabbit skin, the authors
successfully (based on PCR screening) infected ticks with
B. henselae of molted ticks previously fed infected blood,
suggesting that transstadial transmission may be possible.
Subsequently, molted ticks were placed onto rabbit skins
and fed noninfected blood, after which B. henselae was either cultured or detected by PCR analysis within 72 hours
of when aliquots were taken from the previously noninfected blood. This finding indicates that during a blood
meal, the organism could potentially be transferred from
an infected tick to a noninfected individual. In addition, B.
henselae bacteria were also present within molted ticks in
sufficient numbers to cause bacteremia when tick salivary
gland extracts were inoculated intravenously into domestic
cats. Because ticks were not allowed to attach directly to
the cats, this study supports, but does not prove, tick transmission of B. henselae by I. ricinus. Consistent with the
transmission of Bartonella spp. by other arthropods such
as fleas and lice, B. henselae does not seem to be transovarially transmitted in ticks because larvae hatched from
B. henselae–positive (by PCR) egg clutches did not harbor
detectable Bartonella DNA (2,38).
Conclusions
The number of zoonotic Bartonella spp. identified in
the past 15 years has increased considerably. This review
indicates that a diversity of Bartonella spp. DNA can be
amplified from various tick species from numerous geographic locations, that tick attachment has preceded the
onset of illness in a small number of patients from whom
B. henselae DNA has been amplified, and that serologic
and molecular evidence suggests cosegregation of Bartonella spp. with known tick-borne pathogens. Therefore,
ticks might serve as potential Bartonella vectors. However,
there is little evidence that Bartonella spp. can replicate
within ticks and no definitive evidence of transmission by a
tick to a vertebrate host. Only Kruszewska and TylewskaWiezbanowska reported successful isolation of Bartonella
390
sp. from a tick (25); all other studies were based on amplification of Bartonella DNA from ticks by using PCR. As
the medical relevance of the genus Bartonella continues to
evolve, it is clearly necessary to determine whether ticks or
other arthropods play a role in the transmission of Bartonella spp. among animals and humans. For this reason, experimental transmission studies, using infected ticks placed
on live animals, are required to determine whether ticks are
vector competent for the transmission of Bartonella spp.
Addendum
Since the submission of this manuscript, we found 3
cases of B. henselae infection transmitted by Dermancentor spp. ticks. These patients had scalp eschar and neck
lymphadenopathy (39).
Dr Angelakis is a clinician and researcher at the Unité des
Rickettsies in Marseille. His research interests are zoonotic pathogens.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
Rolain JM, Brouqui P, Koehler JE, Maguina C, Dolan MJ, Raoult D.
Recommendations for treatment of human infections caused by Bartonella species. Antimicrob Agents Chemother. 2004;48:1921–33.
DOI: 10.1128/AAC.48.6.1921-1933.2004
Billeter SA, Levy MG, Chomel BB, Breitschwerdt EB. Vector transmission of Bartonella species with emphasis on the potential for
tick transmission. Med Vet Entomol. 2008;22:1–15. DOI: 10.1111/
j.1365-2915.2008.00713.x
Billeter SA, Miller MK, Breitschwerdt EB, Levy MG. Detection of
two Bartonella tamiae–like sequences in Amblyomma americanum
(Acari: Ixodidae) using 16S–23S intergenic spacer region–specific
primers. J Med Entomol. 2008;45:176–9. DOI: 10.1603/0022-2585(2008)45[176:DOTBTS]2.0.CO;2
Swanson SJ, Neitzel D, Reed KD, Belongia EA. Coinfections acquired from Ixodes ticks. Clin Microbiol Rev. 2006;19:708–27.
DOI: 10.1128/CMR.00011-06
Parola P, Raoult D. Ticks and tickborne bacterial diseases in humans:
an emerging infectious threat. Clin Infect Dis. 2001;32:897–928.
DOI: 10.1086/319347
Inokuma H. Vector and reservoir hosts of Anaplasmataceae. In:
Rickettsial diseases. Infectious Diseases and Therapy Series.
2007;42:199–212.
Maurin M, Raoult D. Q fever. Clin Microbiol Rev. 1999;12:518–53.
Hildenbrand P, Craven DE, Jones R, Nemeskal P. Lyme neuroborreliosis: manifestations of a rapidly emerging zoonosis. AJNR Am J
Neuroradiol. 2009;30:1079–87. DOI: 10.3174/ajnr.A1579
Breitschwerdt EB, Maggi RG, Nicholson WL, Cherry NA, Woods
CW. Bartonella sp. bacteremia in patients with neurological and
neurocognitive dysfunction. J Clin Microbiol. 2008;46:2856–61.
DOI: 10.1128/JCM.00832-08
Houpikian P, Raoult D. Molecular phylogeny of the genus Bartonella: what is the current knowledge? FEMS Microbiol Lett.
2001;200:1–7. DOI: 10.1111/j.1574-6968.2001.tb10684.x
Loftis AD, Gill JS, Schriefer ME, Levin ML, Eremeeva ME, Gilchrist MJ, et al. Detection of Rickettsia, Borrelia, and Bartonella in
Carios kelleyi (Acari: Argasidae). J Med Entomol. 2005;42:473–80.
DOI: 10.1603/0022-2585(2005)042[0473:DORBAB]2.0.CO;2
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Potential for Tick-borne Bartonelloses
12
13.
14
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Chang CC, Hayashidani H, Pusterla N, Kasten RW, Madigan JE,
Chomel BB. Investigation of Bartonella infection in ixodid ticks
from California. Comp Immunol Microbiol Infect Dis. 2002;25:229–
36. DOI: 10.1016/S0147-9571(02)00012-7
Rar VA, Fomenko NV, Dobrotvorsky AK, Livanova NN, Rudakova
SA, Fedorov EG, et al. Tickborne pathogen detection, western Siberia, Russia. Emerg Infect Dis. 2005;11:1708–15.
Kim CM, Kim JY, Yi YH, Lee MJ, Cho MR, Shah DH, et al. Detection of Bartonella species from ticks, mites and small mammals in
Korea. J Vet Sci. 2005;6:327–34.
Sun J, Liu Q, Lu L, Ding G, Guo J, Fu G, et al. Coinfection with four
genera of bacteria (Borrelia, Bartonella, Anaplasma, and Ehrlichia)
in Haemaphysalis longicornis and Ixodes sinensis ticks from China.
Vector Borne Zoonotic Dis; 2008;8:791–5.
Chang CC, Chomel BB, Kasten RW, Romano V, Tietze N. Molecular
evidence of Bartonella spp. in questing adult Ixodes pacificus ticks
in California. J Clin Microbiol. 2001;39:1221–6. DOI: 10.1128/
JCM.39.4.1221-1226.2001
Morozova OV, Cabello FC, Dobrotvorsky AK. Semi-nested PCR
detection of Bartonella henselae in Ixodes persulcatus ticks from
western Siberia, Russia. Vector Borne Zoonotic Dis. 2004;4:306–9.
DOI: 10.1089/vbz.2004.4.306
Sanogo YO, Zeaiter Z, Caruso G, Merola F, Shpynov S, Brouqui P,
et al. Bartonella henselae in Ixodes ricinus ticks (Acari: Ixodida)
removed from humans, Belluno Province, Italy. Emerg Infect Dis.
2003;9:329–32.
Podsiadly E, Chmielewski T, Sochon E, Tylewska-Wierzbanowska S. Bartonella henselae in Ixodes ricinus ticks removed from
dogs. Vector Borne Zoonotic Dis. 2007;7:189–92. DOI: 10.1089/
vbz.2006.0587
Schouls LM, Van de Pol I, Rijpkema SGT, Schot CS. Detection
and identification of Ehrlichia, Borrelia burgdorferi sensu lato, and
Bartonella species in Dutch Ixodes ricinus ticks. J Clin Microbiol.
1999;37:2215–22.
Schabereiter-Gurtner C, Lubitz W, Rolleke S. Application of
broad-range 16S rRNA PCR amplification and DGGE fingerprinting for detection of tick-infecting bacteria. J Microbiol Methods.
2003;52:251–60. DOI: 10.1016/S0167-7012(02)00186-0
Halos L, Jamal T, Maillard R, Beugnet F, Le Menach A, Boulouis
HJ, et al. Evidence of Bartonella sp. in questing adult and nymphal
Ixodes ricinus ticks from France and co-infection with Borrelia
burgdorferi sensu lato and Babesia sp. Vet Res. 2005;36:79–87.
DOI: 10.1051/vetres:2004052
Bogumila S, Adamska M. Capreolus capreolus and Ixodes ricinus
as a reservoir of Bartonella in northwestern Poland [in Polish]. Wiad
Parazytol. 2005;51:139–43.
Hercík K, Hásová V, Janecek J, Branny P. Molecular evidence of
Bartonella DNA in ixodid ticks in Czechia. Folia Microbiol (Praha).
2007;52:503–9. DOI: 10.1007/BF02932111
Kruszewska D, Tylewska-Wierzbanowska S. Unknown species of
rickettsiae isolated from Ixodes riconus tick in Walcz. Rocz Akad
Med Bialymst. 1996;41:129–135.
Matsumoto K, Berrada ZL, Klinger E, Goethert HK, Telford SR
III. Molecular detection of Bartonella schoenbuchensis from ectoparasites of deer in Massachusetts. Vector Borne Zoonotic Dis.
2008;8:549–54. DOI: 10.1089/vbz.2007.0244
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
Adelson ME, Rao RV, Tilton RC, Adelson ME, Rao RV, Tilton RC,
et al. Prevalence of Borrelia burgdorferi, Bartonella spp., Babesia
microti, and Anaplasma phagocytophila in Ixodes scapularis ticks
collected in northern New Jersey. J Clin Microbiol. 2004;42:2799–
801. DOI: 10.1128/JCM.42.6.2799-2801.2004
Eskow E, Rao RV, Mordechai E. Concurrent infection of the central nervous system by Borrelia burgdorferi and Bartonella henselae: evidence for a novel tick-borne disease complex. Arch Neurol.
2001;58:1357–63. DOI: 10.1001/archneur.58.9.1357
Wikswo ME, Hu R, Metzger ME, Eremeeva ME. Detection of
Rickettsia rickettsii and Bartonella henselae in Rhipicephalus sanguineus ticks from California. J Med Entomol. 2007;44:158–62.
DOI: 10.1603/0022-2585(2007)44[158:DORRAB]2.0.CO;2
Parola P, Shpynov S, Montoya M, Lopez M, Houpikian P, Zeaiter Z,
et al. First molecular evidence of new Bartonella spp. in fleas and a
tick from Peru. Am J Trop Med Hyg. 2002;67:135–6.
Holden K, Boothby JT, Kasten RW, Chomel BB. Co-detection of
Bartonella henselae, Borrelia burgdorferi, and Anaplasma phagocytophilum in Ixodes pacificus ticks from California, USA. Vector
Borne Zoonotic Dis. 2006;6:99–102. DOI: 10.1089/vbz.2006.6.99
Lucey D, Dolan MJ, Moss CW, Garcia M, Hollis DG, Wegner S,
et al. Relapsing illness due to Rochalimaea henselae in immunocompetent hosts: implication for therapy and new epidemiological
associations. Clin Infect Dis. 1992;14:683–8.
Zangwill KM, Hamilton DH, Perkins BA, Regnery RL, Plikaytis
BD, Hadler JL, et al. Cat scratch disease in Connecticut. Epidemiology, risk factors, and evaluation of a new diagnostic test. N Engl J
Med. 1993;329:8–13. DOI: 10.1056/NEJM199307013290102
Podsiadly E, Chmielewski T, Tylewska-Wierzbanowska S. Bartonella henselae and Borrelia burgdorferi infections of the central
nervous system. Ann N Y Acad Sci. 2003;990:404–6. DOI: 10.1111/
j.1749-6632.2003.tb07400.x
Arnez M, Luznik-Bufon T, Avsic-Zupanc T, Ruzic-Sabljic E, Petrovec M, Lotric-Furlan S, et al. Causes of febrile illnesses after a tick
bite in Slovenian children. Pediatr Infect Dis J. 2003;22:1078–83.
DOI: 10.1097/01.inf.0000101477.90756.50
Morozova OV, Chernousova NI, Morozov IV. Detection of the Bartonella DNA by the method of nested PCR in patients after tick bites
in Novosibirsk region [in Russian]. Mol Gen Mikrobiol Virusol.
2005;4:14–7.
Breitschwerdt EB, Maggi RG, Duncan AW, Nicholson WL, Hegarty
BC, Woods CW. Bartonella species in blood of immunocompetent persons with animal and arthropod contact. Emerg Infect Dis.
2007;13:938–41.
Cotté V, Bonnet S, Le-Rhun D, Le Naour E, Chauvin A, Boulouis
HJ, et al. Transmission of Bartonella henselae by Ixodes ricinus.
Emerg Infect Dis. 2008;14:1074–80. DOI: 10.3201/eid1407.071110
Angelakis E, Pulcini C, Waton J, Imbert P, Socolovschi C, Edouard
S, et al. Scalp eschar and neck lymphadenopathy caused by Bartonella henselae after tick bite. Clin Infect Dis. 2010 Jan 13; [Epub
ahead of print].
Address for correspondence Didier Raoult, Unité des Rickettsies, CNRS
UMR 6020, IFR 48, Faculté de Médecine, Université de la Méditerranée,
27 Blvd Jean Moulin, 13385 Marseille CEDEX 05, France; email: didier.
[email protected]
Search past issues of EID at www.cdc.gov/eid
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
391
RESEARCH
Serologic Markers for Detecting
Malaria in Areas of Low Endemicity,
Somalia, 2008
Teun Bousema, Randa M. Youssef, Jackie Cook, Jonathan Cox, Victor A. Alegana, Jamal Amran,
Abdisalan M. Noor, Robert W. Snow, and Chris Drakeley
Areas in which malaria is not highly endemic are suitable
for malaria elimination, but assessing transmission is difficult because of lack of sensitivity of commonly used methods. We evaluated serologic markers for detecting variation
in malaria exposure in Somalia. Plasmodium falciparum or
P. vivax was not detected by microscopy in cross-sectional
surveys of samples from persons during the dry (0/1,178)
and wet (0/1,128) seasons. Antibody responses against P.
falciparum or P. vivax were detected in 17.9% (179/1,001)
and 19.3% (202/1,044) of persons tested. Reactivity against
P. falciparum was significantly different between 3 villages
(p<0.001); clusters of seroreactivity were present. Distance
to the nearest seasonal river was negatively associated with
P. falciparum (p = 0.028) and P. vivax seroreactivity (p =
0.016). Serologic markers are a promising tool for detecting
spatial variation in malaria exposure and evaluating malaria
control efforts in areas where transmission has decreased
to levels below the detection limit of microscopy.
S
ub-Saharan Africa has the highest incidence of malaria
caused by Plasmodium falciparum. Almost all areas
where P. falciparum parasite prevalence is >50% in the
general population are located in Africa (1). However, maAuthor affiliations: London School of Hygiene and Tropical Medicine, London, UK (T. Bousema, J. Cook, J. Cox, C. Drakeley);
University of Alexandria, Alexandria, Egypt (R.M. Youssef); Kenya
Medical Research Institute–Wellcome Trust Research Programme,
Nairobi, Kenya (R.M. Youssef, V.A. Alegana, J. Amran, A.M. Noor,
R.W. Snow); Roll Back Malaria–World Health Organization, Hargeisa, Somalia (J. Amran); and University of Oxford, Oxford, UK
(A.M. Noor, R.W. Snow)
DOI: 10.3201/eid1603.090732
392
laria is not uniformly distributed (1,2) and many parts of
Africa are characterized by low transmission intensity of
malaria (1). These areas are considered suitable for intensive malaria control and disease elimination (3,4).
Assessing malaria transmission intensity and evaluating interventions are complicated at low levels of malaria
transmission. Assessing transmission intensity directly by
determining the exposure to malaria-infected mosquitoes
(entomologic inoculation rate [EIR]) is difficult when mosquito numbers are low, sometimes below the detection limits of commonly used trapping methods (5,6), and spatial
and temporal variations in mosquito densities necessitate
long-term intensive sampling (5,7,8). Determination of malaria parasite prevalence in the human population is a commonly used alternative (9), but it also becomes less reliable
as an indicator of transmission intensity when endemicity
is low (3,9,10). Therefore, an alternative method is needed
to assess transmission intensity, evaluate interventions, and
obtain information for control programs in areas of low endemicity.
Prevalence of antibodies against malaria parasites has
been explored as a means of assessing malaria transmission intensity (11–13). Antibody seroconversion rates are
less susceptible to seasonal fluctuations in malaria exposure (11,12), show a tight correlation with EIR (12,13), and
show potential to detect recent changes in malaria transmission intensity (14). Serologic markers could be particularly
useful in areas of low endemicity, where it may be easier to
detect relatively long-lasting antibody responses than a low
prevalence of malaria infections in the human population or
infected mosquitoes. We used serologic markers of exposure to determine spatial variation in malaria transmission
intensity in an area of low endemicity in Somalia (15).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Serologic Markers for Detecting Malaria
Methods
Study Area
This study was conducted in the Gebiley District in
Somaliland in northwestern Somalia. The district has a predominantly arid landscape with a few seasonal rivers and
patches of irrigated farmlands. It is an area of intense seasonal rainfall with an average annual precipitation of 59.9
mm (2004–2007) and 2 peaks in rainfall in April and August. Three moderately sized communities were randomly
selected from census maps by using spatial random sampling
techniques in Arcview version 3.2 (Environmental Systems
Research Institute, Redlands, CA, USA) (16). These communities were the villages of Xuunshaley (9.72140°N,
43.42416°E), Badahabo (9.68497°N, 43.65616°E), and
Ceel-Bardaale (9.81777°N, 43.47455°E). The research
protocol was reviewed and approved by the Research Ethics Review Committee of the World Health Organization
(RPC246-EMRO) and the Ethical Committee of the Ministry of Health and Labor, Republic of Somaliland.
Data Collection
Two cross-sectional surveys were conducted. The first
survey was conducted in March 2008 to determine parasite
carriage at the end of the dry season (16). The purpose of
the survey and the procedures were first discussed with the
clan elders; thereafter, each household was visited, and informed consent was sought from each head of household.
Households that agreed to participate were geolocated by
using a global positioning system (Garmin eTrex; Garmin
International, Inc., Olathe, KS, USA), and information was
collected on demographic characteristics, bed net use, and
travel history of the participants. Distance to seasonal rivers
or other water bodies and distance to the nearest livestock
enclosure was determined by using the global positioning
system.
Individual written consent was obtained from all literate adults; illiterate adults provided consent by a thumbprint
in the presence of an independent literate adult witness.
For children <18 years of age, consent was obtained from
parents or guardians, and children 12–18 years of age who
could not write also provided consent by a thumb print.
One fingerprick blood sample was obtained from each
respondent for the preparation of a P. falciparum antigen–
specific rapid diagnostic test (RDT) (Paracheck-Pf; Orchid
Biomedical Systems, Goa, India) sample and thick and thin
blood smears. One-hundred high-power microscopic fields
were examined and an additional 100 fields were examined if the first 100 fields were negative. RDT results were
used for treatment with sulfadoxine-pyrimethamine and 3
doses of artesunate according to national guidelines. A second cross-sectional survey was conducted at the end of the
wet season (August–September 2008) by using procedures
identical to those described above, except that part of the
fingerprick blood sample was placed on filter paper (3 MM;
Whatman, Maidstone, UK) as described by Corran et al.
(17).
Entomologic Surveys
Presence of Anopheles spp. mosquitoes in the area was
determined by larvae collections in all permanent water
bodies (artificial rain water reservoirs, wells, boreholes,
stagnant storage pits, and riverbeds) in the 3 villages at the
end of the wet season. Locally produced 250-mL dippers
with a white surface were used. Five to 10 dips were made
in the large water bodies and the presence of Anopheles
spp. larvae was visually assessed and recorded.
Elution of Serum
Filter paper samples were stored at 4°C with desiccant
until processed. A 3.5-mm blood spot, equivalent to ≈3 μL
of blood (17), was punched from the filter paper and placed
in a labeled well of a low-binding 96-well titer plate. A total of 300 μL of reconstitution buffer (phosphate-buffered
saline [PBS], 0.05%Tween, and 0.1% [wt/vol] sodium azide) was added, and plates were sealed and rocked gently
at room temperature overnight and subsequently stored at
4°C. The reconstituted blood spot solution was equivalent
to a 1:100 dilution of whole blood or a 1:200 dilution of
serum.
ELISAs
All reconstituted filter paper spots were tested at a
final serum dilution equivalent of 1:1,000 for human immunoglobulin G antibodies against P. falciparum merozoite surface protein 119 (MSP-119) and 1:2,000 for antibodies against apical membrane antigen 1 (AMA-1) by
using described ELISA methods (12,17). Briefly, recombinant MSP-119 (Wellcome genotype) and AMA-1 (3D7)
were coated overnight at 4°C at a concentration of 0.5 μg/
mL. Plates were washed by using PBS, 0.05% Tween 20
(PBS/T) and blocked for 3 h with 1% (wt/vol) skim milk
powder in PBS/T. Positive controls (a pool of hyperimmune serum) and negative controls (European malarianegative volunteers) were added in duplicate to each plate.
The plates were washed and horseradish peroxidase–conjugated rabbit anti-human immunoglobulin G (Dako, Roskilde, Denmark) (1:5,000 dilution in PBS/T) was added to
all wells. Plates were developed for 20 min by using an
o-phenylenediamine dihydrochloride substrate solution.
Reactions were stopped with 2 mol/L H2SO4. Plates were
read immediately at 492 nm and optical density (OD) values recorded. For P. vivax, an identical protocol was used
with MSP-119 (0. 5 μg/mL) (18) and AMA-1 (0. 5 μg/mL).
Serum in this protocol was used at 1:1,000 dilutions for
both antigens.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
393
RESEARCH
Data Management and Statistical Analyses
Data were double-entered and imported into STATA
version 10 (StataCorp LP, College Station, TX, USA). Duplicate OD results were averaged and normalized against
the positive control sample on each plate. A cutoff value
above which samples were considered antibody positive
was defined by using a mixture model as described (17).
Distribution of normalized OD values was fitted as the sum
of 2 Gaussian distributions by using maximum-likelihood
methods. The mean OD of the Gaussian distribution corresponding to the seronegative population plus 3 SD values was used as the cutoff value for seropositivity (J. Cook
et al., unpub. data). A separate cutoff value was generated
for each antigen (MSP-119 and AMA-1) for each species
(P. vivax and P. falciparum). The seroconversion rate was
estimated by fitting a simple reversible catalytic model to
the measured seroprevalence by age in years by using maximum-likelihood methods. The serologic-derived annual
EIR was then estimated by using the MSP-119 seroconversion rate and a calibration curve derived from determined
values (11).The titer of antibody responses was estimated
by using the formula dilution/[maximum OD/(OD test serum – minimum OD) – 1]; the median titer and interquartile
range (IQR) are given. Because of low overall antibody
prevalence, antibody responses were combined by species
to determine the presence of any reactivity against P. falciparum or P. vivax. As a quantitative measure of reactivity
to either malaria species, the highest titer in the MSP-119
and AMA-1 ELISAs was used.
Factors associated with P. falciparum or P. vivax seroreactivity were determined for each village separately by
using generalized estimating equations adjusting for correlation between observations from the same household. The
following factors were tested in the models: age in years,
distance to the nearest seasonal river (in 100 m), distance
to the nearest enclosure of livestock (in 100 m), number of
household members, number of houses in a 100-m radius,
roofing material, wall material, floor material, travel history, recent or regular bed net use, and an indicator of household wealth. The household wealth index was calculated on
the basis of principal component analysis on characteristics
such as ownership of a television, radio, telephone, bicycle,
motorbike, cattle, and access to electricity (19). Variables
that were significant at p = 0.10 in univariate analyses were
added to the multivariate model and retained in the final
multivariate model if their association with immune responses was statistically significant at p<0.05.
For detection of spatial clusters in immune responses,
age-adjusted log10-transformed ODs were calculated as described by Wilson et al (20). First, Loess lines were fitted to
scatter plots of age against log-transformed ODs for each
antigen separately. For P. falciparum MSP-119 and P. vivax
AMA-1, the linear regression was split at 49 and 46 years of
394
age. Log-transformed ODs were adjusted for age by linear
regression. SaTScan software (21) was used for detection
of spatial clustering in log-transformed age-adjusted OD
values by using the normal probability model. A circularshaped window was used to systematically scan the area of
each village separately; statistical significance of the clusters was explored by using 999 Monte Carlo replications to
ensure adequate power for defining clusters. The upper limit
was specified as 50% of the village population. Significant
increases in ODs were detected by calculation of the likelihood ratio for each window. Only clusters were reported
that appeared for MSP-119, AMA-1, and their combined
age-adjusted ODs. Maps were made by using ArcGIS version 9.1 (Environmental Systems Research Institute).
Results
The 2 cross-sectional surveys were completed in
March (dry season, n = 1,178) and August–September (wet
season, n = 1,128) 2008. These surveys were characterized
by a clear seasonality with no rainfall detected during November 2007–March 2008 and a median monthly rainfall
of 114.5 mm in April–August 2008. None of the survey
participants were positive by rapid diagnostic test, and P.
falciparum or P. vivax parasites were not detected on any
of the examined blood slides (Table 1). Available hospital
records indicated 2/283 slide-confirmed, RDT-confirmed
malaria cases in the study area in July and August 2008
(T. Bousema, unpub. data). Travel history was not available for these persons. During August–September 2008, a
total of 464 potential breeding sites were examined in Xuunshaley (n = 40), Badahabo (n = 42), and Ceel-Bardaale (n
= 382). In Ceel-Bardaale, 158 Anopheles mosquito larvae
were found at 81 of 382 examined sites. In the 2 other villages, no Anopheles larvae were observed.
Malaria Exposure Assessed by Immunologic Methods
In August–September 2008, serum samples were collected from 1,128 persons in Xuunshaley (n = 271), Badahabo (n = 160), and Ceel-Bardaale (n = 697) (Table 2).
In the 3 months before the survey, 19 persons reported
having traveled to areas that are known to have higher
malaria endemicity for a median of 4 (IQR 2–20) days.
Persons who reported traveling to areas highly endemic
for malaria were more likely to have a positive response
to P. falciparum (odds ratio [OR] 2.62, 95% confidence
interval [CI] 0.98–7.01, p = 0.054) but not to P. vivax
(OR 1.18, 95% CI 0.42–3.32, p = 0.75), after adjustment
for age and village of residence. These 19 persons were
excluded from further analyses.
All antigens tested showed a clear increase in seroprevalence with a person’s age (Figure 1). The data did not
suggest a recent reduction in malaria transmission intensity (14). The EIR for P. falciparum based on seroconver-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Serologic Markers for Detecting Malaria
Table 1. Characteristics of persons included in cross-sectional survey for Plasmodium falciparum and P. vivax infection, Somalia,
2008*
Characteristic
Dry season, Mar–Apr
End of wet season, Aug–Sep
No. persons
1,178
1,128
Age, y, median (IQR)
17 (6–36)
15 (6–37)
Female
48.6 (573/1,178)
50.8 (573/1,128)
Reported regular bed net use
1.9 (22/1,158)
2.2 (25/1,128)
Reported fever in 14 d preceding survey
4.8 (57/1,179)
0.6 (7/1,128)
0.8 (10/1,177)
1.1 (12/1,124)
Temperature >37.5°C at time of survey
Positive rapid diagnostic test result
0 (0/1,173)
0 (0/1,106)
Plasmodium falciparum parasite prevalence†
0 (0/1,173)
0 (0/1,106)
P. vivax parasite prevalence†
0 (0/1,173)
0 (0/1,106)
*IQR, interquartile range (25th75th percentile). Values are % (no. positive/no. tested) unless otherwise indicated.
†Determined by screening 200 high-power microscopic fields.
sion rates for MSP-119 and AMA-1 (11) was <0.1 infectious bites/person/year. When MSP-119 and AMA-1 data
were combined, 17.9% (179/1,001) of the persons tested
showed reactivity against P. falciparum (i.e., had antibodies against P. falciparum MSP-119, AMA-1, or both) and
19.3% (202/1,044) against P. vivax. There was a significant
positive association between reactivity against P. falciparum and P. vivax (p<0.001). However, only 39.8% (66/166)
of persons with antibodies against P. falciparum also responded against P. vivax antigens, and there was no apparent correlation between antibody titers against antigens of
the 2 malaria species (p>0.58).
Spatial Patterns in Seroreactivity
P. falciparum antibody prevalence was 9.4% (23/244)
in Xuunshaley, 21.7% (30/138) in Badahabo (p = 0.001),
and 20.4% (126/619) in Ceel-Bardaale (p<0.001) (Table
2). P. vivax antibody prevalence was 16.1% (40/248) in
Xuunshaley, 21.0% (31/148) in Badahabo (p = 0.11), and
20.2% (131/648) in Ceel-Bardaale (p = 0.13) (Table 2).
Age-adjusted P. falciparum seroreactivity was significantly increased in a cluster of 18 households (108 persons)
in Ceel-Bardaale (p = 0.002) (Figure 2). In Xuunshaley,
there was a small cluster of 6 households (27 persons) with
a higher age-adjusted P. vivax seroreactivity (p = 0.005).
Factors Associated with Seroreactivity
Seroreactivity data were analyzed for villages separately because villages were >7 km apart and were therefore
likely to have their own transmission characteristics. In all 3
villages, P. falciparum antibody prevalence increased with
age (Table 3). For Ceel-Bardaale, an independent negative
association was found between P. falciparum antibody responses and distance to the nearest seasonal river (OR 0.94,
95% CI 0.88–0.99, p = 0.03) after adjustment for age and
correlation between observations from the same household.
Within the group of persons who had a positive antibody
response against P. falciparum, the titer increased with age
in Xuunshaley (β = 1.74, SE = 0.81, p = 0.031) and CeelBardaale (β = 11.48, SE = 3.49, p = 0.001).
Similar to P. falciparum, P. vivax antibody prevalence
increased with age in all 3 villages (Table 3). For CeelBardaale, distance to the nearest seasonal river was negatively associated with P. vivax immune response (OR 0.93,
Table 2. Immune responses against Plasmodium falciparum and P. vivax in study participants, by village, Somalia, 2008*
Village†
Characteristic
Xuunshaley
Badahabo
Ceel-Bardaale
No. persons
271
160
697
Median age, y (IQR)
20 (7–40)
17.5 (5–35)
13 (6–35)
P. falciparum immune response
Combined
9.4 (23/244)
21.7 (30/138)
20.4 (126/619)
MSP-1
5.1 (13/254)
13.4 (19/142)
15.0 (95/634)
251.2 (155.0–285.3)
214.8 (169.8–275.5)
248.5 (190.5–397.2)
AMA-1
4.8 (12/252)
9.2 (13/141)
8.9 (58/653)
169.1 (137.0–190.9)
189.3 (158.4–225.5)
233.7 (170.7–487.0)
P. vivax immune response
Combined
16.1 (40/248)
21.0 (31/148)
20.2 (131/648)
MSP-1
11.9 (30/252)
13.9 (21/151)
10.4 (58/648)
333.9 (271.4–463.9)
342.4 (280.1–374.8)
291.5 (248.7–393.3)
AMA-1
5.2 (13/252)
7.4 (11/149)
12.8 (85/665)
151.5 (146.0–202.1)
183.5 (155.7–275.7)
227.1 (184.6–390.8)
p value‡
0.04
<0.001
<0.001
0.12
0.02
0.12
0.33
0.33
0.39
0.001
0.10
*IQR, interquartile range (25th–75th percentile); MSP-1, merozoite surface protein 1; AMA-1, apical membrane antigen 1.
†Values are % prevalence (no. positive/no. tested) or approximate median titer (IQR) only for seropositive persons unless otherwise indicated.
‡Adjusted for age and correlations between observations from the same household, when applicable.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
395
RESEARCH
Table 3. Factors associated with Plasmodium falciparum or P. vivax seroprevalence in 3 villages, Somalia, 2008*
P. falciparum
P. vivax
Village
Factor
OR (95% CI)
p value
OR (95% CI)
Xuunshaley
Age
1.02 (1.00–1.04)
0.029
1.04 (1.02–1.06)
Badahabo
Age
1.03 (1.01–1.05)
0.002
1.03 (1.01–1.05)
Ceel-Bardaale
Age
1.03 (1.02–1.04)
<0.001
1.03 (1.02–1.04)
Distance to river†
0.94 (0.88–0.99)
0.028
0.93 (0.88–0.99)
p value
<0.001
0.006
<0.001
0.016
*OR, odds ratio; CI, confidence interval. Estimates are adjusted for correlation between observations from the same household.
†Nearest seasonal river.
95% CI 0.87–0.99, p = 0.02) after adjustment for age and
correlation between observations from the same household.
P. vivax antibody titer did not increase with age or any other factor in those persons who were seropositive. Household factors, socioeconomic factors, distance to the nearest
livestock enclosure, and use of mosquito netting were not
independently associated with immune responses against
P. falciparum or P. vivax.
Although seroprevalence and antibody titers were
higher in older age groups, seroreactivity was also observed
in young children. P. falciparum antibodies were detected
in 22 children <5 years of age (median titer 216.5, IQR
173.2–248.5); 10 had antibodies against P. vivax (median
titer 220.1, IQR 190.4–262.4), and 2 of these children had
antibodies against P. falciparum and P. vivax. Thirty children <5 years of age who responded to malaria antigens
were from all 3 villages (3 from Xuunshaley, 7 from Badahabo, and 20 from Ceel-Bardaale). Travel to areas in which
malaria was highly endemic in the past 3 months was not
reported for any of these children with antibodies against P.
vivax, P. falciparum, or both. In children <5 years of age, a
response against P. falciparum antigens was not related to
a response against P. vivax antigens (p = 0.30).
Discussion
We showed that serologic markers can be used to detect heterogeneity in malaria transmission in the Gebiley
District of Somalia where malaria transmission occurs at
levels too low to be detected by microscopy. None of the
slides or rapid diagnostic tests showed parasite carriage in
the population, and MSP-119 and AMA-1 seroprevalence
data showed a clear increase in seroreactivity with age and
evidence for variation in exposure to malaria between and
within villages.
Malaria is perceived as a public health problem in the
study area (22), and the 2 slide-confirmed malaria cases confirm local clinical malaria episodes. Malaria transmission
in the Gebiley District could not be confirmed by microscopy or RDT in 2 large cross-sectional surveys in the general population. However, our serologic findings confirmed
the occurrence of malaria transmission in the area. Using a
validated model to relate age-specific seroconversion rates
to EIR (11), we estimated that P. falciparum transmission
intensity in this area in Somalia was low (EIR <0.1 infec396
tious bites/person/year). Because of the longevity of antibody responses, this estimate should be interpreted as an
average EIR experienced over several years. The low EIR
appeared to be supported by examination of breeding sites
at the end of the wet season, which confirmed the presence
of malaria vectors at a low density. We did not directly determine the EIR by sampling adult mosquitoes because the
low density of mosquitoes would have required intensive
sampling over different seasons (6,23).
Serologic data showed a clear age-dependency in
malaria-specific immune responses, which suggested exposure-driven age acquisition of antibody response. Once
acquired, antibody responses to MSP-119 and AMA-1 will
persist for several years (L.C. Okell, unpub. data) (12), and
the rate of acquisition in younger age groups is therefore
critical for determining current malaria transmission intensity. The maximum seroprevalence for individual malaria antigens did not exceed 25% in the oldest age groups,
which is comparable to areas of low malaria endemicity in
northeastern Tanzania (12).
Because of the longevity of antibody responses, seroreactivity may not necessarily be the result of recent exposure or exposure in the study area (11,24–26). Considerable changes in transmission intensity in the study area
would have been detected by the model (14). However,
especially in adults, exposure to parasites earlier in life and
a history of traveling to malaria-endemic areas can obscure
immune responses resulting from recent local transmission
(25). Our data indicate that although antibodies may have
been acquired outside the study area, ongoing local malaria transmission at a low intensity is likely. Elimination
of false-positive results to reliably detect low-level local
malaria transmission is necessary.
Cross-reactivity between immune responses to malaria
and other parasites have been reported (27,28) but are expected to be more pronounced when whole parasite extract
is used instead of recombinant proteins representing single
antigens. The chance of cross-reactive antibody responses
may be minimized by using sera at a minimum dilution of
1:80 (27). Our serum samples were tested at considerably
higher dilutions and we observed no relation in antibody
titers between the homologous antigens of P. falciparum
and P. vivax. Moreover, our method for calculating seropositivity derives its seronegative population from within
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Serologic Markers for Detecting Malaria
Figure 1. Seroprevalence data for antibodies against A) Plasmodium falciparum merozoite surface protein 119 (MSP-119), B) P. falciparum
apical membrane antigen 1 (AMA-1), C) P. vivax MSP-119, and D) P. vivax AMA-1 by age in the study population, Somalia, 2008. Gray
lines indicate 95% confidence intervals. Seroconversion rates (95% confidence intervals) were as follows: P. falciparum MSP-119 0.0082
(0.0068–0.097); AMA-1 0.0053 (0.0042–0.0066); P. vivax MSP-119 0.0086 (0.0055–0.0133); AMA-1 0.0075 (0.0050–0.0112).
the study sample, thereby minimizing bias caused by local
cross-reactive antigens. Although this method does not rule
out cross-reactive antigens, it makes it unlikely. Antibody
responses in young children who are unlikely to have acquired infections outside the study area, and for whom no
recent travel history was reported, also suggest recent malaria transmission. In our study area, several children <5
years of age had antibody titers >200 to P. falciparum (n =
17) or P. vivax (n = 6). The presence of strong antibody responses (indirect fluorescent antibody titer >20) in children
<15 years of age was used as evidence for active transmission of malaria in area of low endemicity in Middle America (Costa Rica) (25,26).
The indication for local malaria transmission we provide in this study is relevant for local health workers who
should be prepared for fever investigations with standard
parasitologic techniques (microscopy and RDT). Malaria
should be considered as a plausible cause of febrile illness,
particularly in an epidemic form. Low-intensity malaria
transmission and the presence of malaria vectors make the
area susceptible to malaria epidemics, which can have a
high mortality rate in resource-poor areas (29), especially
if outbreak detection systems (30) are not feasible because
of a poor health infrastructure.
We observed heterogeneity in seroreactivity within the
study area. Although the 3 villages had low transmission
intensity and showed no difference in microscopic parasite
carriage, serologic markers showed variation in malaria
exposure. Antibody prevalence against P. falciparum and,
less markedly, P. vivax were lowest in Xuunshaley, which
was furthest from seasonal rivers. Combined P. falciparum
MSP-119 and AMA-1 antibody prevalence was 2× higher in
Badahabo and Ceel-Bardaale than in Xuunshaley. SaTScan
analysis indicated heterogeneity in malaria exposure at a
microepidemiologic level. We observed 1 statistically significant cluster of persons with higher seroreactivity against
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
397
RESEARCH
differences in transmission intensity may prove extremely useful in evaluating malaria control programs in areas
where conventional malariometric markers fail. It may
also provide vital information on which areas are most
likely to be receptive to transmission if malaria epidemics
were to occur.
Acknowledgments
We thank Abdikarim Yusuf for training and supervising of
laboratory technicians; Fahim Yusuf and Ahmed Noor for facilitating training of surveyors and supervising field work; Tanya
Shewchuk, the United Nations Children’s Fund (UNICEF)–Somalia, the World Health Organization, UNICEF country offices,
the Kenya Medical Research Institute (KEMRI), Wafaa Said,
Ahmed Mohamed Jama, and Lydiah Mwangi for administrative
support; Moses Mosobo and Ken Awuondo for technical support
for microscopy; Bart Faber for providing P. vivax AMA-1 antigen; Shona Wilson, Patrick Corran, Lynn Spencer, Eleanor Riley,
and Immo Kleinschmidt for support and advice; the director of
KEMRI for support; and the clan elders, homestead heads, and
community members for participating in the survey.
Figure 2. Age-adjusted optical density (OD) values for antibodies
against Plasmodium falciparum in the study population, CeelBardaale, Somalia, 2008. Colored dots indicate mean age-adjusted
optical densities per household for combined seroreactivity to P.
falciparum merozoite surface protein 119 and apical membrane
antigen 1. The large circle indicates a statistically significant
cluster of higher P. falciparum seroreactivity that was detected
by a spatial scan on the age-adjusted seroreactivity of individual
study participants to both P. falciparum antigens (p = 0.002). As a
result of age adjustment, some persons had lower than expected
seroreactivities. This adjustment resulted in negative OD values.
P. falciparum and 1 with higher seroreactivity against P.
vivax. In Ceel-Bardaale, where households were scattered
along a delta of seasonal rivers, antibody prevalences to P.
falciparum and P. vivax were negatively associated with
distance to the nearest river. In several areas of higher endemicity, distance to the nearest body of water has been
related to malaria incidence (5,20,31,32) and immune responses (20,32). No other factors were significantly related
to malaria-specific immune responses.
Our data indicate that serologic markers can be used
to determine variation in transmission intensity at levels
of malaria transmission that are too low for sensitive assessments by microscopy, RDT, or entomologic tools.
The sensitivity of serologic analysis to detect small-scale
398
This study was supported by The Global Fund to Fight AIDS,
Tuberculosis and Malaria to UNICEF–Somalia (YH/101/04/08).
T.B. is supported by a Rubicon fellowship of the Netherlands Organisation for Scientific Research (825.05.025). J.C. (078925),
C.D. (078925), A.M.N. (081829), and R.W.S. (079081) are supported by the Wellcome Trust UK.
Dr Bousema is a lecturer in the Department of Infectious and
Tropical Diseases at the London School of Hygiene and Tropical
Medicine. His research interests include malaria immune epidemiology and transmission-reducing strategies.
References
1.
2.
3.
4.
5.
6.
Guerra CA, Gikandi PW, Tatem AJ, Noor AM, Smith DL, Hay SI, et
al. The limits and intensity of Plasmodium falciparum transmission:
implications for malaria control and elimination worldwide. PLoS
Med. 2008;5:e38. DOI: 10.1371/journal.pmed.0050038
Snow RW, Omumbo JA, Lowe B, Molyneux CS, Obiero JO, Palmer
A, et al. Relation between severe malaria morbidity in children and
level of Plasmodium falciparum transmission in Africa. Lancet.
1997;349:1650–4. DOI: 10.1016/S0140-6736(97)02038-2
Hay SI, Smith DL, Snow RW. Measuring malaria endemicity from
intense to interrupted transmission. Lancet Infect Dis. 2008;8:369–
78. DOI: 10.1016/S1473-3099(08)70069-0
Nájera JA. Malaria control, achievements, problems and strategies.
Report no. WHO/MAL/99.1087. Geneva: World Health Organization; 1999.
Oesterholt MJ, Bousema JT, Mwerinde OK, Harris C, Lushino P,
Masokoto A, et al. Spatial and temporal variation in malaria transmission in a low endemicity area in northern Tanzania. Malar J.
2006;5:98. DOI: 10.1186/1475-2875-5-98
Smith T, Charlwood JD, Takken W, Tanner M, Spiegelhalter DJ.
Mapping the densities of malaria vectors within a single village.
Acta Trop. 1995;59:1–18. DOI: 10.1016/0001-706X(94)00082-C
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Serologic Markers for Detecting Malaria
7. Mbogo CM, Mwangangi JM, Nzovu J, Gu W, Yan G, Gunter JT, et
al. Spatial and temporal heterogeneity of Anopheles mosquitoes and
Plasmodium falciparum transmission along the Kenyan coast. Am J
Trop Med Hyg. 2003;68:734–42.
8. Drakeley C, Schellenberg D, Kihonda J, Sousa CA, Arez AP, Lopes
D, et al. An estimation of the entomological inoculation rate for Ifakara: a semi-urban area in a region of intense malaria transmission
in Tanzania. Trop Med Int Health. 2003;8:767–74. DOI: 10.1046/
j.1365-3156.2003.01100.x
9. Beier JC, Killeen GF, Githure JI. Short report: Entomologic inoculation rates and Plasmodium falciparum malaria prevalence in Africa.
Am J Trop Med Hyg. 1999;61:109–13.
10. Yekutiel P. Problems of epidemiology in malaria eradication. Bull
World Health Organ. 1960;22:669–83.
11. Corran P, Coleman P, Riley E, Drakeley C. Serology: a robust
indicator of malaria transmission intensity? Trends Parasitol.
2007;23:575–82. DOI: 10.1016/j.pt.2007.08.023
12. Drakeley CJ, Corran PH, Coleman PG, Tongren JE, McDonald
SL, Carneiro I, et al. Estimating medium- and long-term trends in
malaria transmission by using serological markers of malaria exposure. Proc Natl Acad Sci U S A. 2005;102:5108–13. DOI: 10.1073/
pnas.0408725102
13. Mwanziva C, Shekalaghe S, Ndaro A, Mengerink B, Megiroo S,
Mosha F, et al. Overuse of artemisinin-combination therapy in Mto
wa Mbu (river of mosquitoes), an area misinterpreted as high endemic for malaria. Malar J. 2008;7:232. DOI: 10.1186/1475-28757-232
14. Stewart L, Gosling R, Griffin J, Gesase S, Campo J, Hashim R, et al.
Rapid assessment of malaria transmission using age-specific seroconversion rates. PLoS One. 2009;4:e6083. DOI: 10.1371/journal.
pone.0006083
15. Noor AM, Clements AC, Gething PW, Moloney G, Borle M, Shewchuk T, et al. Spatial prediction of Plasmodium falciparum prevalence in Somalia. Malar J. 2008;7:159. DOI: 10.1186/1475-2875-7159
16. Youssef RM, Alegana VA, Amran J, Noor AM, Snow RW. Fever
prevalence and management among three rural communities in the
Republic of Somaliland. Eastern Mediterranean Health Journal. In
press.
17. Corran PH, Cook J, Lynch C, Leendertse H, Manjurano A, Griffin
J, et al. Dried blood spots as a source of anti-malarial antibodies for
epidemiological studies. Malar J. 2008;7:195. DOI: 10.1186/14752875-7-195
18. Babon JJ, Morgan WD, Kelly G, Eccleston JF, Feeney J, Holder
AA. Structural studies on Plasmodium vivax merozoite surface
protein-1. Mol Biochem Parasitol. 2007;153:31–40. DOI: 10.1016/j.
molbiopara.2007.01.015
19. Filmer D, Pritchett LH. Estimating wealth effects without expenditure data–or tears: an application to educational enrollments in states
of India. Demography. 2001;38:115–32.
20. Wilson S, Booth M, Jones FM, Mwatha JK, Kimani G, Kariuki
HC, et al. Age-adjusted Plasmodium falciparum antibody levels
in school-aged children are a stable marker of microgeographical
variations in exposure to Plasmodium infection. BMC Infect Dis.
2007;7:67. DOI: 10.1186/1471-2334-7-67
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
SatScan T. Software for the spatial, temporal, and space-time scan
statisitics [cited 2009 Nov 19]. http://www.satscan.org
Noor AM, Rage IA, Moonen B, Snow RW. Health service providers in Somalia: their readiness to provide malaria case-management.
Malar J. 2009;8:100. DOI: 10.1186/1475-2875-8-100
Hamad AA, Nugud AH, Arnot DE, Giha HA, Abdel-Muhsin AM,
Satti GM, et al. A marked seasonality of malaria transmission in
two rural sites in eastern Sudan. Acta Trop. 2002;83:71–82. DOI:
10.1016/S0001-706X(02)00059-1
Morais CG, Soares IS, Carvalho LH, Fontes CJ, Krettli AU, Braga
EM. Antibodies to Plasmodium vivax apical membrane antigen 1:
persistence and correlation with malaria transmission intensity. Am
J Trop Med Hyg. 2006;75:582–7.
Warren M, Collins WE, Jeffery GM, Skinner JC. The seroepidemiology of malaria in Middle America. II. Studies on the Pacific coast of
Costa Rica. Am J Trop Med Hyg. 1975;24:749–54.
Warren M, Collins WE, Cedillos R, Jeffery GM. The seroepidemiology of malaria in Middle America. III. Serologic assessment of
localized Plasmodium falciparum epidemics. Am J Trop Med Hyg.
1976;25:20–5.
Abramo C, Fontes CJ, Krettli AU. Cross-reactivity between antibodies in the sera of individuals with leishmaniasis, toxoplasmosis, and
Chagas’ disease and antigens of the blood-stage forms of Plasmodium falciparum determined by indirect immunofluorescence. Am J
Trop Med Hyg. 1995;53:202–5.
Naus CW, Jones FM, Satti MZ, Joseph S, Riley EM, Kimani G, et
al. Serological responses among individuals in areas where both
schistosomiasis and malaria are endemic: cross-reactivity between
Schistosoma mansoni and Plasmodium falciparum. J Infect Dis.
2003;187:1272–82. DOI: 10.1086/368361
Guthmann JP, Bonnet M, Ahoua L, Dantoine F, Balkan S, van Herp
M, et al. Death rates from malaria epidemics, Burundi and Ethiopia.
Emerg Infect Dis. 2007;13:140–3. DOI: 10.3201/eid1301.060546
Coleman M, Coleman M, Mabuza AM, Kok G, Coetzee M, Durrheim DN. Evaluation of an operational malaria outbreak identification and response system in Mpumalanga Province, South Africa.
Malar J. 2008;7:69. DOI: 10.1186/1475-2875-7-69
Greenwood BM. The microepidemiology of malaria and its
importance to malaria control. Trans R Soc Trop Med Hyg.
1989;83(Suppl):25–9. DOI: 10.1016/0035-9203(89)90599-3
Booth M, Vennervald BJ, Kenty L, Butterworth AE, Kariuki HC,
Kadzo H, et al. Micro-geographical variation in exposure to Schistosoma mansoni and malaria, and exacerbation of splenomegaly in
Kenyan school-aged children. BMC Infect Dis. 2004;4:13. DOI:
10.1186/1471-2334-4-13
Address for correspondence: Teun Bousema, Infectious and Tropical
Diseases, Immunology Unit, Rm 238C, London School of Hygiene and
Tropical Medicine, Keppel St, London WC1E 7HT, UK; email: teun.
[email protected]
Use of trade names is for identification only and does not imply
endorsement by the Public Health Service or by the U.S.
Department of Health and Human Services.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
399
RESEARCH
Infection of Kissing Bugs with
Trypanosoma cruzi, Tucson,
Arizona, USA
Carolina E. Reisenman, Gena Lawrence, Pablo G. Guerenstein,1 Teresa Gregory, Ellen Dotson,
and John G. Hildebrand
Triatomine insects (Hemiptera: Reduviidae), commonly
known as kissing bugs, are a potential health problem in
the southwestern United States as possible vectors of Trypanosoma cruzi, the causative agent of Chagas disease.
Although this disease has been traditionally restricted to
Latin America, a small number of vector-transmitted autochthonous US cases have been reported. Because triatomine bugs and infected mammalian reservoirs are plentiful in
southern Arizona, we collected triatomines inside or around
human houses in Tucson and analyzed the insects using
molecular techniques to determine whether they were infected with T. cruzi. We found that 41.5% of collected bugs
(n = 164) were infected with T. cruzi, and that 63% of the
collection sites (n = 22) yielded >1 infected specimens. Although many factors may contribute to the lack of reported
cases in Arizona, these results indicate that the risk for infection in this region may be higher than previously thought.
C
hagas disease is endemic throughout Mexico and Central and South America, with ≈7.7 million persons
infected, 108.6 million persons considered at risk, 3–3.3
million symptomatic cases, an annual incidence of 42,500
cases (through vectorial transmission), and 21,000 deaths
every year (1–3). This disease is caused by the protozoan
parasite Trypanosoma cruzi, which is transmitted to humans by blood-sucking insects of the family Reduviidae
(Triatominae). Although mainly a vector-borne disease,
Chagas disease also can be acquired by humans through
blood transfusions and organ transplantation (2–6), con-
Author affiliations: University of Arizona, Tucson, Arizona, USA
(C.E. Reisenman, P.G. Guerenstein, T. Gregory, J.G. Hildebrand);
and Centers for Disease Control and Prevention, Atlanta, Georgia,
USA (G. Lawrence, E. Dotson)
DOI: 10.3201/eid1603.090648
400
genitally (from a pregnant woman to her baby) (7), and
through oral contamination, e.g., foodborne (8). Acute
infection can be lethal, and cardiomyopathy develops in
25%–30% of infected persons (1). Although neither a vaccine against infection nor a completely effective treatment
for chronic Chagas disease currently exists (2,9), treatment
is now recommended for acute infections, congenital infections, infections in immunosupressed persons, and infections in children (10).
Although historically Chagas disease has been considered restricted to Latin America (1,3), the disease is becoming a serious health issue in the United States because of
the presence of a notable number of blood donors seropositive for T. cruzi (11–13). Notably, a small number of the
seropositive blood donors have never left the United States.
Only 7 autochthonous cases of this disease have been reported in the United States, all in the southern half of the
country (14–19). The most recent reported case of autochthonous transmission of T. cruzi occurred in 2006 near New
Orleans, Louisiana (18). Many cases of Chagas disease in
the United States, however, may be overlooked because the
early phase of the infection is often asymptomatic (9,16),
and health professionals are largely unaware of this disease.
In Arizona, humans may be at a greater risk for vectorial
transmission of the disease than previously thought because
human populations are rapidly expanding into habitats
where infected triatomines (20–22) and wild mammalian
reservoirs such as packrats, mice, armadillos, raccoons, and
opossums (23–27) are plentiful. Chagas disease is actively
transmitted in domestic cycles involving dogs in southern
Texas (20,28), where >50% of triatomines collected inside
or near the homes of persons were found to be infected with
1
Current affiliation: Consejo Nacional de Investigaciones Cientıficas
y Técnicas, Diamante, Argentina.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
T. cruzi (19,20). Studies conducted many decades ago found
that triatomines in California, Arizona, and New Mexico
were also infected with T. cruzi (22–25,29).
Arizona is noteworthy as the state with the highest number of triatomine–human contacts reported in the
United States (American Association of Poison Control
Centers, www.aapcc.org/DNN; Arizona Poison and Drug
Information Center, University of Arizona Health Sciences
Center, www.pharmacy.arizona.edu/outreach/poison). In
southern Arizona, triatomine bugs live in association mostly with the white-throated woodrat (Neotoma albigula)
(24,26). Triatomine bugs have wingless nymphal stages
and winged adults. During their dispersal season (beginning of May through July), adult insects, attracted by light,
reach human habitations (30–32). Triatoma rubida is by
far the most common species (Figure 1), but T. protracta
and T. recurva are also found (30,32). T. rubida was associated with a clinical case of Chagas disease in the city of
Guaymas, Mexico, although this bug is perhaps a different
subspecies than the one found in Arizona (33).
To our knowledge, the most recent comprehensive
studies about the infection rates by T. cruzi in triatomines
from Arizona were conducted >45 years ago (21,22), by using microscopy to detect the presence of live parasites in the
insect’s gut or feces. In 1943, Wood (22) found an overall
infection rate of 4% in triatomines (28 of 699) from Arizona
collected over a 3-year period. In 1964, Bice (21) collected
triatomines from packrat dens in what is today a densely
populated area in metropolitan Tucson, Arizona, and found
that 7.5% and 19.5% of T. rubida and T. protracta bugs, respectively, were infected with T. cruzi (21). A recent study
that used molecular methods, but was based on a small sample, found that 1 in 4 T. protracta and 0 of the 20 T. rubida
bugs examined were infected with T. cruzi (34).
To estimate the current potential of vectorial transmission of T. cruzi disease in southern Arizona, we investigated
the infection rate of triatomines collected inside and around
houses in metropolitan Tucson (Pima County), Arizona. Tucson is the second largest metropolitan area in Arizona with
a population (as of 2007) of 1,003,235, of which 462,103
persons live in areas where triatomines are plentiful (35).
Photograph by C. Hedgcock.
Infection of Kissing Bugs with T. cruzi
Figure 1. Adult female kissing bug of the species Triatoma rubida,
the most abundant triatomine species in southern Arizona. Scale
bar = 1 cm.
not to touch or handle the insects with their bare hands,
and they were usually informed about the way that Chagas
disease is transmitted. In a preliminary study conducted in
2005, we found that some triatomine bugs were infected
with T. cruzi (C.E. Reisenman et al., unpub. data). We
therefore conducted a more extensive study in 2006. For
each bug, we recorded, whenever possible, the collection
site (address), insect species, stage, sex (if adults), and date
of collection as well as any other information the collector provided. Collected insects were individually placed
in 95% ethanol immediately after collection or upon death
and stored at 4°C until analysis. Insects were collected during May 15–December 18, 2006.
Analysis of T. cruzi
Materials and Methods
Collection of Insects
Triatomine insects were obtained by issuing public requests asking residents of metropolitan Tucson
(32°13′18′′N, 110°55′35′′W), Arizona, to collect bugs
found inside or around their houses. Insects that reach
houses, as opposed to those directly collected from nests
of wild animals, are of greatest epidemiologic importance
because they have the highest chance of contact with humans. Collectors were instructed to use a container and
Each insect was analyzed by PCR for the presence
of T. cruzi. Before analysis the insect was removed from
ethanol and dried overnight in a petri dish to remove traces
of ethanol before DNA extraction. The lower abdomen of
each bug was detached with a sterile razor blade and homogenized with a ceramic ball, or placed in a 1.5-mL microfuge tube with phosphate-buffered saline (<80 μL) and
homogenized with a hand-held mortar.
DNA was extracted following the instructions provided
with the QiaAmp DNA Blood Mini Kit (QIAGEN 51106;
QIAGEN, Valencia, CA, USA). The DNA was amplified by
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
401
RESEARCH
PCR according to an established T. cruzi sample-processing
protocol (36) by using the T. cruzi–specific primers TCZ1
(5′-CGAGCTCTTGCCCACACGGGTGCT-3′) and TCZ2
(5′-CCTCCAAGCAGCGGATAGTTCAGG-3′),
which
amplify 188 bp of a repetitive nuclear sequence (15). For
the minicircle locus, DNA was amplified by using primers
S35 (5′-AAATAATGTACGGGKGAGATGCATGA-3′)
and S36 (5′-GGGTTCGATTGGGGTTGGTGT-3′) (37),
which amplify a 330-bp minicircle sequence. A 50-μL
reaction containing 0.4 μM of each primer, 20–40 ng of
template DNA, and DNA polymerase (GoTaq; Promega,
Madison, WI, USA, or Platinum Taq; Invitrogen, Carlsbad,
CA, USA) was prepared. Primers for PCR were made at the
Centers for Disease Control and Prevention (Atlanta, GA,
USA) core facility or acquired from Invitrogen. The cycling parameters for the reactions with the TCZ1 and TCZ2
primers were as described (36). The cycling parameters for
the reactions that used the S35 and S36 primers were an initial denaturation at 95°C for 10 min, 35 cycles of amplification at 95°C (30 s each), 58°C (30 s each) and 72°C (1 min
each), and a final extension at 72°C for 10 min. Samples
were processed in a Mastercycler Gradient Thermocycler
Machine (Eppendorf, Hauppauge, NY, USA) or an iCycler (Bio-Rad, Hercules, CA, USA). PCR products were
subjected to electrophoresis on 1.5% agarose gels, stained
with ethidium bromide, and visualized by using UV transillumination with AlphaImager program (Alpha Innotech,
San Leandro, CA, USA). All PCRs were run with a positive control of known T. cruzi DNA and with a negative
control in which template DNA was omitted. Results that
were positive for both sets of primers were considered positive. If a sample was positive for only 1 set of primers, then
the products of the PCR were cloned (pGem-T Easy Vector System; Promega) and sequenced (Big Dye Terminator, v1.1 and ABI 31 30xl Genetic Analyzer; Applied Biosystems, Foster City, CA, USA). Cloned sequences were
compared with sequences in GenBank to determine if the
amplified sequence belonged to the T. cruzi genome. A random sample of ≈15% negative samples (n = 11) was analyzed along with positive samples to exclude the possibility
of false-negative samples.
Results
Insect Collection and Demographics
A total of 164 triatomine bugs (158 [96.3%] T. rubida,
5 [3%] T. recurva, and 1 [0.6%] T. protracta) were collected by volunteers and analyzed for T. cruzi. Most of
the collected T. rubida were adults (93.6%, n = 151). Of
the 141 adult T. rubida identified by sex, 87 were females
(62%) and 54 were males (38%). The proportion of females
to males was statistically different from a 1:1 sex ratio (χ2 =
8.2, df = 1, p = 0.004).
402
Twenty-two collectors provided a total of 142 insects,
with each collector contributing a variable number of insects per night (range 1–10, median 2). A single collector
provided 73 insects collected on 16 nights throughout the
dispersal season. Twenty-two additional bugs were collected by an unknown number of anonymous persons. Information about the specific location where insects were
collected was obtained for 84% (n = 139 insects provided
by 19 collectors) of the insects. These 139 insects (all T.
rubida) were obtained from 17 collection sites distributed
in 6 of the 8 metropolitan Tucson areas corresponding to
the cardinal and ordinal points of the compass, and from
2 collection sites in central Tucson (Table). Because insects were collected by volunteers rather than by using
systematic collection methods (i.e., light traps set up in
all geographic areas), the information in the Table serves
the sole purpose of reporting where insects were collected
and does not constitute an estimate of the abundance of
insects per area.
Adult T. rubida insects were collected in or around
houses from mid-May through the end of August (Figure
2). Most adults were collected in the last days of May
and first week of June (Figure 2, panel B); a total of 61%
of insects were caught during May 25–June 8. This peak
in insect collections coincides with a typical, sustained
increase in minimum temperatures that enables insects to
fly at night (32) (Figure 2, panel A). Bugs were collected
steadily throughout the last week of June; only 13 adults
(8%) were collected during the rest of the dispersal season, which extends to the end of August. Although insects
were not collected by using systematic methods, peak collection periods coincide with the peak dispersals reported
by Ekkens (32).
Analysis of Infection by T. cruzi
We found that 68 (41.5%) of the 164 bugs collected
were infected with T. cruzi. Twenty-four (35%) of the
samples were positive by both set of primers and therefore
Table. Collection sites and collected insects per area, triatomine
insects survey, metropolitan Tucson, Arizona, USA, 2006*
No. insects collected
No. collection sites
(% with insects infected
(% infected
with Trypanosoma cruzi)
with T. cruzi)
Area
Central
2 (100)
2 (100)
North
1 (0)
2 (0)
Northeast
1 (100)
2 (50)
Northwest
6 (66)
14 (43)
South
0
0
Southeast
3 (66)
11 (45)
Southwest
2 (100)
19 (42)
East
0
0
West
4 (100)
88 (40)
*Information about collection sites was obtained for 139 of the 164 bugs
collected. An individual collector from the western area provided an
unusually large number of insects (n = 73).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Infection of Kissing Bugs with T. cruzi
were considered positive. The remaining 44 (65%) positive samples were positive for S35/S36 only, but all of
them were confirmed positive by cloning and sequencing,
thus excluding the possibility of false-positive results. No
samples were positive for TCZ1/TCZ2 and negative for
S35/S36.
Of the 22 identified sites or houses where insects were
collected, 14 (63%) had at least 1 bug infected with T. cruzi.
Infected bugs were found in 7 of 8 areas, including central
Tucson (Table). The percentage of infected bugs per area
was variable (median 43%, range 0%–100%), likely due
to the low number of bugs (1–2) collected in certain areas
(e.g., central, north, northeast). The mean ± SD percentage of infected bugs per area, considering only those areas
where >10 insects were collected, was 42.5% ± 1.0% (4
geographic areas, n = 132 insects). Similarly, to estimate the
prevalence of infection per collection site, we selected sites
where at least 5 bugs were collected. The mean ± SD number of infected bugs per collection site was 47.2% ± 5.7% (n
= 7 collection sites in 4 geographic areas, n = 120 insects).
This percentage was slightly higher (48.8 ± 6.6%, n = 6 collection sites) when a site where a large number of bugs were
collected (n = 73) was excluded from the analysis.
The prevalence of infection by T. cruzi among triatomine species was variable, as reported (21), although a larger
sample is necessary to confirm this prevalence. Forty-one
percent of T. rubida (n = 158) bugs, 60% of T. recurva (n
= 5) bugs, and the single T. protracta bug collected were
infected with T. cruzi. Because only a few T. recurva and
T. protracta bugs were collected, we restricted all further
analysis to T. rubida. Forty-two percent of nymphs (n = 7),
40.1% of females (n = 87), and 40.0% of males (n = 54) of
T. rubida were found to be infected with T. cruzi. Among
adults, the probability of infection was independent of sex
(χ2 = 0.015, df = 1, p>0.9, by χ2 contingency analysis). Infected bugs were found throughout the year; the median
number of infected insects per 5-day collection period during the dispersion season (mid-May through mid-July) was
27% (range 17%–67%).
Discussion
To our knowledge, almost no information has been
collected during the last half-century on the incidence of
infection by T. cruzi in triatomine bugs from Arizona (but
see below). We found that 41.5% of the 164 collected bugs,
most of which were T. rubida, were infected with T. cruzi,
and that 63% of houses or sites where insects were collected
had at least 1 specimen infected. Most bugs collected were
adults, and this winged life stage is known to be the main
driver of dispersal (38). Although most bugs were collected
inside or around human houses from May through the end
of June, infected bugs were collected throughout the period of study. Specimens of the less abundant species T.
Figure 2. Temporal pattern of adult Triatoma rubida insects
collected in metropolitan Tucson, Arizona, USA, May–August,
2006. A) Average minimum daily temperature recorded in 2006
during the period shown (data obtained from www.wrh.noaa.gov/
twc/climate/reports.php). B) Percentages of all adults (n = 134),
males (n = 52), and females (n = 82) collected during the period,
in 5-day intervals (e.g., the percentage of insects collected during
May 15–19 is represented on May 17). Information about sex or
collection date was not available for 16 adults, so they were not
included in this plot.
recurva and T. protracta were also found to be infected.
Samples that were positive with only 1 set of primers were
confirmed by sequencing of the amplified DNA, excluding
the possibility of false-positive results. In contrast with our
results and previous research by others (21,22), a recent
study found that none of the T. rubida bugs collected in
the Tucson area were infected with T. cruzi (34). This discrepancy might be explained by the use of a different set of
primers, the low numbers of insects examined (n = 20 in the
aforementioned study), or bias in the insect sample, such as
few collection sites. Furthermore, the infection rate reported here is much higher than that reported in earlier studies
in Arizona, which ranged from 4% to 9% (22,24,29). Those
studies were conducted by using microscopy that visualized the presence of the parasite in the insect gut; therefore,
discrepancies maybe be attributed to differences in the sensitivity of the methods used (e.g., 16).
The infection rates reported in this study, however, are
in line with those reported in other recent systematic studies. For instance, 51% of triatomines (mostly T. gerstaeckeri) collected from several areas in Texas were infected
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
403
RESEARCH
(n = 241), with many insects found near human dwellings
(19). In Guaymas, in northwestern Mexico, 81% of T. rubida collected in houses and in the peridomicile (n = 279)
were infected with T. cruzi (39). The fact that in that region
adults and juveniles of T. rubida were found inside houses indicates a progressive domiciliation of this otherwise
wild species, probably related to housing developments
in triatomine habitats (39). In our study, immature stage
(nymphs) insects collected inside houses were also infected, but the numbers are too small to draw any definitive
conclusions. If these houses are sites of bug colonization,
then the risk for human infection may be higher than in
houses where only adult insects were found and removed.
Nevertheless, because most immature insects in our study
were found 1–4 months after the peak of dispersion (i.e.,
they are likely the offspring of adults that invade houses
earlier) rather than consistently throughout the year, T. rubida bugs do not appear to be in the process of becoming
domiciliated in Arizona.
Why have there been no reports of autochthonous
cases of Chagas disease in Arizona despite our finding that
41.5% of bugs are infected with T. cruzi? In southern Arizona, triatomines live in close association with the sylvatic
animal reservoirs upon which they feed (26) and apparently have a low capacity for domiciliation, although juvenile
insects (the offspring of dispersing adults) can be found in
houses near beds and readily feed on humans if necessary.
Good housing conditions (e.g., lack of crevices in walls or
ceilings) do not favor the permanent domiciliation of the
insects, but this may not be the case in rural areas where
housing materials provide shelter for the insects. Under
those circumstances, colonization of human habitats might
be favored because at least half of dispersing adults were
female and likely gravid (C.E. Reisenman, unpub. data). In
principle, the parasite can be transmitted to humans when
infected insects that invade houses defecate on the skin
of a human host upon feeding. Although a recent study
reported that T. rubida and T. protracta do not defecate
while feeding (34), our current investigations indicate that
this is not the case for T. rubida bugs in all stages and for
both sexes (C.E. Reisenman, unpub. data). Pet dogs can
become infected by contamination with excreta but also by
contact with the oral mucosa when they instinctively chew
insects that might be infected (40).
Other reasons that might explain why Chagas disease is
so rare in the United States are the following: misdiagnosis
of the early infection (9,16), low insect vectorial capacity
(34), or low infectivity of the genetic lineage of the T. cruzi
parasites present in local insects and mammals, although
this remains to be investigated. Bice (21) showed the presence of T. cruzi parasites in the heart muscle of a mouse
inoculated with feces from an adult T. rubida bug collected
in the Tucson area. Should the lineage of T. cruzi present
404
in southern Arizona correspond to that associated with the
pathogenic form of Chagas disease, the data presented here
suggest that vectorial transmission of the disease in the area
is possible.
Acknowledgments
We thank the 22 volunteer collectors for providing insects,
especially Phil Jenkins, Bill Savary, Jillian Savary, Robert Smith,
and Carl Olson. We also thank the Coordinating Center for Infectious Diseases Core Facility at the Centers for Disease Control and Prevention and C. Olson for identifying insects, Andrew
Dacks for critically reading this manuscript, and members of the
Hildebrand laboratory for helpful discussions.
This work was supported by an Arizona Biomedical Research Commission grant no. 0708 (to J.G.H.).
Dr Reisenman is a researcher at the Department of Neuroscience at the University of Arizona. Her research interests include
vector biology and sensory/neurophysiology of insect vectors of
human and animal diseases.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
Pan American Health Organization Estimación cuantitativa de la
enfermedad de Chagas en las Américas. 2006 [cited 2010 Jan 12].
http://www.bvsops.org.uy/pdf/chagas19.pdf
Tropical Disease Research, World Health Organization. Insect vectors and human health. Report of the scientific working group meeting. Geneva. The Organization. 2003;23–5.
World Health Organization. Chagas disease [cited 2010 Jan 12].
http://www.who.int/tdrold/diseases/chagas/default.htm.2004
Grant IH, Gold J, Wittner M, Tanowitz H, Nathan C, Mayer K, et al.
Transfusion-associated acute Chagas disease acquired in the United
States. Ann Intern Med. 1989;111:849–51.
Nickerson P, Orr P, Schroeder M-L, Sekla L, Johnston J. Transfusion-associated Trypanosoma cruzi infection in a non-endemic area.
Ann Intern Med. 1989;111:851–3.
Guzmán-Bracho C. Epidemiology of Chagas disease in Mexico:
an update. Trends Parasitol. 2001;17:372–6. DOI: 10.1016/S14714922(01)01952-3
Gürtler RE, Segura EL, Cohen JE. Congenital transmission of
Trypanosoma cruzi infection in Argentina. Emerg Infect Dis.
2003;9:29–32.
Nobrega AA, García MH, Tatto E, Obara MT, Costa E, Sobel J,
et al. Oral transmission of Chagas disease by consumption of acai
palm fruit, Brazil. Emerg Infect Dis. 2009;15:653–5. DOI: 10.3201/
eid1504.081450
Kirchhoff LV. American trypanosomiasis (Chagas’ disease)—a tropical disease now in the United States. N Engl J Med. 1993;329:639–
44.
Sosa-Estani S, Segura EL. Etiological treatment in patients infected
by Trypanosoma cruzi: experiences in Argentina. Curr Opin Infect
Dis. 2006;19:583–7. DOI: 10.1097/01.qco.0000247592.21295.a5
Leiby D. Present status of studies on Trypanosoma cruzi in U.S.
blood donors. 2005 [cited 2005 Nov 14]. http://chapters.redcross.
org/ca/norcal/phys/transfus_tcruzi.htm
Leiby D. Blood banking (safety): seroepidemiology of Trypanosoma
cruzi, etiologic agent of Chagas’ disease, in US blood donors. Blood
Weekly. 1997;8:20.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Infection of Kissing Bugs with T. cruzi
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
Centers for Disease Control and Prevention. Blood donor screening
for Chagas disease, United States. MMWR Morb Mortal Wkly Rep.
2006–2007;23:141–3.
Woody NC, Woody HB. American trypanosomiasis (Chagas’s
disease): first indigenous case in the United States. JAMA.
1955;159:676–7.
Ochs DE, Hnilica VS, Moser DR, Smith JH, Kirchoff LV. Postmortem diagnosis of autochthonous acute chagasic myocarditis
by polymerase chain reaction amplification of a species-specific
DNA sequence of Trypanosoma cruzi. Am J Trop Med Hyg.
1996;54:526–9.
Herwaldt BL, Grijalva M, Newsome A, McGhee C, Powell M,
Nemec D, et al. Use of polymerase chain reaction to diagnose the
fifth reported US case of autochthonous transmission of Trypanosoma cruzi, in Tennessee, 1998. J Infect Dis. 2000;181:395–9. DOI:
10.1086/315212
Schiffler RJ, Mansur GP, Navin TR. Indigenous Chagas’ disease
(American trypanosomiasis) in California. JAMA. 1984;251:2983–4.
DOI: 10.1001/jama.251.22.2983
Dorn PL, Perniciario L, Yabsley M, Roellig D, Balsamo G, Diaz J,
et al. Autochthonous transmission of Trypanosoma cruzi, Louisiana.
Emerg Infect Dis. 2007;13:605–7. DOI: 10.3201/eid1304.061002
Kjos SA, Snowden KF, Olson JK. Biogeography and Trypanosoma
cruzi infection prevalence of Chagas disease vectors in Texas, USA.
Vector Borne Zoonotic Dis. 2009;9:41–50.
Beard CB, Pye G, Steurer F, Rodriguez R, Campman R, Townsend
Peterson A, et al. Chagas disease in a domestic transmission cycle in
southern Texas, USA. Emerg Infect Dis. 2003;9:103.
Bice D. The incidence of Trypanosoma cruzi in Triatoma of Tucson,
Arizona [thesis]. Tucson (AZ): University of Arizona; 1964.
Wood SF. Observations on vectors of Chagas’ disease in the United
States. II Arizona. Am J Trop Med. 1943;23:315–20.
Wood SF, Wood FD. Observations on vectors of Chagas’ disease in the United States. III. New Mexico. Am J Trop Med Hyg.
1961;10:155–65.
Wood SF. Additional observations on Trypanosoma cruzi Chagas,
from Arizona in insects, rodents and experimentally infected animals. Am J Trop Med. 1949;29:43–55.
Wood SF. Observations on vectors of Chagas’ disease in the United
States. I. California. Bull South Calif Acad Sci. 1942;41:61–9.
Ryckman R. The vertebrate hosts of the Triatominae of North and
Central America and the West Indies (Hemiptera: Reduviidae: Triatominae). Bull Soc of Vector Ecol. 1986;11:221–41.
Packchanian A. Reservoirs hosts of Chagas’ disease in the state of
Texas. Am J Trop Med. 1942;22:623–31.
Kjos SA, Snowden KF, Craig TM, Lewis B, Ronald N, Olson JK.
Distribution and characterization of canine Chagas disease in Texas.
Vet Parasitol. 2008;152:249–56. DOI: 10.1016/j.vetpar.2007.12.021
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
Kofoid C, Whitaker B. Natural infection of American human trypanosomiasis in two species of cone-nosed bugs, Triatoma protracta
Uhler and Triatoma Uhleri Neiva, in the western United States. J
Parasitol. 1936;22:259–63. DOI: 10.2307/3271533
Wood SF. Dispersal flight of Triatoma in southern Arizona. J Parasitol. 1950;36:498–9. DOI: 10.2307/3273185
Wood S. Notes on the distribution and habits of Reduviid vectors of
Chagas’ disease in the Southwest United States. Pan-Pac Entomol.
1941;17:85–94.
Ekkens D. Nocturnal flights of Triatoma (Hemiptera: Reduviidae)
in Sabino Canyon, Arizona. I. Light collections. J Med Entomol.
1981;18:211–27.
Palencia L, Montaño E. Un nuevo caso de tripanosomiasis en México. Rev Med Fac Mex. 1959;1:737–9.
Klotz SA, Dorn PL, Klotz JH, Pinnas JL, Weirauch C, Kurtz JR, et al.
Feeding behavior of triatomines from the southwestern United States:
an update on potential risk for transmission of Chagas disease. Acta
Trop. 2009;111:114–8. DOI: 10.1016/j.actatropica.2009.03.003
Pima Association of Governments. Draft. July 1, 2007, population
estimates for Arizona’s counties, incorporated places and balance
of county. Arizona Population Statistics Unit, Research Administration, Department of Economic Security [cited 2010 Jan 12]. http://
www.pagnet.org/documents/Population/EEC2007.pdf
Virreira M, Torrico F, Truyens C, Alonso-Vega C, Solano M, Carlier
Y, et al. Comparison of polymerase chain reaction methods for reliable and easy detection of congenital Trypanosoma cruzi infection.
Am J Trop Med Hyg. 2003;68:574–82.
Sturm NR, Degrave W, Morel C, Simpson L. Sensitive detection
and schizodeme classification of Trypanosoma cruzi cells by amplification of kinetoplast minicircle DNA sequences: use in diagnosis
of Chagas’ disease. Mol Biochem Parasitol. 1989;33:205–14. DOI:
10.1016/0166-6851(89)90082-0
Vázquez-Prokopec GM, Ceballos LA, Marcet PL, Cécere MC, Cardinal MV, Kitron U, et al. Seasonal variations in active dispersal
of natural populations of Triatoma infestans in rural north-western
Argentina. Med Vet Entomol. 2006;20:273–9. DOI: 10.1111/j.13652915.2006.00637.x
Paredes EA, Valdéz-Miranda J, Nogueda Torres B, Alejandre-Aguilar R, Cannet Romero R. Vectorial importance of triatominae bugs
(Hemiptera: Reduviidae) in Guaymas, Mexico. Rev Latinoam Microbiol. 2001;43:119–22.
Montenegro VM, Jiménez M, Días JC, Zeledón RBB. Chagas disease in dogs from endemic areas of Costa Rica. Mem Inst Oswaldo
Cruz. 2002;97:491–4.
Address for correspondence: Carolina E. Reisenman, Department of
Neuroscience, College of Science, University of Arizona, PO Box 210077,
Tucson, AZ 85721-0077, USA; email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
405
RESEARCH
Surveillance for West Nile Virus in
American White Pelicans, Montana,
USA, 2006–2007
Gregory Johnson, Nicole Nemeth, Kristina Hale, Nicole Lindsey, Nicholas Panella,
and Nicholas Komar
West Nile virus (WNV)–associated deaths of American
white pelican (Pelecanus erythrorhynchos) chicks have been
recognized at various nesting colonies in the United States
since 2002. We evaluated American white pelican nesting
colonies in Sheridan County, Montana, USA, for an association between WNV-positive pelican carcasses and human
West Nile neuroinvasive disease. Persons in counties hosting affected colonies had a 5× higher risk for disease than
those in counties with unaffected colonies. We also investigated WNV infection and blood meal source among mosquitoes and pelican tissue type for greatest WNV detection efficacy in carcasses. WNV-infected Culex tarsalis mosquitoes
were detected and blood-engorged Cx. tarsalis contained
pelican DNA. Viral loads and detection consistency among
pelican tissues were greatest in feather pulp, brain, heart,
and skin. Given the risks posed to wildlife and human health,
coordinated efforts among wildlife and public health authorities to monitor these pelican colonies for WNV activity are
potentially useful.
A
fter West Nile virus (WNV; family Flaviviridae, genus Flavivirus) was detected in the Great Plains of the
United States in 2002, programs were initiated to identify
the spatial distribution of WNV transmission risk throughout the region. Surveillance activities included compiling
case counts for human and equine disease, and testing
mosquitoes, avian carcasses, and sentinel chicken serum
samples for WNV infection. Corvid (primarily crows and
magpies) death surveillance was an effective early warnAuthor affiliations: Montana State University, Bozeman, Montana,
USA (G. Johnson, K. Hale); and Centers for Disease Control and
Prevention, Fort Collins, Colorado, USA (N. Nemeth, N. Lindsey, N.
Panella, N. Komar)
DOI: 10.3201/eid1603.090559
406
ing system for human disease shortly after WNV was detected in this region (1). However, carcasses of numerous
other bird species also were positive for WNV (2). Avian
deaths caused by WNV infection typically result in widely dispersed carcasses; for the extent of these deaths to
be recognized, substantial public cooperation is required
in reporting deaths (3). In contrast to this cryptic pattern
of deaths, geographically focused deaths among juvenile
American white pelicans (Pelecanus erythrorhynchos
Gmelin; order Pelecaniformes, family Pelecanidae) have
occurred as a result of WNV transmission at numerous
pelican-breeding colonies throughout the northern Great
Plains (4). This region of the United States has the highest incidence of human West Nile neuroinvasive disease
(WNND) recorded (5).
Concurrent with the arrival of WNV to the northern
Great Plains region, high death rates of pelican chicks were
observed at 4 major colonies in Montana, North Dakota,
South Dakota, and Minnesota. WNV was presumed to
be the etiologic agent for >9,000 American white pelican
deaths in 7 states in 2002–2003 on the basis of testing of
a sample of carcasses from various affected colonies (6).
At Medicine Lake National Wildlife Refuge (MLNWR) in
Montana, the chick death rate from mid-July until fledging,
a time when pelican chicks are less vulnerable to severe
weather and predation, typically averages <4%. However,
this death rate reached as high as 44% among colonies in
the region after the arrival of WNV in 2002, and annual
losses since then have remained elevated (typically 7–8×)
in most years (4). Although a spatiotemporal link between
WNV detection and pelican chick deaths seems evident,
the cause of most of these deaths remains presumptive.
Furthermore, the potential public health consequences of
American white pelican deaths need to be evaluated.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
WNV and American White Pelicans
Pelican deaths may indicate increased risk for WNV
transmission to persons living in nearby communities. We
evaluated pelican deaths and human WNND cases for potential associations. In addition, we captured and tested
mosquitoes from MLNWR in 2006 and 2007 to determine
the risk for vector-borne transmission of WNV and identify
the vertebrate source of mosquito blood meals. Finally, we
collected a series of tissue types from a subset of pelican
carcasses at our field site to identify the most efficient tissue for maximizing the probability of WNV detection and
to confirm WNV infection as a contributing factor to elevated prefledgling pelican death rates.
Materials and Methods
Site Description
MLNWR (elevation 590 m) is located in Sheridan
County in northeastern Montana (48°27′N, 104°23′W). The
refuge covers 13,000 hectares, including Medicine Lake
(3,320 hectares), the largest natural lake in eastern Montana. Extensive wetlands provide suitable breeding habitat
for mosquitoes and aquatic birds. Cropland and short-grass
prairie surround the lake and provide nesting grounds to
≈125 species of birds. Approximately 4,000 breeding pairs
of pelicans nest on a narrow peninsula (length ≈500 m) (7).
Spatiotemporal Associations between
Pelican Deaths and Human WNV Disease
Data for human WNV disease cases were obtained
from ArboNET, an internet-based passive surveillance system maintained by the Centers for Disease Control and Prevention (Fort Collins, CO, USA) in collaboration with state
and local health departments. Locations of colonies were
obtained from King and Anderson (8). Wildlife Mortality
Quarterly Reports published by the US Geological Survey
National Wildlife Health Center provided locations and
dates of WNV-related pelican deaths during 2003–2007
(www.nwhc.usgs.gov/publications/quarterly_reports/index.jsp). We used an odds ratio to compare incidence of
WNND cases in counties with reported WNV-associated
deaths at pelican-nesting colonies to that in all other counties with pelican colonies during 2003–2007. Positive and
negative predictive values were defined as the percentage
of counties with pelican-nesting colonies in which a pelican
WNV die-off and human WNND case(s) occurred, and in
which neither a pelican WNV die-off nor a human WNND
case occurred, respectively, during a given year.
Although neuroinvasive and nonneuroinvasive disease
cases are reportable, reporting of nonneuroinvasive WNV
disease has varied substantially by jurisdiction and over
time. Therefore, only WNND cases were considered. For
each year and county that pelican and human WNV disease were observed, we determined the interval between
the earliest collection date of WNV-positive pelicans and
the earliest onset date of human WNV disease.
Surveillance of Mosquitoes
Mosquitoes were collected from MLNWR by using
battery-powered miniature light traps (J.W. Hock, Gainesville, FL, USA) supplemented with CO2 from a 9-kg compressed gas tank. In 2006, seven traps were placed at 5
locations on the northeast perimeter of Medicine Lake; 3
were at Bridgerman Point, 10–200 m from pelican-nesting
and -congregation sites (9). In 2007, all 5 traps were placed
at Bridgerman Point. Traps were generally operated for 2
consecutive nights each week from mid-May through August in 2006 and 2007, and collections were stored at –20°C
for >24 h before transport on dry ice. Collections were processed on a chill table and the light trap index (LTI) was
calculated for each week as the number of trapped Culex
tarsalis mosquitoes per trap night.
For WNV testing by reverse transcription–PCR (RTPCR), weekly trap collections were sorted by species and
location. Pools of <50 adult female mosquitoes were homogenized in vials containing 4.5 mm-diameter coppercoated steel beads (BB pellets) in BA-1 medium (medium
199 with Hanks balanced salt solution, 0.05 mol/L Tris buffer, pH 7.6, 1% bovine serum albumin, 0.35 g/L of NaHCO3, 100 mg/L streptomycin, 100 U/mL penicillin G, 1 μg/
mL amphotericin B) and clarified by centrifugation. RNA
was extracted from the supernatant and purified through an
EasyMag extractor (bioMérieux, Durham, NC, USA) by
using automated magnetic silicon extraction. Purified RNA
was transcribed into cDNA and amplified by using specific
WNV primers as described (10) in an EasyQ thermocycler
(bioMérieux). Detection of WNV cDNA was achieved by
agarose gel electrophoresis. Prevalence of WNV infection
in mosquito populations was estimated by using PooledInfRate (www.cdc.gov/ncidod/dvbid/westnile/software.
html). Vector index was calculated as the product of the
LTI and infection rate (11).
Identification of Mosquito Blood Meals
Blood-engorged Aedes vexans and Cx. tarsalis mosquitoes were stored individually at –20°C and processed for
blood meal identification as described (12). Briefly, each
mosquito was homogenized and DNA was extracted. A portion of the mitochondrial cytochrome B gene was amplified
and sequenced, and the resulting sequence was compared
with sequences in a database for species identification.
Pelican Sample Collection and Preparation
Moribund pelican chicks (≈6–12 weeks of age) showing clinical signs suggestive of WNV infection (e.g.,
ataxia, torticollis, reluctance or inability to move) (Figure)
were killed by cervical dislocation and stored frozen until
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
407
RESEARCH
Detection of WNV in Pelican Samples
Figure. Juvenile American white pelicans (Pelecanus
erythrorhynchos) at Medicine Lake National Wildlife Refuge,
Montana, USA, 2007, including ill (foreground) and dead
(background) birds.
necropsy. In 2006, carcasses were collected from July 25
through August 11 (n = 8) during a period of maximum
chick deaths, and in 2007 from July 11 through August 1 (n
= 24) after confirmation of WNV in mosquito pools. Also
in 2007, oropharyngeal and cloacal swab samples, skin,
and feather samples were collected from 23 carcasses in the
field before they were frozen for comparison with samples
collected from the same animals in the laboratory during
necropsy.
For swab samples, dacron-tipped applicators were inserted into the oropharyngeal cavity (behind the pouch) or
into the cloaca and then submerged and swirled in vials
containing 1 mL BA-1 medium and discarded. In 2007, eye
swab samples were collected from 17 carcasses by placing
the applicator tip between the inner membrane of the eyelid
and the eye. In addition, pouch lice (Piagetiella peralis) were
individually removed from the inner lining of the pouch of
each pelican and pooled in cryovials (<40 lice/pool). Four
flight feathers were removed from each carcass (2/wing).
Feathers were removed from the follicle, and the calamus
(quill tip) was aseptically cut and placed with the associated
pulp into a vial containing 1 mL BA-1 medium. Approximately 0.5 cm3 each of skin, kidney, spleen, heart, lung, and
brain was aseptically collected and placed in cryovials containing 1 mL BA-1 medium for cryopreservation.
Tissues and chewing lice, obtained from the inside of
throat pouches, were homogenized in a mixer mill (5 min
at 25 cycles/s; Retsch GmbH, Haan, Germany) in 1 mL of
BA-1 medium containing 20% fetal bovine serum and a
BB pellet. Homogenates were clarified by centrifugation
(12,000 × g for 3 min), and an aliquot was removed for
immediate testing. Remaining supernatants were stored at
–80°C.
408
Virus isolation was performed for tissues, lice homogenates, and swabs by using a Vero cell plaque assay as described (13). Viral plaques were confirmed as WNV by RTPCR or VecTest WNV Antigen Detection Assay (Medical
Analysis Systems, Camarillo, CA, USA) as described (2).
RT-PCR and plaque assay detection methods were compared within tissue types by using the Fisher exact test with
Bonferroni correction for 9 comparisons (α = 0.0056). For
specimens collected in the field and their carcass-matched
controls collected in the laboratory, test results were compared by using the κ statistic for concordance.
RT-PCR methods for detection of WNV RNA in tissues were according to those of Lanciotti et al. (14), except
for use of the Viral RNA Minikit (QIAGEN, Valencia, CA,
USA) for RNA extraction and the Bio-Rad Icycler IQ Realtime Detection System (Bio-Rad, Hercules, CA, USA) for
cDNA amplification. A cycle threshold value <37 was considered positive for target sequence amplification. Samples
were screened with 1 pair of primers (genome positions
were 10668 for forward primer, 10770 for reverse primer,
and 10691 for probes) and positive results were confirmed
with a second pair of primers (genome positions were 1160
for forward primer, 1229 for reverse primer, and 1186 for
probe).
Results
Association of Pelican Deaths and Human
WNV Disease
The probability of human WNND cases in counties
with pelican nesting colonies increased 5× when WNVassociated deaths occurred among the pelicans (odds ratio
5.0, 95% confidence interval 1.9–13.0, n = 135 countyyears). The positive predictive value of pelican deaths for
human WNND cases was 55%, and negative predictive
value was 81%. Pelican deaths were observed an average
of 23.1 days (median 13.5 days) before human case onset
and occurred before human disease onset in 12 (75%) of 16
county-years (Table 1).
Mosquito Surveillance
In 2006, a total of 414 Cx. tarsalis mosquitoes were
captured in 67 light trap-nights from July 1 through August
5. Weekly LTI values for Cx. tarsalis mosquitoes ranged
from 4.1 to 9.0 during July and early August (Table 2) when
mosquito populations were low because of severe drought
(larval production sites were dry or contained ephemeral
water). None of 12 pools of Cx. tarsalis mosquitoes assayed were positive for WNV RNA.
In 2007, a total of 25,291 Cx. tarsalis mosquitoes
were captured in 42 light trap-nights from June 30 through
August 8 (Table 2). Weekly LTI values during this period
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
WNV and American White Pelicans
Table 1. Deaths in pelicans infected by WNV and WNV human
disease in counties with nesting American white pelican colonies,
United States, 2003–2007*
Earliest date Earliest date
Difference,
of pelican
of disease
Year
County, state
death
in humans
d
2003 Big Stone, MN
Jul 1
Aug 25
56
Phillips, MT
Aug 1
Aug 15
14
Sheridan, MT
Jul 23
Aug 1
9
Stutsman, ND
Jul 15
Jul 26
11
Day, SD
Jul 28
Jul 14
14
2004 Big Stone, MN
May 30
Sep 1
93
2005
Sheridan, MT
Jun 23
Jul 14
52
Stutsman, ND
Jun 17
Jul 18
31
Day, SD
Jul 6
Aug 26
51
2006 Big Stone, MN
Jun 15
Jul 27
42
Washoe, NV
Jul 14
Jul 10
4
Stutsman, ND
Jul 24
Aug 1
8
Day, SD
Jul 19
Aug 1
13
Brown, WI
Jul 15
Aug 10
26
2007 Stutsman, ND
Jul 7
Jul 1
6
Day, SD
Jul 9
Jun 27
12
*WNV, West Nile virus.
ranged from 169 to 1,643. WNV was detected in 28 (32.2%)
of 87 mosquito pools by RT-PCR, with the first positive
mosquito samples collected during the week of July 8,
2007. WNV was detected in 10 of 20 pools of mosquitoes
collected during the last week of July; we observed an estimated infection rate of 10.7/1,000 mosquitoes.
Vertebrate DNA sequences were obtained from bloodengorged abdomens of 22 mosquitoes collected in 2007, including 8 Ae. vexans and 14 Cx. tarsalis. All 22 mosquitoes
had fed on American white pelicans.
WNV in Pelican Samples
Twenty-seven (84.4%) of 32 pelicans sampled had >1
tissues positive for WNV by plaque assay compared with 7
(87.5%) of 8 positive by RT-PCR (Table 3). Pelicans with
WNV-positive tissues were collected from July 25 through
August 11, 2006, and July 11 through August 1, 2007. Be-
cause pelicans were not collected before these dates, the
timing of initial onset of WNV outbreaks in pelicans is unknown.
Skin was the most efficacious tissue for WNV detection in pelican carcasses. Viral loads were greatest in
feather pulp, brain, heart, and skin. RT-PCR and plaque
assay results were similar; detection rates did not differ
among specific tissues or between field-collected vs. laboratory-derived samples (Table 4). Concordance (i.e., test
agreement) was 82% (κ = 0.82) among matched field and
laboratory samples from the same carcasses. All pouch lice
samples were negative for WNV.
Discussion
We observed an association between human cases of
WNND and WNV-induced juvenile pelican deaths in counties with pelican-nesting colonies. The positive and negative predictive values of pelican WNV-associated deaths
for human WNND cases were similar in magnitude to those
of American crow (Corvus brachyrhynchos) deaths. These
findings suggest that monitoring of pelican deaths in colonies near human populations could be of potential use in
public health–oriented WNV surveillance programs, many
of which use crow deaths as indicators of local WNV activity and human risk (15).
Surveillance of pelican colonies for WNV activity
could assist in presaging human WNV infection and associated disease. Pelican deaths were generally detected >2
weeks before WNV disease onset in humans. However, our
observations were limited by numerous assumptions inherent to surveillance data, such as that human case-patients
were infected in their home counties, that all human residents of each county were equally at risk for WNV infection, and that only residents of a county with a colony were
potentially at risk. Because human settlements nearest a
colony may pertain to a different county, a more accurate
analysis would evaluate distance from the nesting colony as
a risk factor for human cases, independent of county lines.
Table 2. Culex tarsalis mosquito infection data for WNV calculated weekly during 2 WNV transmission seasons, Medicine Lake
National Wildlife Refuge, Montana, USA*
2006
2007
Light
No. positive
No. positive
Week of
trap
Light trap
Infection rate‡
Vector index§
pools/no.
Light trap Light trap index
pools/no.
collection
nights
tested
tested
index ± SD†
± SD†
(95% CI)
(95% CI)
nights
Jul 1–7
13
4.1 ± 4.3
0/17
4
448.5 ± 549.5
0/100
0.0
0.0
Jul 8–14
9
6.6 ± 11.6
0/59
9
325.3 ± 131.4
5/800
6.3 (0.8–11.7)
2.0 (0.3–3.8)
Jul 15–21
10
9.0 ± 8.8
0/88
10
1,643.0 ± 899.8
7/1,000
7.0 (1.8–12.2) 11.5 (3.0–20.0)
11
7.0 ± 5.9
0/69
8
259.6 ± 301.9
4/1,000
4.0 (0.1–7.9)
1.0 (0.03–2.1)
Jul 22–28
13
7.1 ± 10.4
0/74
7
169.0 ± 105.3
10/937
10.7 (4.1–17.3)
1.8 (0.7–2.9)
Jul 29–Aug 4
*WNV, West Nile virus: CI, confidence interval.
†Light trap index is mean number of adult female Cx. tarsalis mosquitoes collected per trap night. Seven traps were used in 2006, and 5 traps were used
in 2007.
‡Infection rate is in units of 1,000 mosquitoes and determined by maximum-likelihood estimate. Infection rate was 0 for all collection dates in 2006.
§Vector index is the product of light trap index and infection rate. Unit of measure is number of infected female Cx. tarsalis mosquitoes per trap night.
Vector index values were 0 for all collection weeks in 2006.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
409
RESEARCH
Table 3. WNV detected by plaque assay or RT-PCR in tissues from American white pelican carcasses collected at Medicine Lake
National Wildlife Refuge, Montana, USA, 2006–2007*
3
No. (%) plaque assay positive,
Median viral titer, log PFU/0.5 cm
No. (%) RT-PCR positive,
n = 27
(range)†
n=8
Specimen
Feather pulp
18 (66.7)
3.5 (1.3–5.9)
6 (75.0)
Kidney
18 (66.7)
2.6 (2.0–3.9)
3 (37.5)
Spleen
4 (14.8)
1.6 (0.7–2.0)
1 (12.5)
Brain
21 (77.8)
2.7 (1.7–5.9)
5 (62.5)
Heart
14 (51.9)
3.6 (0.7–5.3)
2 (25.0)
Lung
6 (22.2)
2.4 (1.7–3.3)
1 (12.5)
Skin
25 (92.6)
3.1 (0.7–5.0)
5 (62.5)
Oral swab
9 (33.3)
2.1 (0.7–3.7)
3 (37.5)
Cloacal swab
7 (25.9)
1.8 (0.7–3.7)
2 (25.0)
Eye swab‡
2 (11.8)
2.2 (1.7–2.6)
–
*WNV, West Nile virus; RT-PCR, reverse transcription–PCR. All carcasses were WNV positive by virus isolation or detection of specific WNV RNA by RTPCR.
†Median titers were calculated from the positive specimens only. Unit of measurement for swabs is per swab rather than per 0.5 cm3.
‡Eye swabs were collected from only 17 WNV-positive chicks.
Most pelican colonies are remote from human population centers and are not currently actively monitored for
WNV-associated deaths. Although human population densities near pelican colonies are low, infected host-seeking
mosquitoes may travel >10 km in search of a blood meal,
especially because breeding pelicans and other birds disperse from the region, typically in August. Cx. tarsalis
mosquitoes have traveled distances <12.6 km (16). Other
mosquito species, such as Ae. vexans, could serve as bridge
vectors between infectious juvenile pelicans and susceptible humans. Blood meal analyses from engorged Ae. vexans
and Cx. tarsalis mosquitoes showed that these well-known
biters of humans also feed on pelicans. Furthermore, dispersing pelicans may be infectious and introduce the virus
to competent mosquitoes near human population centers.
Pelicans forage daily <80 km from colony sites (17).
We confirmed vector-borne transmission of WNV to
pelicans at MLNWR in Sheridan County, Montana. Cx.
tarsalis mosquitoes appeared to be the major vector for
transmission of WNV to pelicans in 2007 because vector
and trap indices were high for this mosquito species, and
blood meal identification linked these vectors to the pelicans. WNV was detected in pelican carcasses in 2006 despite low populations of Cx. tarsalis mosquitoes and lack
of WNV detection in mosquitoes, which suggested that
Table 4. Virus titers of field-collected samples from WNV-positive
American white pelican chicks and test agreement with carcassmatched specimens, Montana, USA, 2006–2007*
No. (%) WNV
Median viral titer, log
3
positive, n = 19 PFU/0.5 cm (range)
Sample
N
Skin†
15 (88.2)
3.6 (1.7–5.0)
0.88
Feather pulp
15 (78.9)
4.9 (1.3–5.6)
0.84
Oral swab
7 (36.8)
1.2 (0.7–2.1)
0.79
Cloacal swab
4 (21.1)
1.5 (0.7–2.7)
0.79
*WNV, West Nile virus; N, concordance. All carcasses were positive for
WNV infection by virus isolation or detection of specific WNV RNA by
reverse transcription–PCR. Only plaque assay results are presented for
field-collected samples.
†Skin was collected from only 17 carcasses in the field.
410
pelican deaths may be a sensitive indicator of local WNV
activity. Juvenile pelican deaths caused by WNV infection have been observed (4,6) but never targeted for WNV
avian mortality surveillance, i.e., to generate public health–
related data to be used for WNV prevention and control. In
the reports of juvenile pelican deaths, comparison of WNV
tissue loads in pelicans was not rigorously evaluated.
Biologic specimens collected from avian carcasses
have proven useful in WNV surveillance; the American
crow has been a useful sentinel (2,3,18). Oral swabs and
feather pulp are preferred target samples for diagnosis of
WNV infection in corvids (19,20). To help guide future
WNV surveillance efforts, we sought to determine which
pelican samples would be most useful for WNV detection.
Our results showed that skin and feather pulp are the most
ideal specimens. Previous research showed that feather pulp
was slightly more efficacious than oral swabs for detecting
WNV when the VecTest assay was used for corvids (21),
and that 100% of feather pulp samples were positive among
WNV-infected American crows and blue jays (Cyanocitta
cristata) (20). Feather pulp and skin meet criteria for a lowresource approach to dead bird surveillance: samples require a minimal amount of time for field collection, dissection of the carcass is not required, exposure of laboratory
personnel to infected carcasses is avoided, samples can be
easily transported and shipped, and laboratory processing
costs can be kept to a minimum. Oropharyngeal, cloacal,
and eye swab samples were relatively insensitive for detecting WNV in pelicans.
Continued surveillance of American white pelican colonies is useful for assessing long-term effects of WNV in
colonies and in populations in the northern plains and upper Midwest region of the United States. The role of these
colonial nesting birds in WNV ecology, and conversely that
of WNV on pelican ecology, remains unknown. WNV-amplifying hosts and vectors are generally plentiful at pelican
colonies, and recurring chick deaths since 2003 suggest that
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
WNV and American White Pelicans
WNV-induced reductions in pelican populations will continue. Because juvenile pelicans are likely more susceptible
to WNV-associated illness and death than adults, the effects
of WNV on pelican population growth would manifest as
failed recruitment of new birds into the population in affected colonies, rather than loss of fertile adults. Indirect environmental effects of pelican nest failures are unknown.
The association we observed between WNV disease
among pelicans and humans does not imply that pelicans
are the source of human WNV infections, or vice versa,
and may merely be a consequence of geographic autocorrelation. However, this link highlights the benefit of communication between wildlife and public health sectors.
Knowledge of WNV infections in either sector may signal
a problem requiring attention in the other. This study of
deaths in pelicans caused by WNV serves as a reminder
that wildlife disease investigations may play an useful role
in mitigating risk for zoonotic infections in humans.
Acknowledgments
We thank J. Rodriguez, T. Rodriguez, S. Cross, E. Madden,
and R. Flagan for assistance with bird collections; A. Jackson and
J. Dinkins for assisting with necropsies and sample collection; S.
Zanto and the Montana Public Health Laboratory for testing mosquitoes; A.W. Layton for access to the necropsy area of the State
of Montana Veterinary Diagnostic Laboratory; K. Burkhalter, J.
Velez, and G. Young for laboratory support; and B. Biggerstaff
and M. Fischer for sharing statistical and epidemiologic expertise,
respectively.
This study was supported by the Montana Department of
Health and Human Services, the Montana Agricultural Experiment
Station, and the Centers for Disease Control and Prevention.
Dr Johnson is professor of veterinary entomology in the Department of Animal and Range Sciences at Montana State University in Bozeman. His research focuses on insects that affect
domestic livestock and wildlife, with a particular emphasis on
arthropod-borne diseases of veterinary importance.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
Patnaik JL, Juliusson L, Vogt RL. Environmental predictors of
human West Nile virus infections, Colorado. Emerg Infect Dis.
2007;13:1788–90.
Nemeth NM, Beckett S, Edwards E, Klenk K, Komar N. Avian mortality surveillance for West Nile virus in Colorado. Am J Trop Med
Hyg. 2007;76:431–7.
Eidson M, Kramer L, Stone W, Hagiwara Y. Avian mortality surveillance as an early warning system for West Nile virus. Emerg Infect
Dis. 2001;7:631–5. DOI: 10.3201/eid0704.010405
Sovada MA, Pietz PJ, Converse KA, King DT, Hofmeister EK,
Scherr P, et al. Impact of West Nile virus and other mortality factors on American white pelicans at breeding colonies in the northern
plains of North America. Biological Conservation. 2008;141:1021–
31. DOI: 10.1016/j.biocon.2008.01.019
20.
21.
Lindsey NP, Kuhn S, Campbell GL, Hayes EB. West Nile virus neuroinvasive disease incidence in the United States, 2002–2006. Vector Borne Zoonotic Dis. 2008;8:35–9. DOI: 10.1089/vbz.2007.0137
Rocke T, Converse K, Meteyer C, McLean R. The impact
of disease in the American white pelican in North America. Waterbirds. 2005;28:87–94. DOI: 10.1675/1524-4695(2005)28[87:TIODIT]2.0.CO;2
Madden EM, Restani M. History and breeding ecology of the
American white pelican at Medicine Lake National Wildlife Refuge,
Montana. Waterbirds. 2005;28:23–6. DOI: 10.1675/1524-4695(2005)28[23:HABEOT]2.0.CO;2
King DT, Anderson DW. Recent population status of the American
white pelican: a continental perspective. Waterbirds. 2005;28:48–54.
DOI: 10.1675/1524-4695(2005)28[48:RPSOTA]2.0.CO;2
Hale KM. Investigations of the West Nile virus transmission cycle
at Medicine Lake National Wildlife Refuge, Montana, 2005–2006
[master’s dissertation]. Bozeman (MT): Montana State University;
2007.
Lanciotti RS, Kerst AJ. Nucleic acid sequence-based amplification assays for rapid detection of West Nile and St. Louis encephalitis viruses. J Clin Microbiol. 2001;39:4506–13. DOI: 10.1128/
JCM.39.12.4506-4513.2001
Gujral IB, Zielinski-Gutierrez EC, LeBailly A, Nasci R. Behavioral
risks for West Nile virus diseases, northern Colorado, 2003. Emerg
Infect Dis. 2007;13:419–25. DOI: 10.3201/eid1303.060941
Kent R, Juliusson L, Weissman M, Evans S, Komar N. Seasonal
blood feeding behavior of Culex tarsalis (Diptera: Culicidae) in
Weld County, Colorado, 2007. J Med Entomol. 2009;46:380–90.
DOI: 10.1603/033.046.0226
Panella NA, Kerst A, Lanciotti RS, Bryant P, Wolf B, Komar N.
Comparative West Nile virus detection in organs of naturally infected American crows (Corvus brachyrhynchos). Emerg Infect Dis.
2001;7:754–5. DOI: 10.3201/eid0704.010430
Lanciotti RS, Kerst AJ, Nasci RS, Godsey MS, Mitchell CL, Savage HM, et al. Rapid detection of West Nile virus from human
clinical specimens, field-collected mosquitoes, and avian samples
by a TaqMan reverse transcriptase-PCR assay. J Clin Microbiol.
2000;38:4066–71.
Julian KG, Eidson M, Kipp AM, Weiss E, Petersen LR, Miller JR, et
al. Early season crow mortality as a sentinel for West Nile virus disease in humans, northeastern United States. Vector Borne Zoonotic
Dis. 2002;2:145–55. DOI: 10.1089/15303660260613710
Reisen WK, Milby MM, Meyer RP. Population dynamics of adult
Culex mosquitoes (Diptera: Culicidae) along the Kern River, Kern
County, California, in 1990. J Med Entomol. 1992;29:531–43.
O’Malley JB, Evans RM. Flock formation in white pelicans. Canadian Journal of Zoology. 1982;60:1024–31. DOI: 10.1139/z82-143
Mostashari F, Kulldorff M, Hartman JJ, Miller JR, Kulasekera V.
Dead bird clusters as an early warning system for West Nile virus
activity. Emerg Infect Dis. 2003;9:641–6.
Komar N, Lanciotti R, Bowen R, Langevin S, Bunning M. Detection of West Nile virus in oral and cloacal swabs collected from bird
carcasses. Emerg Infect Dis. 2002;8:741–2.
Docherty DE, Long RR, Griffin KM, Saito EK. Corvidae feather pulp
and West Nile virus detection. Emerg Infect Dis. 2004;10:907–9.
Stone WB, Okoniewski JC, Therrien JE, Kramer LD, Kauffman EB,
Eidson M. VecTest as diagnostic and surveillance tool for West Nile
virus in dead birds. Emerg Infect Dis. 2004;10:2175–81.
Address for correspondence: Gregory Johnson, Department of Animal
and Range Sciences, Montana State University, Rm 19, Linfield Hall,
Bozeman, MT 59717, USA; email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
411
RESEARCH
Murine Typhus in Austin, Texas,
USA, 2008
Jennifer Adjemian,1,2 Sharyn Parks,1 Kristina McElroy, Jill Campbell, Marina E. Eremeeva,
William L. Nicholson, Jennifer McQuiston, and Jeffery Taylor
In August 2008, Texas authorities and the Centers
for Disease Control and Prevention investigated reports
of increased numbers of febrile rash illnesses in Austin to
confirm the causative agent as Rickettsia typhi, to assess
the outbreak magnitude and illness severity, and to identify potential animal reservoirs and peridomestic factors that
may have contributed to disease emergence. Thirty-three
human cases of confirmed murine typhus were identified.
Illness onset was reported from March to October. No patients died, but 23 (70%) were hospitalized. The case-patients clustered geographically in central Austin; 12 (36%)
resided in a single ZIP code area. Specimens from wildlife
and domestic animals near case-patient homes were assessed; 18% of cats, 44% of dogs, and 71% of opossums
had antibodies reactive to R. typhi. No evidence of R. typhi
was detected in the whole blood, tissue, or arthropod specimens tested. These findings suggest that an R. typhi cycle
involving opossums and domestic animals may be present
in Austin.
M
urine typhus, also known as endemic or flea-borne
typhus, is caused by Rickettsia typhi, a gram-negative, obligate intracellular bacillus. This zoonotic disease is
primarily maintained in rodent–flea cycles and is transmitted to humans when infected flea feces contaminate the flea
feeding site or other skin abrasions (1). After an incubation
period of 6–14 days, a nonspecific febrile illness may develop with symptoms of headache, arthralgia, abdominal
pain, and confusion. Approximately 50% of patients also
Author affiliations: Centers for Disease Control and Prevention,
Atlanta, Georgia, USA (J. Adjemian, S. Parks, K. McElroy, M.E.
Eremeeva, W.L. Nicholson, J. McQuiston); Texas Department of
State Health Services, Austin, Texas, USA (S. Parks, J. Taylor); and
Austin/Travis County Health Department, Austin (J. Campbell)
report the development of a diffuse macular or maculopapular rash, which starts on the trunk and spreads peripherally
(sparing the palms and soles) nearly 1 week after the initial
onset of fever and can last from 1 to 4 days. Although the
disease is easily treated with doxycycline, it can be severe
or even fatal if not diagnosed and treated properly (2,3).
Throughout its global distribution, R. typhi has been
primarily concentrated in coastal urban areas where it is
maintained among rats (Rattus spp.) and oriental rat fleas
(Xenopsylla cheopis) (3). Within the United States, murine typhus is endemic in parts of California, Hawaii, and
Texas, where <100 cases are reported annually (4–7) with
a 1%–4% fatality rate when left untreated (3,4). Recent
studies in southern Texas and California indicate that the
classic rodent-flea cycle of R. typhi has been augmented
in these suburban areas by a peridomestic cycle involving
free-ranging cats, dogs, opossums, and their fleas (1,6,7).
In addition, R. felis, which may produce a febrile illness in
humans (8), may also circulate within these same zoonotic
cycles (7,9). Although both agents have been documented
in opossum-flea cycles in parts of southern Texas (7,9),
these diseases are rare in the Austin/Travis County area.
Though Austin is only 140 km from the Texas coast, where
murine typhus is endemic, only 4 cases have been reported
there in the past 25 years; 2 of those 4 cases were reported
in September 2007 (Texas Department of State Health Services [TDSHS], unpub. data).
From March through July 2008, the Austin/Travis County Department of Health and Human Services
(ATCDHHS) identified 13 cases of febrile illness, half of
which had a rash or a severe headache, or both. Laboratory
tests conducted at the TDSHS and the Centers for Disease
1
These authors contributed equally to this article.
2
DOI: 10.3201/eid1603.091028
412
Current affiliation: Federal Bureau of Prisons, Washington, DC,
USA.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Murine Typhus, Texas, USA
Control and Prevention (CDC) indicated that these patients
all had antibodies reactive to R. typhi. Active infection with
R. typhi was also identified in 1 patient by PCR. In August
2008, TDSHS, CDC, and ATCDHHS initiated a detailed
epidemiologic investigation to confirm the causative agent
as R. typhi, to assess the outbreak magnitude and illness
severity, and to identify potential animal reservoirs and
peridomestic factors that may have contributed to disease
emergence.
Methods
In August 2008, TDSHS, CDC, and ATCDHHS initiated an epidemiologic investigation into the emergence of
murine typhus in Austin. A clinical investigation was conducted to assess the magnitude and severity of the outbreak.
An environmental investigation was conducted to assess
the environment and peridomestic factors and domestic
animals around case-patient home sites to identify possible
means of transmission and risk factors for disease.
Clinical Investigation
Healthcare providers in Austin were asked to report
any suspected cases to the health department. Suspected
cases were reported to ATCDHHS by the National Electronic Disease Surveillance System. Criteria for suspected
cases were high fever (>38°C), with at least 1 of the following: headache, rash, or myalgia. Confirmed cases were
defined as meeting the suspected case criteria and having
laboratory confirmation for R. typhi infection. The criteria
for laboratory confirmation included at least a 4-fold rise
in antibody titer to R. typhi antigen between paired serum
specimens obtained >3 weeks apart or the detection of R.
typhi DNA in a clinical specimen by PCR.
All suspected and confirmed case-patients identified
from March through November 2008 were interviewed inperson or by telephone, medical chart reviews were conducted, and serum specimens were collected for laboratory
testing. Where the patient was <18 years old, the parents
were interviewed. All patients or their proxies were interviewed by using a standard questionnaire. Information collected included demographics, laboratory test results, and
clinical symptoms. Medical records of all patients were
reviewed. Abstracted data included results of radiographs,
urinalyses, blood counts, serologic analysis, and liver enzyme analyses.
Environmental Investigation
Environmental assessments were conducted at the
households of 21 case-patients who had been identified
from March through July 2008. An external site assessment
of the physical property was conducted, including evaluations of environmental factors such as housing structure,
vegetation, water features, food sources, and evidence of
animals present. When possible, household owners were
queried on the internal and external use of pesticides, ownership of domestic animals, use of flea- and tick-control
products, history of flea infestations, and reported past evidence of rodents or other types of wildlife in or around the
property.
Serum and whole blood specimens were collected from
cats and dogs from consenting case-patient households, as
well as from feral cats submitted by humane organizations
working in the area. A total of 791 trap nights using a combination of live traps (H.B. Sherman Traps, Tallahassee,
FL, USA, and Tomahawk Live Trap Co., Tomahawk, WI,
USA) were also conducted around 10 case-patient households, targeting capture of peridomestic small wild mammals. In addition, wildlife was accepted from organizations
that trapped so-called nuisance species within the outbreak
area. Wildlife species were released after specimen collection, except for rats, which were humanely euthanized.
Serum and whole blood, as well as ectoparasites, were
collected from all animals. Tissue specimens (heart, lung,
kidney, spleen and liver) were collected from animals that
were euthanized. The address of residence or location was
recorded for each animal assessed.
Laboratory Analyses
Confirmatory tests for suspected human cases were
performed at a variety of private commercial laboratories; results were then verified by subsequent testing at the
TDSHS Laboratory, Austin, Texas, USA, the Rickettsial
Zoonoses Branch Diagnostic Laboratory at CDC, Atlanta,
Georgia, USA, or both. All animal and arthropod samples
were tested at CDC.
Serologic Analysis
Serologic analysis was conducted by using indirect immunofluorecent antibody (IFA) assays for R. typhi grown
in embryonated chicken yolk sacs, air-dried, and acetonefixed onto template slide wells. In each assay, antibodies
bound to the antigens are detected by using species specific
fluorescein isothiocyanate (FITC)–labeled conjugates. We
used FITC conjugates (Kirkegaard & Perry Laboratories,
Gaithersburg, MD, USA) produced in goats against human
immunoglobulin (Ig) G (γ-chain–specific at a final dilution
of 1:150), human IgM (μ-chain–specific at a final dilution
of 1:100), rat IgG (heavy plus light [H + L] chain) (diluted
at 1:100), mouse IgG (H + L chain) (1:100), cat (H + L
chain) IgG (1:100), and a monovalent conjugate against
dog IgG (γ-chain–specific) (1:150). FITC-labeled conjugate against opossum IgG (H + L chain) (Bethyl Laboratories, Montgomery, TX, USA) was used at a final dilution of 1:100. The assay format, buffers, and other reagents
were used according to the method described by Nicholson
et al. (10). Samples were serially (2) diluted and the last
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
413
RESEARCH
Amplification by PCR and Sequencing
Fleas were identified to species, and DNA was isolated from each specimen by using the Biomek 2000 Laboratory Automation workstation (Beckman, Fullerton, CA,
USA) and reagents from the Wizard Prep kit (Promega,
Madison, WI, USA) (11). Detection of R. felis and R. typhi
DNA was conducted by using a TaqMan assay for the citrate synthase (gltA) gene of Rickettsia spp. as described
elsewhere (11,12). The reactions were conducted by using
the Brilliant Q PCR core reagent kit (Stratagene, La Jolla,
CA, USA) and run on an iCycler (Bio-Rad, Hercules, CA,
USA). Primers and probes were produced by the CDC Core
Facility (Atlanta, GA, USA). For animal and human specimens, DNA was extracted from 200 μL of EDTA-blood
and 25–50 mg tissue by using the QIAamp DNA Mini Kit
(QIAGEN, Valencia, CA, USA). Animal specimens were
tested by gltA TaqMan. PCR assays for the rickettsial 17kDa antigen gene were used for detection of spotted fever
and typhus group rickettsiae DNA in clinical specimens
with Ready-to-Go-Beads (Amersham Biosciences UK
Ltd., Little Chalfont, UK) as described elsewhere (13,14).
Amplicons were purified using Wizard SV Gel and PCR
Clean-Up System according to the manufacturer’s instructions (Promega). The purified product was sequenced with
the ABI PRISM BigDye Terminator Cycle 3.1 Sequencing kit (Applied Biosystems, Foster City, CA, USA). The
sequenced product was then purified with a QIAGEN DyeEx 2.0 kit (QIAGEN) and run on an Applied Biosystems
3100x Sequencer (Applied Biosystems).
Results
Clinical Investigation
Thirty-three of 53 patients with suspected cases were
confirmed to have murine typhus. All 33 were laboratory
confirmed by IFA assay; 1 case was serologically confirmed by PCR, and the sequenced product was positive for
R. typhi DNA. Illness onset among the patients ranged from
March through October 2008, with 70% occurring during
May–August (Figure 1). Patients with confirmed cases had
an average age of 39 years (range 7–64 years, 15% <18
years); most were male (56%) and white (97%). Although
no deaths were attributed to murine typhus among this cohort of case-patients, 23 (70%) were hospitalized (mean
7 days; range 3–14 days), and 9 (27%) were admitted to
intensive care units (mean 5 days, range 1–10) with complications, including pneumonia, coagulopathy, and renal
failure. Seventeen (51%) patients received antimicrobial
drugs, 13 (76%) of them doxycycline. The mean time from
414
No. cases
well demonstrating specific fluorescence of the R. typhi organisms was recorded as the endpoint titer (expressed as a
reciprocal of the dilution).
8
7
6
5
4
3
2
1
0
Mar Apr May Jun
Jul
Aug Sep Oct
Nov
Figure 1. Month of illness onset for laboratory-confirmed murine
typhus cases (n = 33) reported in Austin/Travis County, Texas,
USA, 2008.
symptom onset to antimicrobial drug treatment was 8.3
days (median 8 days, range 1–19 days). No significant differences were detected in rates of hospitalization (p = 0.78)
and complications (p = 0.84) between those patients who
did and those who did not receive doxycycline.
The median high temperature reported among confirmed case-patients was 40°C (range 39°C–41°C). The
most commonly reported symptoms included malaise
(76%), headache (73%), chills (61%), and myalgia (61%).
Loss of appetite (58%), nausea (52%), rash (46%), vomiting (42%), and diarrhea (36%) were also reported by many
case-patients. Less than one third of case-patients reported
photophobia (30%), arthralgia (33%), stiff neck (24%),
backache (21%), abdominal pain (21%), coughing (18%),
jaundice (18%), lymphadenopathy (15%), conjunctivitis
(12%), and confusion (12%). Serologic results showed that
impaired liver function was common in patients (70%), and
some had impaired kidney function (21%).
The 33 confirmed case-patients clustered geographically in central Austin (Figure 2). Twelve (36%) resided
in 1 ZIP code area in a suburban-residential area (Table 1).
Most other patients were from adjacent and nearby central
and east central Austin areas. One case-patient resided in
northern Travis County but worked in central Austin.
Environmental Investigation
Twenty-six (79%) of the 33 confirmed case-patients
owned a dog or cat. Of those, 14 (42.4%) reported regularly
administering flea/tick preventatives to their pets. However, only 2 patients (5.4%) noted flea bites or exposure
in the 2-week period before illness onset. Recent exposure
to opossums was reported by 11 (29.7%) of the patients;
>20% had been recently exposed to rats, 19% to raccoons,
and 5% to mice through both direct and indirect contact.
External site assessments were performed at 20 home
sites (representing 21 case-patients). Of the home sites evaluated, 9 (45%) had pet food outside; 9 (45%) had a garden
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Murine Typhus, Texas, USA
samples obtained from raccoons or rats were seropositive.
Seropositive animals came from 5 ZIP code areas, and
68% of all seropositive animals came from 2 ZIP codes
areas where 35% of the human cases were reported (Figure 2; Table 1). All 3 seropositive cats came from 1 capture site, whereas the 4 seropositive dogs were owned by
3 case-patients (2 dogs by a single patient) from 3 ZIP
code areas. Seropositive opossums were from 8 capture
sites in 3 ZIP code areas. Of the arthropods evaluated,
83.5% were identified as Ctenocephalides felis, the cat
flea (Table 3). No evidence of either R. typhi or R. felis
DNA was detected in any of the whole blood, tissue, or
arthropod specimens tested.
Figure 2. Distribution of confirmed murine typhus case-patients
and animals by serologic status for antibodies to Rickettsia typhi
in Travis County, Texas, USA, 2008. Red circles, confirmed
case-patients; black circles, seropositive animals; gray circles,
seronegative animals.
or compost heap; 12 (60%) had outdoor piles of firewood
or harborage; 12 (60%) had apparent evidence of rodents
(through direct observations or the presence of feces, nests,
or burrows); 17 (85%) had outdoor water sources; and 17
had unsecured garbage outside.
A total of 56 animals (including 17 cats, 9 dogs, 17
opossums, 9 raccoons, and 4 rats) (Table 2) and 139 arthropods were obtained; all but 1 opossum was evaluated (Table 3). Overall, 19 (33.9%) of all animals tested
were seropositive. This sample included 3 (17.6%) cats,
4 (44.4%) dogs, and 12 (70.6%) oppossums. None of the
Discussion
Murine typhus is a common zoonotic disease in endemic foci of southern Texas, where a mean of 48 cases
were reported annually from 1990 through 2006 (15).
However, before this investigation, murine typhus was not
believed to occur commonly in the Austin/Travis County
area, and only 2 cases were identified before 2007. This
investigation identified 33 patients with laboratory-confirmed cases, nearly 70% of whom were hospitalized from
March through November 2008. In addition, 2 murine typhus cases reported in Austin in September 2007 likely represent some of the first cases associated with this emergent
focus. These findings represents the first large-scale outbreak reported in Austin/Travis County since eradication
efforts were coordinated in this part of Texas in the 1940s
(TDSHS, unpub. data).
The clinical features and age distribution of casepatients reported here are similar to those found in case-
Table 1. Distribution by ZIP code of confirmed human murine typhus case-patients and animals and ectoporasites that were tested for
Rickettsia typhi by IFA assay and/or PCR, Austin/Travis County, Texas, USA, August 2008*
No. human casepatients, n = 33
ZIP code
Opossum (12/17)† Raccoon (0/9)† Rat (0/4)† Cat (3/17)† Dog (4/9)† Flea (0/139)†
78702
1
1/1
–
–
–
–
0/14
78703
12
6/7
0/5
0/4
0/2
0/3
0/58
78704
1
–
–
–
–
–
–
78705
5
–
–
–
–
–
–
78722
2
–
–
–
3/4
0/1
0/6
78723
1
0/2
–
–
0/3
1/2
0/15
78727
1
–
–
–
–
–
–
78728
1
–
–
–
0/2
–
0/5
78731
1
–
–
–
–
–
–
78741
0
–
0/1
–
–
–
0/2
78745
0
–
0/1
–
–
–
0/4
78746
2
5/7
0/2
–
0/2
2/2
0/31
78747
1
–
–
–
–
–
–
78748
0
–
–
–
0/1
–
0/2
78751
2
–
–
–
–
–
–
78757
3
–
–
–
0/1
1/1
0/2
78759
0
–
–
–
0/2
–
–
*IFA, immunofluorescent antibody.
†Values are no. positive/no. tested except as indicated.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
415
RESEARCH
Table 2. Frequency and distribution of animals seropositive for Rickettsia typhi, Austin/Travis County, August, 2008*
IFA assay titer, no. animals
No. animals
No. (%) animals
Animal
tested
seropositive
<32
32
64
128
256
512
1,024
Cat
17
3 (17.7)
14
0
0
0
0
1
0
Dog
9
4 (44.4)
5
0
0
0
0
1
2
Opossum
17
12 (70.6)
5
4
3
1
3
1
0
Raccoon
9
0
9
0
0
0
0
0
0
Rat
4
0
4
0
0
0
0
0
0
Total
56
19 (33.9)
38
4
3
1
3
3
2
2,048
0
1
0
0
0
1
>4,096
2
0
0
0
0
2
*IFA, immunofluorescent antibody. Seropositivity indicated by titer >32.
patients reported in other murine typhus studies (4,16).
Although 70% of the case-patients identified during this
outbreak were hospitalized, this percentage is slightly less
than what was observed by Taylor et al. (16) during a study
of 200 cases in Texas from 1980 through 1984, in which
85% of patients were hospitalized and 1% died. Though no
deaths were reported during this 2008 outbreak, nearly one
third of all patients were admitted to the intensive care unit
with complications (including pneumonia, coagulopathy,
and renal failure) that demonstrated the severity of illness.
Delaying treatment for murine typhus increases the
duration of symptoms and risk for complications (4,17).
Treatment should always be initiated on the basis of clinical and epidemiologic considerations alone without waiting for a laboratory confirmation of the diagnosis. In this
outbreak, 48% of patients did not receive treatment with
doxycycline, the drug of choice for treatment for rickettsial
diseases. The lack of doxycycline administration and the reported lag time of 1 week to nearly 3 weeks between symptom onset and antimicrobial drug treatment experienced
by most patients may have been associated with a delay in
recognizing that the cases were murine typhus, because of
the perception that the disease was not present in Austin.
Despite this finding, the difference in hospitalization and
complication rates did not appear to be significant between
patients with and without proper antimicrobial drug treatment. However, the small sample size may have precluded
a robust comparison of these data.
Strong serologic evidence of exposure to rickettsiae
was detected among opossum and domestic animal populations in Austin/Travis County. More than one third of all
animals tested were seropositive with R. typhi antigen. Of
particular interest, >70% of opossums tested were seropositive with R. typhi antigen. Further studies are needed to determine the specific role that opossums play in the ecology
of murine typhus in the Austin area. Exposure to other rickettsiae in the spotted fever group also cannot be excluded,
particularly for R. felis, which is very common in cat fleas
obtained from opossums (7,12). The serologic findings observed here are similar to what has been observed in studies
of disease-endemic regions in southern Texas and California, USA, where opossums are hosts for fleas containing
R. typhi and R. felis (6,7,9,18). In Los Angeles, California,
and Corpus Christi, Texas, 42% and 25% of opossums were
found to be seropositive for R. typhi, respectively, although
seropositive rats were rarely or never detected (7,9). These
studies have resulted in a reevaluation of the classic urban
cycle of murine typhus in suburban disease-endemic areas
in the continental United States, where opossums, domestic cats, and cat fleas—and not rodents and their fleas—are
considered to be a primary source of infection (2).
Although none of the rats in this study were seropositive for R. typhi, the small sample size tested (n = 4) limits
our ability to draw conclusions regarding the contribution
of rats and their arthropods to the dynamics of murine typhus in this area. Additionally, presumptions regarding
contributions of various animal species are limited because
only serologic findings were positive; active infection with
either R. typhi or R. felis was not detected in any of the
samples tested. While none of the fleas were positive for
either R. typhi or R. felis DNA, this result is not entirely unexpected considering the infrequency with which positive
Table 3. Summary of fleas collected from animals in Austin/Travis County, Texas, USA, August 2008
No. animals with
Total no. fleas
Frequency of flea species by
fleas/total no. animals
collected
host animal, %
Animal
Flea species collected
Cat
12/17
23
70.6 (n = 12)
Ctenocephalides felis
Dog
1/9
1
11.1 (n = 1)
Ctenocephalides canis
Opossum
18/18
84
100.0 (n = 18)
C. felis
14
22.2 (n = 4)
Pulex irritans
Raccoon
9/9
8
44.4 (n = 4)
C. felis
1
11.1 (n = 1)
Echidnophaga gallinacean
5
33.3 (n = 3)
P. irritans
2
22.2 (n = 2)
Xenopsylla cheopis
Rat
1/4
1
25.0 (n = 1)
C. felis
Total
41/56
–
139
73.2 (n = 44)
416
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Infestation
index
1.35
0.11
4.67
0.78
0.89
0.11
0.56
0.22
0.25
–
Murine Typhus, Texas, USA
fleas were detected in similar studies. For instance, Boostrom et al. (7) identified only 3 R. typhi and 11 R. felis positive fleas out of a sample of 529 from highly endemic parts
of southern Texas. Still, R. felis may be circulating within
this area because both pathogens appear to be maintained in
complex ecologic cycles (2,7). More specific studies targeting larger numbers of statistically representative domestic
animals and wildlife are needed to better discern complicated human-animal-disease dynamics.
Murine typhus may now be established in the Austin/
Travis County area and should be considered an ongoing
public health threat. Although, the idea that persons have
been infected with R. felis (which has been previously found
to infect a patient in Texas) cannot be totally excluded (8).
Continued public health education efforts are needed in the
Austin/Travis County area regarding the emergence of fleaborne rickettsiosis and the likely risk factors for infection,
with an emphasis on avoiding contact with wild animals
and controlling fleas on pets and around the home with approved products. Physicians in the area should maintain an
increased vigilance in detecting and diagnosing suspected
murine typhus cases as well as other rickettsioses, because
timely treatment with the appropriate antimicrobial drug
therapy is critical for limiting severe outcomes.
Acknowledgments
We thank the following persons and organizations for their
support throughout this investigation: Eda Gowdy, Philip Huang,
Joe Staudt, Melissa Maass, Guy Moore, Beverlee Nix, Tom Sidwa, Glenna Teltow, Maria L. Zambrano, Joseph Singleton, Sandor E. Karpathy, John Krebs, Gregory A. Dasch, Robert Massung,
and staff from the Austin Humane Society and the Town Lake
Animal Shelter, Austin, Texas.
Dr Adjemian is the lead infectious disease epidemiologist for
the Federal Bureau of Prisons, Washington, DC. Her research interests are infectious disease modeling, spatial epidemiology, and
the epidemiology and ecology of zoonotic diseases.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
References
1.
2.
3.
Azad AF, Radulovic S, Higgins JA, Noden BH, Troyer JM. Fleaborne rickettsioses: ecologic considerations. Emerg Infect Dis.
1997;3:319–27. DOI: 10.3201/eid0303.970308
Civen R, Ngo V. Murine typhus: an unrecognized suburban
vectorborne disease. Clin Infect Dis. 2008;46:913–8. DOI:
10.1086/527443
Azad AF. Epidemiology of murine typhus. Annu Rev Entomol.
1990;35:553–69. DOI: 10.1146/annurev.en.35.010190.003005
All material published in Emerging Infectious Diseases is in the
public domain and may be used and reprinted without special
permission; proper citation, however, is required.
Dumler JS, Taylor J, Walker DH. Clinical and laboratory features
of murine typhus in south Texas, 1980 through 1987. JAMA.
1991;266:1365–70. DOI: 10.1001/jama.266.10.1365
Manea SJ, Sasaki DM, Ikeda JK, Bruno PP. Clinical and epidemiological observations regarding the 1998 Kauai murine typhus outbreak. Hawaii Med J. 2001;60:7–11.
Williams SG, Sacci JB, Schriefer ME, Andersen EM, Fujioka KK,
Sorvillo FJ, et al. Typhus and typhuslike rickettsiae associated with
opossums and their fleas in Los Angeles County, California. J Clin
Microbiol. 1992;30:1758–62.
Boostrom A, Beier MS, Macaluso JA, Macalusco KR, Sprenger D,
Hayes J, et al. Geographic association of Rickettsia felis-infected
opossums with human murine typhus, Texas. Emerg Infect Dis.
2002;8:549–54.
Schriefer ME, Sacci JB Jr, Dumler JS, Bullen MG, Azad AF. Identification of a novel rickettsial infection in a patient diagnosed with
murine typhus. J Clin Microbiol. 1994;32:949–54.
Schreifer ME, Sacci JB Jr, Higgins JA, Taylor JP, Azad AF. Murine
typhus: updated role of multiple urban components and a second
typhus-like rickettsiae. J Med Entomol. 1994;31:681–5.
Nicholson WL, Comer JA, Sumner JW, Gingrich-Baker C, Coughlin RT, Magnarelli LA, et al. An indirect immunofluorescence assay
using a cell culture–derived antigen for the detection of antibodies
to the agent of human granulocytic ehrlichiosis. J Clin Microbiol.
1997;35:1510–6.
Eremeeva ME, Warashina WR, Sturgeon MM, Buchholz AE, Olmsted GK, Park SY, et al. Rickettsia typhi and R. felis in rat fleas (Xenopsylla cheopis), Oahu, Hawaii. Emerg Infect Dis. 2008;14:1613–5.
DOI: 10.3201/eid1410.080571
Karpathy SE, Hayes EK, Williams AM, Hu R, Krueger L, Bennett
S, et al. Detection of Rickettsia felis and Rickettsia typhi in area of
California endemic for murine typhus. Clin Microbiol Infect. 2009;
[Epub ahead of print].
Paddock CD, Finley RW, Wright CS, Robinson HN, Schrodt BJ,
Lane CC, et al. Rickettsia parkeri rickettsiosis and its clinical
distinction from Rocky Mountain spotted fever. Clin Infect Dis.
2008;47:1188–96. DOI: 10.1086/592254
Massung RF, Davis LE, Slater K, McKechnie DB, Puerzer M. Epidemic typhus meningitis in the southwestern United States. Clin Infect Dis. 2001;32:979–82. DOI: 10.1086/319351
Texas Department of State Health Services. Murine typhus in Texas.
The EpiLink. 2008;65:1–3.
Taylor JP, Betz TG, Rawlings JA. Epidemiology of murine typhus in
Texas, 1980 through 1984. JAMA. 1986;255:2173–6. DOI: 10.1001/
jama.255.16.2173
Fergie JE, Purcell K, Wanat D. Murine typhus in south Texas children. Pediatr Infect Dis J. 2000;19:535–8. DOI: 10.1097/00006454200006000-00009
Sorvillo FJ, Gondo G, Emmon R, Ryan P, Waterman SH, Tilzer A, et
al. A suburban focus of endemic typhus in Los Angeles County: association with seropositive domestic cats and opossums. Am J Trop
Med Hyg. 1993;48:269–73.
Address for correspondence: Jennifer Adjemian, Office of Research and
Evaluation, 320 First St N, 400 Bldg, Rm 3022, Washington, DC 30534,
USA; email: [email protected]
Use of trade names is for identification only and does not imply
endorsement by the Public Health Service or by the U.S.
Department of Health and Human Services.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
417
RESEARCH
Chikungunya Virus Infection during
Pregnancy, Réunion, France, 2006
Xavier Fritel, Olivier Rollot, Patrick Gérardin, Bernard-Alex Gaüzère, Jacques Bideault,
Louis Lagarde, Barbara Dhuime, Eric Orvain, Fabrice Cuillier, Duksha Ramful, Sylvain Sampériz,
Marie-Christine Jaffar-Bandjee, Alain Michault, Liliane Cotte, Monique Kaminski,
Alain Fourmaintraux, and the Chikungunya-Mère-Enfant Team
Mother-to-child transmission of chikungunya virus was
reported during the 2005–2006 outbreak on Réunion Island,
France. To determine the effects of this virus on pregnancy
outcomes, we conducted a study of pregnant women in
Réunion in 2006. The study population was composed of
1,400 pregnant women (628 uninfected, 658 infected during
pregnancy, 27 infected before pregnancy, and 87 infected
on unknown dates). We compared pregnancy outcomes for
655 (628 + 27) women not infected during pregnancy with
658 who were infected during pregnancy. Infection occurred
during the first trimester for 15% of the infected women, the
second for 59%, and the third for 26%. Only hospital admission during pregnancy differed between infected and uninfected women (40% vs. 29%). Other outcomes (cesarean
deliveries, obstetric hemorrhaging, preterm births, stillbirths
after 22 weeks, birthweight, congenital malformations, and
newborn admissions) were similar. This virus had no observable effect on pregnancy outcomes.
C
hikungunya virus infection is transmitted by mosquitoes of the genus Aedes. The virus was first isolated in
1952 and is found in eastern Africa, India, and Southeast
Author affiliations: Centre Hospitalier Régional de la Réunion, SaintDenis, France (X. Fritel, P. Gérardin, B.-A. Gaüzère, E. Orvain, F.
Cuillier, D. Ramful, S. Sampériz, M.-C. Jaffar-Bandjee, A. Michault,
L. Cotte, A. Fourmaintraux); Centre d’Investigation Clinique–Epidémiologie Clinique de la Réunion, Saint-Denis (O. Rollot, P. Gérardin); Institut National de la Santé et de la Recherche Médicale,
Villejuif, France (X. Fritel, P. Gérardin, M. Kaminski); Centre Hospitalier Intercommunal de Saint-Benoit-Saint-André, Saint-Benoit,
France (J. Bideault); Centre Hospitalier Gabriel-Martin, Saint-Paul,
France (L. Lagarde); Clinique Sainte-Clotilde, Saint-Denis (B. Dhuime); and Université Pierre et Marie Curie 6, Paris, France (X. Fritel, P. Gérardin, M. Kaminski)
DOI: 10.3201/eid1603.091403
418
Asia. Symptoms of infection are high fever and disabling
muscle and joint pain, often associated with a rash and
mild bleeding. Persons infected usually recover spontaneously in several days to a week (1). Fever and arthralgia
may occur for several months or even years (2). Patients are
treated only for their symptoms because there is no specific
treatment for the underlying infection (3). Before the recent
outbreak on the island of Réunion, the disease was not considered life-threatening.
Réunion, a French territory in the southwestern Indian
Ocean, has a population of ≈785,000 inhabitants. Medical
facilities in Réunion are similar to those in mainland France
and other industrialized countries. A major chikungunya
outbreak occurred in Réunion in 2005–2006. At the end of
this outbreak, seroprevalence was estimated to be 38.2%
(95% confidence interval [CI] 35.9%–40.6%); 300,000
(95% CI 283,000–320,000) persons were infected (4,5).
Aedes albopictus mosquitoes were the primary vector in
this outbreak.
The outbreak began in eastern Africa (6). It reached
Réunion in March 2005 but was relatively inactive, with
only several thousand cases until November 2005, when
its incidence unexpectedly increased during summer in the
Southern Hemisphere, peaking at 47,000 cases/week during week 5 of 2006. The most recent cases were reported
in August 2006. Comparisons of 2006 with previous years
showed that mortality rates increased during February,
March, and April 2006 (7,8). Since 2006, the virus has
caused several epidemics in the Indian Ocean region (Madagascar, India, Sri Lanka, Thailand, Malaysia, and Singapore). Three new cases of chikungunya were reported in
August 2009 on Réunion Island (9).
The first cases of virus transmission from mother to
child at birth were identified in February 2006; a total of 38
such cases were reported (10,11). The virus was also found
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Chikungunya Virus during Pregnancy
in specimens from 3 early second trimester miscarriages
(12). When this outbreak began, little information was
available about the risk for chikungunya virus infection in
pregnant women. In addition to virus transmission at birth,
potential complications include transplacental transmission
before birth, congenital malformations, stillbirths, growth
restriction, and preterm delivery. Chikungunya virus belongs to the same family of viruses (Togaviridae) as rubella
virus, for which some of these complications have been described (13). The high fever that characterizes chikungunya infection could cause uterine contractions or fetal heart
rate abnormalities, which might promote spontaneous or
induced preterm delivery (cesarean for fetal salvage). The
hemorrhagic syndrome described at the onset of infection
might be manifested by vaginal bleeding during pregnancy
or third-stage hemorrhaging, as reported for infection with
dengue virus (14,15). The proportion of symptomatic and
asymptomatic infections was also unknown.
The purpose of our study (the Chikungunya-MèreEnfant cohort study) was to determine the consequences of
chikungunya infection on pregnancy outcomes. These results will be useful to public health officials and physicians
who provide care for pregnant women or newborns because
chikungunya can be imported by international travelers and
the location of Ae. albopictus mosquitoes has extended beyond the tropics (16). These mosquitoes are found in 26
states in the United States and several countries in Europe,
where outbreaks are possible (17,18).
Methods
We began our study in early April 2006, by planning
to recruit all pregnant women (with or without symptoms
of chikungunya infection) who received care at 1 of the 6
main maternity units in Réunion. These 6 units accounted
for 78% of 14,077 live births in Réunion in 2006. Inclusion
in the study was proposed regardless of the reason for a visit or admission. We had planned to include 3,600 women so
that sufficient children with in utero chikungunya infection
were available to study their psychomotor development. To
show a difference of 10 points in the developmental quotient at 24 months of age, it would have been necessary to
observe 19 children infected in utero. However, because of
the decrease in the outbreak after June 1, we revised our
sample size and included only pregnant women who reported clinical signs suggestive of this infection. The study
cohort was composed of 1,400 pregnant women (mean
term 32 weeks); 1,384 (99%) gave birth in 1 of the 6 participating maternity units. Information on pregnancy outcome
for 16 women lost to follow-up was obtained by contacting
each one directly. A total of 914 participants were included
in April, 386 in May, 88 in June, 5 in July, 2 in August, 4 in
September, and 1 in November. In an ancillary study, for 3
days in May 2006, all women who gave birth in the 6 par-
ticipating units were interviewed to determine how women
in the study cohort differed from those not in the study in
terms of chikungunya symptoms, parity, age, gestational
age of the infant at birth, and mode of delivery.
Serologic status for chikungunya virus infection was
determined at participant’s inclusion in the study. All reports of chikungunya fever were confirmed by using serologic testing or detection of the viral genome in any
specimen by using real-time reverse transcription–PCR
(RT-PCR) (19,20). Serologic tests with negative results
at inclusion were repeated at delivery or when symptoms
suggestive of infection appeared. Histologic examinations
were performed on placentas of all women who had chikungunya infection during pregnancy. RT-PCR was also
performed for placenta and amniotic fluid samples from
women with symptoms at delivery.
Date of infection was determined by checking patient
history of symptoms or by RT-PCR when available. Women were classified into 2 groups: those infected by chikungunya virus during pregnancy (symptoms during pregnancy confirmed by positive serologic or RT-PCR results) and
those not infected (negative serologic results at delivery
or during the preceding 7 days). Women infected before
pregnancy were considered not infected during pregnancy.
We excluded women who were infected but asymptomatic,
those whose symptoms could not be dated, and those with
inconclusive serologic results from analysis.
We analyzed how women infected by chikungunya virus during pregnancy (658) differed from those who were
not infected (655) for general characteristics (age, educational level, marital status, and body mass index), medical
history (diabetes and hypertension), and obstetric history
(previous pregnancies, history of preterm delivery, smallfor-gestational-age, or stillbirths). We then compared
pregnancy outcomes (prenatal hospital admission for any
reason and for chikungunya symptoms, vaginal bleeding
during pregnancy, mode of delivery, obstetric hemorrhage,
stillbirth, preterm birth, birthweight, congenital malformations, and newborn hospitalization) between the 2 groups.
Obstetric hemorrhage was defined as blood loss >500 mL.
We considered only fetal malformations recognized by European Surveillance of Congenital Abnormalities (EUROCAT) (www.eurocat.ulster.antibodies.uk). All malformations recorded were verified by checking either pediatric
files or the Réunion congenital anomalies registry, which is
affiliated with EUROCAT.
Bivariate analysis of pregnancy outcomes compared
means (by Wilcoxon rank-sum test) and percentages (χ2 or
Fisher exact tests). For multivariate analysis, we adjusted
for center, maternal age, educational level, and body mass
index. Logistic regression was used to estimate the adjusted odds ratios (ORs). A p value <0.05 was considered
significant. Sensitivity analyses were performed to deter-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
419
RESEARCH
mine whether results changed when either the 27 infected
before pregnancy or the 100 women included in the study
after May 2006 were omitted from the analysis. Statistical
analysis was performed by using SAS version 9.1 software
(SAS Inc., Cary, NC, USA).
This prospective multicenter study was reviewed and
approved by the ethics committee (Comité de Protection
des Personnes) of Tours (no. 2006–2007). It was reported
to the French Data Protection Authority (Commission Nationale de l’Informatique et des Libertés).
Results
Of 1,400 pregnant women included in the study, 705
(50%) reported chikungunya symptoms during pregnancy,
668 (48%) reported no symptoms, and 27 (2%) reported
symptoms before pregnancy (Table 1). Specific serologic
or RT-PCR tests confirmed the diagnosis of chikungunya
infection for 658 (93%) of 705 who reported symptoms
during pregnancy. In 6 cases (1%), serologic results for
immunoglobulin (Ig) G were negative at delivery, which
ruled out infection. Conclusions could not be reached for
41 women (6%) because of missing or inconclusive laboratory data. Negative serologic findings for IgG confirmed
the absence of chikungunya infection in 622 (93%) of 668
women with no reported symptoms during pregnancy.
Findings were positive for 46 women (7%); these women
were considered asymptomatically infected at an unknown
date and excluded from the analysis. Chikungunya infection was confirmed for all 27 women with symptoms before
pregnancy. Overall, 658 women were classified as infected
by chikungunya virus during pregnancy (exposed) and 655
as not infected during pregnancy (not exposed).
Among the 658 exposed women, infection occurred
during the first trimester for 99 (15%) women, the second
for 387 (59%), and the third for 172 (26%). Infection occurred during the first quarter of 2006 for 536 (81%), before
that for 62 (9.4%), and after that for 60 (9.1%). Maternal
signs and symptoms were fever (408 cases, 62%), arthralgia (615 cases, 93%), headache (354 cases, 54%), edema
(355 cases, 54%), diarrhea (78 cases, 12%), aphthae (63
cases, 9.6%), epistaxis or gingivorrhagia (59 cases, 9.0%),
and rash (496 cases, 76%). Overall, 137 (21%) were hospitalized for chikungunya infection for a median duration
of 2 days (range 1–75 days). Signs of infection began a
median of 108 days before delivery (range 1–263 days),
and only 4 infected women (0.6%) had symptoms in the 7
days before delivery.
Pregnancy outcomes included 656 live births to women
who were infected and 653 to those who were not infected
(including 8 and 14 pairs of twins, respectively); 5 and 8,
respectively, stillbirths after 22 weeks of gestation, and 5
and 8, respectively, miscarriages before 22 weeks. Of the
4 children born to mothers infected by chikungunya during
420
Table 1. Chikungunya virus infections in 1,400 pregnant women,
by onset or lack of symptoms, Réunion, France, 2006*
Symptoms
No. infected
Diagnosis
Symptoms during pregnancy, n = 705
Yes
658
Exposed
No
6
Not exposed
Unknown
41
Excluded
No symptoms, n = 668
Yes
46
Excluded
No
622
Not exposed
Symptoms before pregnancy, n = 27
Yes
27
Not exposed
*Infection was confirmed by positive serologic or reverse transcription–
PCR results. Women infected before pregnancy were considered not
infected during pregnancy.
the last week of pregnancy, 1 newborn had signs of infection on the third day of life, and RT-PCR and IgM serologic analysis confirmed the infection. The mother had had
chikungunya symptoms the day before delivery. The other
3 neonates remained asymptomatic and had no detectable
IgM against chikungunya virus. Of 624 placentas examined
from women found to be infected during pregnancy, only
the placenta from the case of mother-to-child transmission
had histologic signs compatible with viral infection.
RT-PCR was performed to test for the viral genome
in the placenta or amniotic fluid from 3 of the 5 stillbirth
fetuses (>22 weeks) of women with chikungunya infections. The test result was positive in 2 cases, in which chikungunya symptoms in the mothers had begun 25 and 70
days before the fetal loss. For the 8 miscarriages before 22
weeks, RT-PCR was performed on trophoblast tissue for 1
case and the result was negative.
Women infected by chikungunya during pregnancy
were more likely to have been born in Réunion, to have
stopped going to school at a younger age, to be unmarried,
overweight, or already have children (Table 2). They also
differed by maternity center. Multivariate analysis showed
that only 2 characteristics were significantly different: educational level (primary school OR 1.48, 95% CI 1.11–1.97;
high school as reference; university OR 0.54, 95% CI 0.38–
0.77) and being overweight (body mass index >25 kg/m2,
OR 1.76, 95% CI 1.22–2.55).
After we controlled for potential confounders, the
only difference in pregnancy characteristics between infected and uninfected women (Table 3) was the frequency
of hospital admissions during pregnancy (40% vs. 29%).
This difference disappeared when hospital admission for
suspected chikungunya was excluded (26% vs. 28%).
Other maternal and neonatal outcomes were similar in
both groups. Excluding women infected before pregnancy or included after May 2006 from the analysis did not
modify the results (Table 3). Congenital malformations
observed in newborns as a function of maternal exposure
are shown in Table 4.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Chikungunya Virus during Pregnancy
In early May, we conducted a 3-day survey of all women giving birth in the maternity units participating in the
study. Of 113 women interviewed, 43% (49) were included
in the study cohort. The inclusion rate differed according to
maternity unit, ranging from 16% to 88%. The mean proportion of women asked to participate was 62% (70/113),
Table 2. Characteristics of women infected and not infected with chikungunya virus during pregnancy, Réunion, France, 2006*
Characteristic
Infected, no. (%), n = 658
Not infected, no. (%), n = 655
p value†
Born in Réunion
Yes
545 (84.1)
510 (79.2)
No
103 (15.9)
134 (20.8)
0.02
Education
Primary school
331 (52.2)
214 (34.3
<0.0001
High school
198 (31.2)
200 (32.1)
University
105 (16.6)
209 (33.6)
Marital status
Lives alone
252 (39.0)
207 (32.0)
0.008
Lives with partner
394 (61.0)
440 (68.0)
History of diabetes
Yes
17 (2.6)
14 (2.1)
No
641 (97.4)
641 (97.9)
0.59
History of hypertension
Yes
23 (3.5)
27 (4.1)
No
635 (96.5)
627 (95.9)
0.55
Previous pregnancies <22 wks
Yes (>1)
273 (41.6)
258 (39.5)
No
384 (58.4)
395 (60.5)
0.45
Mean parity
1.4 (1.6)
1.1 (1.4)
<0.0001
0
216 (32.9)
278 (42.7)
0.0004
1
199 (30.3)
181 (27.8)
2
110 (16.8)
106 (16.3)
131 (20.0)
86 (3.2)
>3
Previous stillbirth or neonatal death
Yes
22 (3.3)
12 (1.8)
No
636 (96.7)
643 (98.2)
0.08
Previous preterm delivery
Yes
44 (6.7)
27 (4.1)
No
614 (93.3)
626 (95.9)
0.04
Previous child >2,500 g
Yes
70 (10.7)
55 (8.4)
No
587 (89.3)
598 (91.6)
0.17
Previous cesarean
Yes
71 (10.8)
66 (10.1)
No
587 (89.2)
586 (89.9)
0.69
Mean age at delivery, y
28.6 (6.9)
28.8 (6.4)
0.52
<20
71 (10.8)
69 (10.5)
0.94
20–29
309 (47.0)
303 (46.3)
>30
278 (42.2)
283 (43.2)
2
24.7 (5.9)
23.4 (5.1)
<0.0001
Mean body mass index, kg/m
<25
390 (60.8)
454 (71.5)
<0.0001
25–29
137 (21.3)
113 (17.8)
>30
115 (17.9)
68 (10.7)
Center
1
165 (25.1)
188 (28.7)
<0.0001
2
196 (29.8)
153 (23.4)
3
62 (9.4)
71 (10.8)
4
21 (3.2)
9 (1.4)
5
118 (17.9)
182 (27.8)
6
96 (14.6)
52 (7.9)
*Women infected before pregnancy were considered not infected during pregnancy.
†By Wilcoxon rank-sum test for continuous variables and Ȥ2 test for nominal variables.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
421
RESEARCH
Table 3. Pregnancy outcome according to chikungunya virus infection during pregnancy, Réunion, France, 2006*
Infected,†
Not infected,‡
Unadjusted OR
no. (%), n = 658 no. (%), n = 655
(95% CI)
Characteristic
p value
Hospital admission during pregnancy
Yes
266 (40.4)
191 (29.2)
1.65 (1.31–2.07)
No
392 (59.6)
464 (70.8)
<0.0001
1
Hospital admission during pregnancy, suspected infection with chikungunya virus excluded
Yes
180 (28.0)
136 (26.1)
0.91 (0.70–1.18)
No
464 (72.0)
385 (73.9)
0.48
1
Vaginal bleeding during pregnancy
Yes
55 (8.4)
68 (10.4)
0.79 (0.55–1.15)
No
596 (91.6)
584 (89.6)
0.22
1
Obstetric hemorrhaging
Yes
36 (5.6)
42 (6.5)
0.85 (0.54–1.35)
No
609 (94.4)
605 (93.5)
0.49
1
Mode of delivery§
Vaginal
545 (83.8)
530 (81.5)
0.27
1
Cesarean
105 (16.2)
120 (18.5)
0.85 (0.64–1.14)
Mean gestational age, wk§
39.0 (2.1)
38.9 (2.5)
0.55
<32
8 (1.2)
15 (2.3)
0.26
0.52 (0.22-1.24)
32–36
53 (8.2)
60 (9.2)
0.86 (0.59–1.27)
>37
589 (90.6)
575 (88.5)
1
Mean birthweight, g§
3,116 (549)
3.056 (620)
0.27
<2,000
20 (3.1)
32 (4.9)
0.36
0.62 (0.35–1.11)
2,000–2,999
235 (35.9)
236 (35.7)
0.99 (0.79–1.25)
3,000–3,999
372 (56.9)
371 (56.1)
1
27 (4.1)
22 (3.3)
1.22 (0.69–2.19)
>4,000
Stillbirth after 22 wk§
Yes
5 (0.8)
8 (1.2)
0.63 (0.20–1.93)
No
653 (99.2)
656 (98.8)
0.41
1
Congenital malformation
Yes
19 (2.9)
15 (2.2)
1.36 (0.68–2.74)
No
647 (97.1)
654 (97.8)
0.48
1
Admission to neonatal care§
Yes
53 (8.1)
55 (8.3)
0.97 (0.65–1.44)
No
605 (91.9)
609 (91.7)
0.88
1
Adjusted OR
(95% CI)
1.52 (1.18–1.95)
1
0.83 (0.62–1.10)
1
0.94 (0.63–1.42)
1
0.87 (0.53–1.42)
1
1
0.77 (0.56–1.06)
0.48 (0.19–1.23)
0.78 (0.51–1.20)
1
0.66 (0.36–1.22)
1.01 (0.79–1.30)
1
1.25 (0.65–2.39)
0.61 (0.18–2.07)
1
1.54 (0.68–3.49)
1
1.03 (0.67–1.58)
1
*OR, odds ratio; CI, confidence interval. OR was adjusted for center, educational level, body mass index, and maternal age. Women infected before
pregnancy were considered not infected during pregnancy.
†Of the 658 women who were infected, 650 had delivered a child after 22 weeks; 658 children were delivered by these women.
‡Of the 655 women who were not infected, 650 had delivered a child after 22 weeks; 664 children were delivered by these women.
§Miscarriage before 22 weeks was excluded.
and the mean acceptance rate was 70% (49/70); 43% (21)
of the women included thought that they had had chikungunya infection during pregnancy compared with 6% (4) of
those not included (p<0.0001). Mean parity (2.1 vs. 2.6; p
= 0.08), mean maternal age (28.6 years vs. 29.1 years; p =
0.70), mean gestational age at delivery (39.1 weeks vs. 38.7
weeks; p = 0.14), and mode of delivery (18% vaginal vs.
17% cesarean; p = 0.87) did not differ between the women
who were or were not included.
Discussion
In this comparative study, we did not observe any effect of chikungynya infection on pregnancy outcomes except for the number of prenatal maternal hospital admissions for chikungunya symptoms. Our study involved a
high proportion of maternity units and births in Réunion.
Women included in the study in April 2006 accounted for
422
73% (905/1,240) of all live births in Réunion. Systematic
determination of serologic status by identification of specific IgM and IgG confirmed infection status. All patients
for whom chikungunya infection during pregnancy was uncertain were excluded. We excluded women who had positive serologic results but did not report symptoms or have
a positive RT-PCR result because we could not identify the
date of infection. Studies during the outbreak in Réunion
showed that IgM tended to persist for 12 to 24 months and
cannot be used to identify the date of infection (21).
Because inclusion in the study began in April 2006 after
the outbreak had peaked, we could not analyze pregnancies
completed before this date. Therefore, our study does not
describe the consequences of the outbreak on the risk for
miscarriage or preterm delivery during the first quarter of
2006. The study included only pregnancies with outcomes
after that quarter. Most of the women were infected before
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Chikungunya Virus during Pregnancy
Table 4. Congenital malformation classification, according to ICD-10 code, as a function of maternal exposure to chikungunya virus
during pregnancy, Réunion, France, 2006*
Exposure to chikungunya virus during pregnancy,
no. newborns, n = 34
Classification
Yes
No
Chromosomal (Q90, Q91, Q96)
3
1
Neural tube (Q03, Q05)
3
0
Cardiovascular (Q20, Q21, Q25, Q26)
5
1
Kidneys, urinary tract, genital organs (Q53, Q55, Q61, Q62, Q63)
1
5
Limbs, thorax, bones, and spine (Q66, Q69, Q71, Q74, Q76)
5
9
Ear, cleft palate (Q17, Q35)
3
0
Other (D22, Q33, Q40, Q42, Q89, T21)
4
3
*ICD-10, International Classification of Diseases, 10th revision. Total exceeds 34 because 1 child had 3 types of malformations and 7 children had 2
types.
their inclusion. The fact that many women seen in May had
already been included at a previous visit in April explains
why there were fewer inclusions in May; only pregnant
women seen for the first time or who for some reason had
not been included in April were eligible. A disadvantage of
conducting a study during an outbreak is that its duration
cannot be known in advance. For this reason, the number of
women was smaller than planned.
Date of infection was estimated by recording the time
of symptoms and confirmed by RT-PCR and serologic testing. The positive predictive value of symptoms was reliable
because infection was confirmed in ≈93% of women with
suggestive symptoms and ruled out in <1% of these women. The negative predictive value was also reliable because
serologic results were negative for 93% of the women without symptoms. These values are similar to the positive predictive value (91%) and negative predictive value (87%) of
symptoms observed in a survey of a representative sample
of the population in Réunion at the end of 2006 (4). These
results confirm that clinical signs of chikungunya have an
excellent predictive value during an outbreak.
Women who thought that they had had chikungunya
infection during their pregnancy because they had symptoms were more likely to agree to participate in the cohort
than the women without such symptoms. There were also
disparities in the inclusion rate according to maternity center. Because of these differences, women included in this
study were not representative of the population of pregnant
women during this period in Réunion. These differences
in the inclusion rate according to symptoms and hospital
make it impossible to estimate the attack rate of infection
among the population of pregnant women. However, because other characteristics (parity, age, gestational age at
delivery, mode of delivery) were similar, sampling did not
create any bias for comparisons between exposed and unexposed women.
The rarity of placental histologic lesions (in only 1 of
624 women with chikungunya infection during pregnancy)
confirmed the absence of placental infection by the virus
and explained the rarity of cases of fetal chikungunya infec-
tion before birth (22). Couderc et al. recently showed that
human syncytiotrophoblast tissue is refractory to chikungunya infection (23). During the outbreak in Réunion, only
3 cases of fetal chikungunya infection at the beginning of
the second trimester were reported (12). All other reported
cases involved symptomatic newborns with chikungunya
infection in the days after birth, for whom the presumed
mechanism of viral transmission was direct passage from
maternal blood into the fetal circulation through placental
breaches during labor (11). Kwiek and others showed that
maternal–fetal microtransfusions that occur during labor
promote HIV-1 transmission from mother to child (24).
Our results are consistent with those of Gérardin et al.,
who showed that most cases of maternal–fetal transmission
of chikungunya virus occurred at birth (22). Because we
systematically determined chikungunya serologic status,
we could compare pregnancy outcomes between infected
and uninfected women. We found no difference in risk for
hospitalization (except for suspected chikungunya), preterm delivery, low birthweight, or admission to neonatal
care. However, the number of women tested enabled us
to show a difference of 7% for prevalence of admission
during pregnancy, 5% for preterm delivery, 82 g for fetal
weight, and 5% for admission to neonatal care (β = 0.20
and α = 0.05).
Stillbirths were not more frequent among women with
chikungunya infection during pregnancy than among uninfected women, even though >62% of infected women
had fevers. This observation appears to conflict with the
hypothesis that fever plays a direct role in in utero deaths.
However, because of the rarity of this event (0.64% in 2002
in Réunion) (25), the power of the study is insufficient to
justify any definitive conclusion.
In our sample, the minimum detectable difference was
1.8% for stillbirths (0.6% vs. 2.4%, β = 0.20 and α = 0.05).
For early fetal loss before 22 weeks, the number of events
(13/1,313 women) was lower than the number expected
probably because most participants were included after that
term. For this reason, we could not analyze outcome and
reach a conclusion for this point.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
423
RESEARCH
Chikungunya infection can also induce hemorrhagic
complications (11). Overall, 59 infected mothers reported
epistaxis or gingivorrhagia, but these symptoms are frequent in pregnant women. We found no difference in the
risk for vaginal bleeding during pregnancy or for thirdstage hemorrhage.
We observed more congenital malformations in babies
exposed to chikungunya in utero than in unexposed babies
(19 vs. 15). However, this difference was not significant and
we could not reach a definitive conclusion for this factor
because only 99 women in our sample had a chikungunya
infection during the first trimester. It would have required
1,340 children in each group to show a doubling of the risk
(4% vs. 2%) with a power of 80% (β = 0.20 and α = 0.05).
There is no information on long-term consequences of in
utero exposure to chikungunya. Some newborns in our cohort were followed up until the age of 2 years. Analyses are
underway to assess long-term consequences.
Chikungunya infection was more frequent in women
with a lower educational level. That disadvantaged populations are overexposed to transmissible infectious diseases, including dengue and chikungunya, has been shown
(26,27). Therefore, during outbreaks, information and protection for all pregnant women should particularly be emphasized, especially for those whose educational level may
result in a lack of basic knowledge about disease prevention. It might be useful to screen these women actively and
conduct home visits to verify application of basic antivector
measures (destruction of mosquito breeding sites and larval
havens around the home, wearing of long-sleeved clothing,
and use of repellents appropriate for pregnant women and
of mosquito netting).
The chikungunya vector (Ae. albopictus) is found in
Asia, Oceania, North and South America, and Europe. International travel creates the possibility of large-scale epidemics in countries previously considered free of chikungunya (16,28). An epidemic of chikungunya was observed
in a temperate zone (Italy) in 2007 (18). Our results will
provide information for pregnant women in unimmunized
populations during epidemics.
Acknowledgments
We thank the patients for participating in the study; the
healthcare staff at the participating hospitals for accepting an additional workload during the outbreak; Jo Ann Cahn for editorial
assistance; and Georges Barau, Vanessa Basque, Emmanuelle
Bessueille, Anne-Sophie Charpentier, Daniel Daguindeau, François Favier, Marc Gabriele, Jean-François Grandjean, Philippe
Grivard, Annie Lagarde, Joëlle Perrau, Annie Naty, Hanitra Randrianaivo, Jean-Pierre Rivière, Martine Robillard, Pierre-Yves
Robillard, Jean-Claude Sommer, Sandrine Terrentroy, Yasmina
Touret, and Jacques Tuaillon for helping with patient participation.
424
This study was supported by the French Ministry of Health
as part of the Hospital Clinical Research Plan for 2006.
Dr Fritel is a gynecologist and epidemiologist at Centre
Hospitalier Régional de la Réunion, Saint-Denis. His primary research interest is the relationship between pelvic floor disorders
and childbirth.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Pialoux G, Gaüzère BA, Jauréguiberry S, Strobel M. Chikungunya,
an epidemic arbovirosis. Lancet Infect Dis. 2007;7:319–27. DOI:
10.1016/S1473-3099(07)70107-X
Brighton SW, Prozesky OW, de la Harpe AL. Chikungunya virus infection. A retrospective study of 107 cases. S Afr Med J.
1983;63:313–5.
De Lamballerie X, Boisson V, Reynier JC, Enault S, Charrel RN,
Flahault A, et al. On chikungunya acute infection and chloroquine
treatment. Vector Borne Zoonotic Dis. 2008;8:837–9. DOI: 10.1089/
vbz.2008.0049
Gérardin P, Guernier V, Perrau J, Fianu A, Le Roux K, Grivard P, et
al. Estimating chikungunya prevalence in La Réunion Island outbreak by serosurveys: two methods for two critical times of the epidemic. BMC Infect Dis. 2008;8:99. DOI: 10.1186/1471-2334-8-99
Reiter P, Fontenille D, Paupy C. Aedes albopictus as an epidemic
vector of chikungunya virus: another emerging problem? Lancet Infect Dis. 2006;6:463–4. DOI: 10.1016/S1473-3099(06)70531-X
Sergon K, Njuguna C, Kalani R, Ofula V, Onyango C, Konongoi
LS, et al. Seroprevalence of chikungunya virus (CHIKV) infection on Lamu Island, Kenya, October 2004. Am J Trop Med Hyg.
2008;78:333–7.
Josseran J, Solet JL, Renault P, Caillère N, Fouillet A, Le Tertre
A, et al. Description of mortality fluctuations in the Réunion Island population in the context of the 2005–2006 chikungunya
outbreak [in French]. Bulletin Epidémiologique Hebdomadaire 3840:2008:353–7.
Renault P, Josseran L, Pierre V. Chikungunya-related fatality rates, Mauritius, India, and Réunion Island. Emerg Infect Dis.
2008;14:1327.
D’Ortenzio E, Grandadam M, Balleydier E, Dehecq JS, Jaffar-Bandjee JC, Michault A, et al. Sporadic cases of chikungunya, Réunion
Island, August 2009. Euro Surveill. 2009;14:pii: 19324.
Robillard PY, Boumahni B, Gérardin P, Michault A, Fourmaintraux
A, Schuffenecker I, et al. Vertical maternal fetal transmission of
the chikungunya virus. Ten cases among 84 pregnant women [in
French]. Presse Med. 2006;35:785–8. DOI: 10.1016/S0755-4982(06)74690-5
Ramful D, Carbonnier M, Pasquet M, Bouhmani B, Ghazouani J,
Noormahomed T, et al. Mother-to-child transmission of chikungunya virus infection. Pediatr Infect Dis J. 2007;26:811–5. DOI:
10.1097/INF.0b013e3180616d4f
Touret Y, Randrianaivo H, Michault A, Schuffenecker I, Kauffmann E, Lenglet Y, et al. Early maternal-fetal transmission of the
chikungunya virus [in French]. Presse Med. 2006;35:1656–8. DOI:
10.1016/S0755-4982(06)74874-6
Andrade JQ, Bunduki V, Curti SP, Figueiredo CA, de Oliveira
MI, Zugaib M. Rubella in pregnancy: intrauterine transmission
and perinatal outcome during a Brazilian epidemic. J Clin Virol.
2006;35:285–91. DOI: 10.1016/j.jcv.2005.09.007
Carles G, Talarmin A, Peneau C, Bertsch M. Dengue fever and pregnancy. A study of 38 cases in French Guiana [in French]. J Gynecol
Obstet Biol Reprod (Paris). 2000;29:758–62.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Chikungunya Virus during Pregnancy
15.
16.
17.
18.
19.
20.
21.
22.
Waduge R, Malavige GN, Pradeepan M, Wijeyaratne CN, Fernando S, Seneviratne SL. Dengue infections during pregnancy: a
case series from Sri Lanka and review of the literature. J Clin Virol.
2006;37:27–33. DOI: 10.1016/j.jcv.2006.06.002
Charrel RN, de Lamballerie X, Raoult D. Chikungunya outbreaks, the globalization of vectorborne diseases. N Engl J Med.
2007;356:769–71. DOI: 10.1056/NEJMp078013
Centers for Disease Control and Prevention. Information on Aedes
albopictus [cited 2009 Dec 4]. http://www.cdc.gov/ncidod/dvbid/
Arbor/albopic_new.htm
Rezza G, Nicoletti L, Angelini R, Romi R, Finarelli AC, Panning M,
et al. CHIKV study group. Infection with chikungunya virus in Italy:
an outbreak in a temperate region. Lancet. 2007;370:1840–6. DOI:
10.1016/S0140-6736(07)61779-6
Martin DA, Muth DA, Brown T, Johnson AJ, Karabatsos N, Roehrig
JT. Standardization of immunoglobulin M capture enzyme-linked
immunosorbent assays for routine diagnosis of arboviral infections.
J Clin Microbiol. 2000;38:1823–6.
Laurent P, Le Roux K, Grivard P, Bertil G, Naze F, Picard M, et al.
Development of a sensitive real-time reverse transcriptase PCR assay
with an internal control to detect and quantify chikungunya virus. Clin
Chem. 2007;53:1408–14. DOI: 10.1373/clinchem.2007.086595
Grivard P, Le Roux K, Laurent P, Fianu A, Perrau J, Gigan J, et al.
Molecular and serological diagnosis of chikungunya virus infection.
Pathol Biol. 2007;55:490–4. DOI: 10.1016/j.patbio.2007.07.002
Gérardin P, Barau G, Michault A, Bintner M, Randrianaivo H, Choker G, et al. Multidisciplinary prospective study of mother-to-child
chikungunya virus infections on the island of La Réunion. PLoS
Med. 2008;5:e60. DOI: 10.1371/journal.pmed.0050060
23.
24.
25.
26.
27.
28.
Couderc T, Chrétien F, Schilte C, Disson O, Brigitte M, Guivel-Benhassine F, et al. A mouse model for chikungunya: young age and inefficient type-I interferon signaling are risk factors for severe disease.
PLoS Pathog. 2008;4:e29. DOI: 10.1371/journal.ppat.0040029
Kwiek JJ, Mwapasa V, Milner DA Jr, Alker AP, Miller WC, Tadesse
E, et al. Maternal-fetal microtransfusions and HIV-1 mother-to-child
transmission in Malawi. PLoS Med. 2006;3:e10. DOI: 10.1371/journal.pmed.0030010
Rachou E, Riquebourg M, Yovanovitch JD. Perinatal mortality on
Réunion Island, description of 2002 cases [in French] [cited 2009
Dec 4]. http://www.orsrun.net/IMG/file/etudes/mortalite_perinatale_en_2002.pdf
Brunkard JM, Robles López JL, Ramirez J, Cifuentes E, Rothenberg
SJ, Hunsperger EA, et al. Dengue fever seroprevalence and risk factors, Texas–Mexico border, 2004. Emerg Infect Dis. 2007;13:1477–
83.
Raude J, Setbon MB. The role of environmental and individual
factors in the social epidemiology of chikungunya disease on
Mayotte Island. Health Place. 2009;15:659–69. DOI: 10.1016/j.
healthplace.2008.10.009
Enserink M. Tropical disease follows mosquitoes to Europe. Science. 2007;317:1485. DOI: 10.1126/science.317.5844.1485a
Address for correspondence: Xavier Fritel, CHU Jean Bernard,
Gynécologie-Obstétrique, Poitiers CEDEX, France; email: [email protected]
orange.fr
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
425
RESEARCH
Effects of Mumps Outbreak
in Hospital, Chicago, Illinois,
USA, 2006
Amanda L. Bonebrake, Christina Silkaitis, Gaurav Monga, Amy Galat, Jay Anderson,
JoEllyn Tiesi Trad, Kenneth Hedley, Nanette Burgess, and Teresa R. Zembower
In 2006, nearly 6,000 mumps cases were reported in
the United States, 795 of which occurred in Illinois. In Chicago, 1 healthcare institution experienced ongoing transmission for 4 weeks. This study examines the outbreak
epidemiology and quantifies the financial affect on this organization. This retrospective cohort study was conducted
through case and exposure identification, interviews, medical record reviews, and immunologic testing of blood specimens. Nine mumps cases resulted in 339 exposures, 325
(98%) among employees. During initial investigation, 186
(57%) of the exposed employees had evidence of mumps
immunity. Physicians made up the largest group of noncompliers (55%) with mumps immunity testing. The cost to the
institution was $262,788 or $29,199 per mumps case. The
outbreak resulted in substantial staffing and financial challenges for the institution that may have been minimized with
readily accessible electronic employee vaccination records
and adherence to infection control recommendations.
Mumps, a highly contagious illness caused by a
paramyxovirus, causes influenza-like symptoms and salivary gland swelling. Although rare, complications may
include encephalitis, meningitis, orchitis, and oophoritis.
The virus replicates within the upper respiratory tract and
is transmitted through direct contact with respiratory droplets or saliva and through fomites. The incubation period
ranges from 12 to 25 days; persons who contract mumps
are considered infectious from 3 days before symptoms appear through 9 days after symptoms appear. Although no
Author affiliations: University of Illinois at Chicago, Chicago, Illinois,
USA (A.L. Bonebrake); University of Chicago Hospitals, Chicago
(A.L. Bonebrake); and Northwestern Memorial Hospital, Chicago
(C. Silkaitis, G. Monga, A. Galat, J. Anderson, J.T. Trad, K. Hedley,
N. Burgess, T.R. Zembower)
DOI: 10.3201/eid1603.090198
426
specific treatment exists, the disease is preventable through
use of measles, mumps, rubella (MMR) vaccine usually
provided to children ≈1 year of age with a booster dose
administered before children start school. Clinical diagnosis is confirmed by laboratory testing that includes culture,
serologic analysis, or real-time reverse transcription–PCR
(RT-PCR) (1,2).
During January 1–October 7, 2006, 45 states reported
5,783 confirmed or probable cases to the Centers for Disease Control and Prevention (CDC). Six states, including Illinois, were responsible for 84% of reported cases. Mumps
is generally more common among unvaccinated children,
but nationally this outbreak occurred primarily among
college-age persons (3). In Chicago, reported mumps cases
began to increase in March 2006. By the end of the year,
the Chicago Department of Public Health had 73 confirmed
and probable cases. More of these cases were in an older
age group (20–29 years) than was nationally observed (4).
Most healthcare worker (HCW) cases were concentrated in 1 hospital, Northwestern Memorial Hospital (NMH),
Chicago Illinois, USA, which experienced ongoing transmission during April 23–May 23, 2006. The situation created resource and economic challenges to the organization.
We examine the control and effects of this outbreak in a
tertiary care center.
Methods
Clinical Setting and Patient Population
NMH is an 825-bed academic medical center. All adult
patient care rooms are single occupancy; the neonatal intensive care unit (ICU) is multiple occupancy with 8 nurseries each housing 4–12 isolettes (self-contained incubator
units, total of 67 isolettes). The patient cohort comprised all
mumps case-patients and persons exposed to them at NMH
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Effects of Mumps Outbreak in Hospital
during April 23–May 23, 2006. The NMH Institutional Review Board approved this study.
Definitions
According to CDC, a clinical case of mumps is defined as acute onset of unilateral or bilateral tender, selflimited swelling of the parotid or other salivary glands
lasting >2 days without other apparent cause. Confirmed
cases are either laboratory confirmed or meet the clinical
case definition and are epidemiologically linked to a confirmed or probable case. Probable cases meet the clinical
case definition but are neither laboratory confirmed nor
epidemiologically linked to another confirmed or probable
case. Two probable cases that are epidemiologically linked
are considered confirmed, even in the absence of laboratory confirmation (3,5). An exposure is defined as being
within 3 feet of a person with mumps without use of appropriate personal protective equipment (6). A close contact
is a visitor or family member exposed to a person with a
confirmed or probable case. Persons are considered to have
mumps immunity if they have documentation of receipt of
2 doses of mumps-containing vaccine, positive mumps immunoglobulin (Ig) G serologic results, or documentation
of physician-diagnosed mumps (4,7). Persons with mumps
serologies in the indeterminate range are considered nonimmune.
Outbreak Investigation
The NMH Infection Control and Prevention Department (IC) investigated all mumps cases in an attempt to
identify the index case and all persons who were exposed.
Case-patients were placed in airborne infection isolation,
as were exposed, nonimmune patients during their incubation period. Upon hospital discharge, case-patients and exposed patients were instructed to follow-up with the NMH
Infectious Diseases Clinic (ID) or their primary care physicians. Similarly, patients discharged before recognition of
exposure were contacted and referred to either ID or their
primary care physician. IC sometimes needed to assign a
provisional case status and to recommend a disposition before laboratory results were known. All cases were reported
to the jurisdictional local health departments, and NMH
provisional case status was retrospectively compared with
the final case status assigned by the health departments.
According to NMH policy, all employees with communicable work-related illnesses or exposures are evaluated in the Corporate Health Department (CH). During this
outbreak, employees with illnesses consistent with mumps
were evaluated, furloughed through day 9 of their illness,
and cleared by CH before returning to work. Ill employees
were paid either through Workers’ Compensation (WC) after the first 3 days, for which employees are required by the
Illinois State Workers’ Compensation Commission to use
personal time off, or through the Short Term Injury and
Illness Plan. Exposed employees were paid through a furlough account established by NMH during days 12–25 of
the incubation period if nonimmune or while awaiting serologic test results. Employee compensation was managed
through the NMH WC and Human Resources (HR) departments. Close contacts were referred to ID where immunity
was determined at no charge to them.
Infection control data were collected through interviews and medical record review. Patient data were obtained from electronic medical records and employee data
from written medical charts. Data included name, job title
for employees; hospital location; exposure source for cases; and immunologic status, including previous receipt of
MMR vaccine, history of mumps, and mumps serologic
result with laboratory test date.
Vaccine Program
Before 2003, only measles and rubella vaccination
were routinely recorded in employee health records;
thus, mumps vaccination status was often unavailable.
To quickly assess mumps immunity during this outbreak,
an intranet survey was created (SurveyMonkey, Portland,
OR, USA) and made available to all employees. CH personnel reviewed survey results; results were not corroborated during the outbreak because of time constraints. To
facilitate evaluation, counseling, and vaccination, nonimmune employees were seen either in CH, the Northwestern Medical Faculty Foundation Travel Medicine and Immunization Center, or in 1 of 2 satellite clinics established
for this outbreak. Staff were classified as either high-risk
caregivers (HRCs), low-risk caregivers (LRCs) or noncaregivers (NCs) to allow vaccine prioritization. HRCs
were those who worked in areas where mumps cases were
located or worked with pregnant or immunosuppressed
patients. LRCs were persons who cared for patients in
other inpatient or outpatient areas. To conserve resources,
NCs were encouraged to seek evaluation with their primary care physicians but were not turned away if they
sought evaluation at an NMH location.
Laboratory Evaluation
NMH’s Immunology Laboratory performs mumps
qualitative IgG antibody testing. Although most tests were
performed in house, because of a low manufacturer’s supply of test kits, patient IgG testing was sent to a reference
laboratory, and in-house testing was reserved for employees who were within 4 days of furlough. Turnaround time
for the in-house test was decreased from 72 to 24 hours,
and staffing was increased on weekends throughout the
outbreak to ensure timeliness of test results. Reference
laboratory turnaround time was 1–3 days. NMH’s Referred
Testing Department sent serum to a reference laboratory
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
427
RESEARCH
for IgM and IgG antibody testing and buccal swabs to the
Illinois Department of Public Health for RT-PCR.
Financial Effects and Data Analysis
The financial effects were determined by tabulating
the cost of personnel assistance and resource use. The cost
of personnel assistance (i.e., lost productivity) was systematically provided by departmental leaders after the investigation. A total dollar value was assigned each department
by estimating the time spent by each employee on outbreak
and exposure management. The cost for resources, represented by exact dollar amounts, includes medical evaluations, vaccines, laboratory evaluations, and employee
compensation. Data for personnel assistance were stratified
by department and aggregated to provide a total estimate.
Data for resources were stratified by type of activity and
aggregated to provide a total cost. Additionally, an estimate
of the cost of maintaining a routine 2-dose MMR vaccination program and adequate employee medical records was
calculated to compare with the cost of the outbreak. Data
from 2008 were used for this calculation because 2008
was the first year NMH had complete financial records for
the 2-dose MMR vaccination program. Financial data are
rounded to the nearest dollar amount.
Results
Outbreak Investigation
Nine mumps cases occurred at NMH, 7 among employees and 2 among inpatients (Table 1). Six were primary and 3 were secondary cases (Figure 1). Eight cases
were symptomatic. Eight case-patients were women; the
average age of all case-patients was 34 years (range 26–39
years). Two had documented receipt of 2 MMR vaccines, 2
had positive IgM serologic results, and none had documentation of prior mumps infection. Retrospectively, jurisdictional health departments assigned case status as follows:
4 confirmed, 3 probable, and 2 that could not be confirmed
because even though both had clinical symptoms, 1 had
negative laboratory results and the other had no known history of exposure.
During the outbreak, 339 persons (325 employees and
14 close contacts) were reported as having been exposed to
a person with mumps, resulting in an average of 38 exposures per case (Figure 2). Of the 325 employees, 186 (57%)
were deemed immune: 16 (9%) with documented physician-diagnosed mumps, 14 (7%) with documented receipt
of 2 doses of mumps-containing vaccine, and 156 (84%)
with prior laboratory evidence of immunity. None of these
employees required time off work because of the timely reporting of their mumps immune status. The remaining 139
(43%) employees required laboratory testing for immunity.
Of these, 63 (45%) underwent testing, with serologic results as follows: 33 (52%) positive, 11 (18%) equivocal,
and 19 (30%) negative. Overall, 219 (88%) of the 249
HCWs evaluated were immune to mumps. The remaining
76 (55%) employees who required testing for mumps immunity did not comply with CH evaluation (Figure 3). Of
these persons, physicians made up 55%; registered nurses
(RNs), 29%; unit staff, 13%; and nonunit staff, 3%. Fourteen close contacts required laboratory testing for mumps
immunity, and all were immune.
A total of 59 employees were absent from work for
282 days for reasons that included having mumps, being
nonimmune, and awaiting symptom evaluation or laboratory test results (Table 2). Employee time off work ranged
from 1 to 24 days (average 5 days). RNs accounted for
most of the work absences (n = 25, 42%) and took off the
Table 1. Epidemiology of 9 mumps cases, Northwestern Memorial Hospital, Chicago, Illinois, USA, 2006*
Case
Patient
No. MMR vaccine
Date of symptom Serologic test results
no.
age, y/sex
doses received
Clinical signs
onset
IgM
IgG
1
35/F
1
Fatigue, unilateral facial
Apr 24
–
+
swelling
2
30/F
0
Fever, chills, stiff neck, bilateral
May 5
–
+
facial swelling
3
26/F
2
Fatigue, fever, headache, stiff
May 12
IND
+
neck, bilateral facial swelling
4
39/F
0
Headache, sore throat, stiff
May 15
+
IND
neck, myalgias, bilateral facial
swelling
5
38/F
0
Flu-like illness, bilateral facial
May 19
–
+
swelling
6
30/F
0
Headache, sore throat,
May 19
–
+
myalgias, tender
submandibular nodes
7
26/F
2
Sore throat, headache, bilateral
May 22
–
+
facial swelling
8
44/F
1
Bilateral facial swelling
May 22
–
+
9
35/M
0
Asymptomatic
May 23
+
+
*MMR, measles, mumps, rubella; Ig, immunoglobulin; DoH, Department of Health; –, negative; +, positive; IND, indeterminate.
428
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
DoH case
disposition
Not a case
Not a case
Probable
Confirmed
Probable
Probable
Confirmed
Confirmed
Confirmed
Effects of Mumps Outbreak in Hospital
Figure 1. Epidemiology of 9 mumps cases at Northwestern Memorial
Hospital, Chicago, Illinois, USA, April 23–May 23, 2006. Black bars,
community-acquired cases among staff members; white bars,
community-acquired cases among patients; red bars, secondary
cases among staff members; blue bars, presumed work-related
cases among staff members; CT1, first chain of transmission; CT2,
second chain of transmission.
most days (94 days, 33%), followed by resident physicians
(49 days, 17%). Furlough was the most used type of time
off, with 229 days (81%), primarily for nonimmunity (178
days, 78%) followed by furlough awaiting serologic test
results (51 days, 22%).
During April 1–June 31, 2006, 416 mumps IgG serologies were performed at NMH; 58 IgM and 207 IgG serologic results were sent to a reference laboratory. Twentynine buccal swabs were sent to the Illinois State Laboratory
for mumps RT-PCR, and only 2 were positive, both from
outpatients unrelated to the institutional outbreak.
Vaccine Program
Of the 6,600 NMH employees, 5,150 (78%) completed
the intranet survey to assess their mumps immunity (Figure 4). Of these, 1,560 (30%) were HRCs and 3,590 (70%)
were LRCs or NCs. Ninety-one percent of HRCs and 74%
of LRCs and NCs completed the survey. Of the HRCs
who completed the survey, 699 (45%) required additional
follow-up; however, only 355 (51%) complied. Of those
who complied, 228 (64%) received vaccination. In comparison, 1,072 (30%) LRCs and NCs required additional
follow-up, and 386 (36%) complied. Of these, 223 (58%)
received vaccination. Overall, 127 (36%) of HRCs and 163
(42%) of LRCs or NCs either declined or did not require
vaccination. The average time for employee evaluation in
CH was 30–45 minutes, and the 2 satellite clinics operated
for 177 hours. From April 20 through September 1, 2006,
CH administered a total of 755 MMR vaccinations, 451 to
survey participants.
Financial Effects
The estimated cost of personnel assistance during the
mumps outbreak was $66,432, led by IC at $36,746 (55%)
(Table 3). The largest contribution from a hospital unit
was the neonatal ICU at $6,624 (10%). The actual cost of
resources was $196,356. The largest resource contributors were HR resulting from compensation for employee
time off work at $91,318 (47%) and CH at $56,256 (27%)
from time required for medical record review. The total
cost of the outbreak was $262,788, representing a 3:1 ratio
of resource to personnel costs. Cost per mumps case was
$29,199.
In comparison, in 2008 maintaining a routine 2-dose
MMR vaccination program and adequate employee medical records cost ≈$66,025. This figure represents the annual
number of new employees (n = 978), all of whom required
a $30 medical record review and the annual number of
MMR vaccinations given (n = 667) at $55 each. Thus, the
cost of controlling the mumps outbreak was 4× the cost of
maintaining a routine MMR prevention program.
Discussion
Transmission of mumps can occur within hospitals,
but outbreaks with secondary transmission such as the
one at NMH are rarely reported (8,9). One of the most
widely reported incidents of nosocomial transmission occurred during a community mumps outbreak in Tennessee
in 1986–1987 (8). Although only a small number of cases
were nosocomially transmitted, this in-hospital outbreak illustrates the threat that mumps and other illnesses can pose
to patients and HCWs (8,10).
Although investigators have quantified the impact of
nosocomial mumps outbreaks, in-depth analysis of resource
use during a large-scale nosocomial mumps outbreak has
not been published (9,11). Analysis of this outbreak assigned a cost for the resources used and the personnel affected. Most of the resource cost was attributable to HR
9mumpscaseͲpatients
(7employees,2patients)
325employeeexposures
14closecontactexposures
139(43%)requiredserologictesting
186(57%)immune
76(55%)nottestedor
noresultsavailable
16(9%)physicianͲ
documentedmumps
14(7%)vaccination
156(84%)positive
serologictestresults
14(100%)immuneonthebasis
ofpositiveserologictestresults
63(45%)testedforimmunity
33(52%)immuneonthebasis
ofpositiveserologictestresults
11(18%)nonimmune onthebasisof
indeterminateserologictestresults
19(30%)nonimmune onthebasis
ofnegativeserologictestresults
Figure 2. Immune status results among employees and close
contacts exposed to 9 persons who had mumps, Northwestern
Memorial Hospital, Chicago, Illinois, USA, 2006. For those deemed
immune, immunity is grouped based on historical documentation
of serologic status, mumps infection, or vaccination. All others
were required to report for serologic testing during the outbreak;
for those who complied with the required testing, immune status
is provided.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
429
RESEARCH
Figure 3. Mumps immunity status and compliance among employees,
Northwestern Memorial Hospital, Chicago, Illinois, USA, 2006.
Black bars, no. employees with history of immunity; white bars, no.
employees who complied with required antibody titer testing; red
bars, no. employees who did not comply with required antibody
titer testing; black line, percentage of employees in compliance.
Unit staff consisted of nurse managers, secretaries, patient care
technicians, clinical coordinators, and emergency department
assistants; nonunit staff consisted of applications analysts,
counselors, radiographers, resource coordinators, respiratory
therapists, records specialists, safety technicians, patient escorts,
housekeeping workers, and food services workers.
for compensation for staff work absences and to CH for
employee health record review. Additionally, personnel
most affected were from IC and from the neonatal ICU, the
inpatient unit requiring the most staffing substitutions. In
comparison, a nosocomial mumps outbreak in Utah in 1996
reported the total cost of the outbreak in an inpatient pediatric facility was $3,140, substantially lower than our cost
(9). Examination of these 2 outbreaks, however, indicates
that they are not comparable. The Utah facility was much
smaller than NMH (45 vs 825 beds), had fewer staff, and
had only 2 cases. The smaller work environment and magnitude of the outbreak posed less opportunity for exposure
to an infected person and required far fewer resources for
outbreak control. In contrast, a neonatal ICU outbreak of
infection with respiratory syncytial virus, an illness spread
through a similar route, involving 9 infants was reported
to have cost >$1.15 million (12). Although the number of
cases is similar to ours, the increased cost of the outbreak of
infection with respiratory syncyntial virus reflects the need
for intensive care and expensive postexposure prophylaxis
(12). These discrepancies highlight the need for organizations to conduct and report detailed disease-specific analyses to assist similar institutions planning for resource use
during outbreak prevention and control.
At NMH, the lack of complete and easily retrievable
employee health records contributed substantially to the
overall outbreak cost. Until recently, only documentation
of rubella and measles immunity was required and mumps
immune status was often not recorded; additionally, vaccination information was not available electronically. During the outbreak, the need to rapidly evaluate the mumps
immunity of our workforce would have required review of
>6,000 employee health records, a task not deemed practi430
cal to prevent ongoing disease transmission and excessive
employee furlough. This challenge led to development of
an electronic survey to query employees about their mumps
immunity. Although obviously suboptimal, this approach
allowed CH to focus on record review for employees who
either did not know their status or did not respond to the
survey and to manage the ongoing vaccine campaign.
This situation is not unique to NMH. Analysis of previous
mumps outbreaks identified complete and easily retrievable employee vaccination records as an integral step in
reducing the resource and financial costs to the hospital
(8,9,13,14). If employee health information was complete
and accessible, more than one fourth of our outbreak cost
might have been averted.
Vaccination of HCWs is vital to mumps outbreak
prevention. Although numerous outbreaks have occurred
in populations with only 1-dose vaccine coverage, the national mumps outbreak of 2006 occurred during the highest 2-dose vaccine coverage in the United States at 87%,
making this the first large-scale national mumps outbreak
associated with 2-dose vaccine failure. The estimated
herd immunity threshold for mumps ranges from 88% to
92%, and during the outbreak at NMH, 88% of our evaluated workforce reported mumps immunity. The experience nationally and at our institution supports the concept
that an increased level of group-specific immunity may
be required to prevent transmission in settings in which
close or prolonged contact occurs, particularly in crowded conditions, such as those within healthcare institutions
(9,13,15). The possibility of vaccine failure highlights the
need to maximize immunity among HCWs with 2 doses
6,600employees
5,150(78%)employeescompletedsurvey
3,590(70%)lowͲriskornoncaregivers
1,560(30%)highͲriskcaregivers
699(45%)required
corporatehealthfollowͲup
355(51%)received
followͲup
228(64%)
vaccinated
861(55%)selfͲreported
immunity
344(49%)didnot
receivefollowͲup
127(36%)declined
ordidnotrequire
vaccination
1,072(30%)required
corporatehealthfollowͲup
386(36%)received
followͲup
223(58%)
vaccinated
2,518(70%)selfͲ
reportedimmunity
686(64%)didnot
receivefollowͲup
163(42%)declined
ordidnotrequire
vaccination
Figure 4. Survey results of self-reported mumps immunity among
workforce, Northwestern Memorial Hospital, Chicago, Illinois, USA,
2006. Results are categorized by high-risk caregivers, those who
worked in areas where mumps cases were located or worked
with pregnant or immunosuppressed patient populations; lowrisk caregivers, those who cared for patients in other inpatient or
outpatient areas; or noncaregivers. Compliance with corporate
health evaluation and vaccination for those who did not report
immunity are also shown.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Effects of Mumps Outbreak in Hospital
Table 2. Characteristics of employee work absences during mumps outbreak, Northwestern Memorial Hospital, Chicago, Illinois, USA,
2006*
Type of time off
Job title
No. employees
Days allowed
PTO
Registered nurse
1
3
Patient escort
1
2
Short-term injury and illness plan
Unit secretary
1
6
WC
Patient care technician
1
24
Registered nurse
1
10
WC and PTO
Registered nurse
2
8
Furlough
Because of nonimmunity
Registered nurse
9
48
Physician
5
49
Unit staff†
9
42
Nonunit staff‡
7
39
Because of pending titer results
Registered nurse
12
25
Unit staff
8
20
Nonunit staff
2
6
Total
59
282
*PTO, personal time off; WC, workers’ compensation
†Nurse managers, secretaries, patient care technicians, clinical coordinators, emergency department assistants.
‡Applications analyst, counselor, radiographer, resource coordinator, respiratory therapist, records specialist, safety technician, patient escort,
environmental services, food services.
of MMR vaccine and to address the age of administration
of an MMR booster or the addition of a third vaccine dose
to prevent future outbreaks (13–15).
Our outbreak highlights the inaccuracies that can exist
in mumps case recognition, resulting in both underestimation and overestimation of disease. Cases can be underestimated because patients are contagious for days before
symptoms appear, and up to one third of patients never
develop symptoms but can still spread disease. Notably, 1
exposed, asymptomatic employee underwent IgG and IgM
testing and was positive for IgM. Fortunately, no secondary
cases are known to have resulted from exposure to this person. In addition, overestimation can occur when presumptive case status is assigned on the basis of clinical presentation before laboratory results are available. At NMH, 2
probable cases could not be confirmed by the health departments. These cases led to additional exposure evaluations.
Although prompt initiation of infection control measures is
vital to control a mumps outbreak, investigators should be
aware of the challenges in accurate case recognition.
The lack of laboratory resources also increased the
cost of the outbreak. The on-site laboratory testing facility required increased staffing to complete timely serologic
testing and later had a shortage of testing kits. The need
to send specimens to a reference laboratory delayed test
results and led to assignment of presumptive case status
on the basis of symptoms resulting in potentially unnecessary exposure evaluations. In addition, the hospital had
to furlough exposed employees whose immune status was
unknown until serologic results were available.
The lack of compliance with IC recommendations for
exposure evaluation and vaccination was evident primarily
among physicians. This reaction was similar to that dur-
ing a mumps outbreak in 1987 at the Chicago Mercantile
Exchange in which the intense nature and competitiveness
of the profession encouraged employees to work while ill
(16). The reasons for lack of compliance at NMH, particularly among physicians, are unknown, but the urgent nature
of the profession is expected to have played a major role.
That some employees minimized the risk for exposure or
thought the follow-up process was too cumbersome also
has been speculated. Another finding was the discovery of
a few persons who claimed exposure to benefit from time
off work. Cooperation between CH, IC, WC, and HR led to
detection and management of these rare instances.
Table 3. Financial effects of mumps outbreak, Northwestern
Memorial Hospital, Chicago, Illinois, USA, 2006*
Type of expense and department
Cost, US$*
Personnel
Human resources
1,066
Infection control and prevention
36,746
Laboratories
7,312
Medical administration
1,500
Nursing units
10,808
Patient escort
1,200
Risk management
300
Environmental and occupational safety
7,500
Total personnel cost
66,432
Resources
Corporate health
56,256
Human resources employee compensation
91,318
Infectious diseases clinic
1,000
Laboratories
6,842
Travel medicine and immunization center
2,240
Vaccination program
38,700
Total resource cost
196,356
Total cost to hospital
262,788
*Rounded to the nearest dollar.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
431
RESEARCH
When examining the types of employee compensation
provided, an inherent inequality was established. Ill employees were not fully compensated for their work absence
(67% of the employee’s average weekly wage after taking 3
days of personal time off). These employees were required
to take WC, and the rate of compensation is set according to the Illinois Workers’ Compensation Act (www.state.
il.us/Agency/IIC/act.pdf). In contrast, exposed employees
were compensated by a system specifically established for
this outbreak by the hospital because WC will not cover
such costs. These persons were compensated 100% of their
salary. This unbalanced system of reimbursement may require reevaluation for future outbreaks so that ill persons do
not feel penalized or fail to self-disclose illness.
This study has several limitations. First, recall bias
may have occurred, particularly when departmental leaders retrospectively estimated personnel costs. Second, the
reliability of self-reported information obtained through
interviews and the intranet survey regarding mumps immunity was not validated during the outbreak and may have
contributed to either overestimation or underestimation of
mumps immunity in our workforce. Finally, the findings of
this study may not be generalizable because all healthcare
institutions are unique environments.
We examined the effects of the 2006 national mumps
outbreak within a healthcare institution. Our cost of
>$262,000 makes a strong business case for healthcare organizations to improve infectious diseases prevention and
control strategies. A comprehensive program that consists
of maintaining complete electronic employee health records, identifying cases and employee exposures rapidly,
enforcing compliance with infection control recommendations, and developing plans to alleviate laboratory shortages is of paramount importance for outbreak control. Reports of detailed epidemiologic and financial analyses of
infectious disease outbreaks can facilitate emergency preparedness and response planning for comparable healthcare
organizations.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Acknowledgments
We thank Northwestern Memorial Hospital and Northwestern University Feinberg School of Medicine for providing financial support for this research.
Ms Bonebrake is an infection control practitioner at the University of Chicago Medical Center, focusing on maternal-child
health and surgical practices and infections. Her research interests
include issues with interactions between public health and healthcare epidemiology.
16.
Chotani RA, Roghmann M, Perl TM. Nosocomial infections. In:
Nelson KE, Masters Williams CF, editors. Infectious diseases epidemiology: theory and practice, 2nd ed. Sudbury (MA): Jones and
Bartlett Publishers, Inc.; 2007. p. 505–74.
Centers for Disease Control and Prevention. Mumps in short [cited
2008 Oct 3]. http://www.cdc.gov/vaccines/vpd-vac/mumps/in-shortadult.htm
Centers for Disease Control and Prevention. Brief report: update: mumps activity—United States, January 1–October 7, 2006.
MMWR Morb Mortal Wkly Rep. 2006;55:1152–3.
Chicago Department of Public Health. CD info: communicable disease information: mumps. Monthly Morbidity Report. 2007;1–3.
Centers for Disease Control and Prevention. Case definitions for
infectious conditions under public health surveillance. MMWR Recomm Rep. 1997;46(RR-10):1–55.
Centers for Disease Control and Prevention. Mumps—prevention
and control of mumps in healthcare settings [cited 2008 Oct 3].
http://www.cdc.gov/vaccines/vpd-vac/mumps/outbreak/controlhcw.htm
Centers for Disease Control and Prevention. Notice to readers: updated recommendations of the Advisory Committee on Immunization Practices (ACIP) for the control and elimination of mumps.
MMWR Morb Mortal Wkly Rep. 2006;55:629–30.
Wharton M, Cochi SL, Hutcheson RH, Schaffner W. Mumps
transmission in hospitals. Arch Intern Med. 1990;150:47–9. DOI:
10.1001/archinte.150.1.47
Fischer PR, Brunetti C, Welch V, Christenson JC. Nosocomial
mumps: report of an outbreak and its control. Am J Infect Control.
1996;24:13–8. DOI: 10.1016/S0196-6553(96)90048-6
Zivna I, Bergin D, Casavant J, Fontecchio S, Nelson S, Kelley A,
et al. Impact of Bordetella pertussis exposures on a Massachusetts tertiary care medical system. Infect Control Hosp Epidemiol.
2007;28:708–12. DOI: 10.1086/518352
Suyama J, Savitz L, Chang H, Allswede M. Financial implications of
hospital response to bioterrorism based on diagnosis-related group
analysis. Prehosp Disaster Med. 2007;22:145–8.
Halasa NB, Williams JV, Wilson GJ, Walsh WF, Schaffner W,
Wright PF. Medical and economic impact of a respiratory syncytial
virus outbreak in a neonatal intensive care unit. Pediatr Infect Dis J.
2005;24:1040–4. DOI: 10.1097/01.inf.0000190027.59795.ac
Kancherla VS, Hanson IC. Mumps resurgence in the United
States. J Allergy Clin Immunol. 2006;118:938–41. DOI: 10.1016/j.
jaci.2006.07.033
Miller C. Mumps resurgence prompts revised recommendations.
Minn Med. 2007;90:41–3.
Dayan GH, Quinlisk MP, Parker AA, Barskey AE, Harris ML,
Schwartz JM, et al. Recent resurgence of mumps in the United States.
N Engl J Med. 2008;358:1580–9. DOI: 10.1056/NEJMoa0706589
Kaplan KM, Marder DC, Cochi SL, Preblud SR. Mumps in the
workplace. Further evidence of the changing epidemiology of a
childhood vaccine-preventable disease. JAMA. 1988;260:1434–8.
DOI: 10.1001/jama.260.10.1434
Address for correspondence: Teresa R. Zembower, Division of Infectious
Diseases, Northwestern University, 645 N Michigan Ave, Suite 900,
Chicago, IL 60611, USA; email: [email protected]
Search past issues of EID at www.cdc.gov/eid
432
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Blood Meal Analysis to Identify
Reservoir Hosts for Amblyomma
americanum Ticks
Brian F. Allan, Lisa S. Goessling, Gregory A. Storch, and Robert E. Thach
Efforts to identify wildlife reservoirs for tick-borne pathogens are frequently limited by poor understanding of tick–
host interactions and potentially transient infectivity of hosts
under natural conditions. To identify reservoir hosts for lone
star tick (Amblyomma americanum)–associated pathogens,
we used a novel technology. In field-collected ticks, we used
PCR to amplify a portion of the 18S rRNA gene in remnant blood meal DNA. Reverse line blot hybridization with
host-specific probes was then used to subsequently detect
and identify amplified DNA. Although several other taxa of
wildlife hosts contribute to tick infection rates, our results
confirm that the white-tailed deer (Odocoileus virginianus)
is a reservoir host for several A. americanum–associated
pathogens. Identification of host blood meal frequency and
reservoir competence can help in determining human infection rates caused by these pathogens.
Z
oonotic pathogens, which reside in animal reservoir
species and may at times spill over into human populations, are emerging at an unprecedented rate (1). Among
these pathogens, several vector-borne pathogens have
garnered considerable attention for the toll they exact on
human health, which a growing body of evidence indicates may be exacerbated by anthropogenic environmental
change (2–4). A rigorous understanding of the transmission
dynamics of pathogens from infected wildlife hosts to vector organisms is critical to explorations of the ecology of
vector-borne diseases.
Among the most rapidly emerging vector-borne
zoonotic pathogens in the United States are several that
are transmitted by the lone star tick (Amblyomma america-
Author affiliation: Washington University in St. Louis, St. Louis, Missouri, USA (B.F. Allan, L.S. Goessling, R.E. Thach); and St. Louis
Children’s Hospital, St. Louis (G.A. Storch)
DOI: 10.3201/eid1603.090911
num). These pathogens include Ehrlichia chaffeensis and
E. ewingii, both agents of human ehrlichiosis, and Borrelia lonestari, a potential agent of southern tick–associated
rash illness (5). Ticks generally acquire pathogens by 2
primary modes of transmission: vertical (i.e., transovarial)
transmission, whereby the pathogen is acquired maternally
during development of the egg, and horizontally, whereby
the pathogen is acquired through a blood meal on a reservoir-competent and infectious animal host. Recent research
suggests that E. chaffeensis and E. ewingii are acquired
horizontally (6,7); B. lonestari is likely transmitted horizontally and vertically (8). Several lines of evidence suggest that white-tailed deer (Odocoileus virginianus) are a
major reservoir host for all 3 pathogens (9). Nonetheless,
several other species have also been implicated as potential
reservoirs, and our understanding of their relative roles in
disease transmission remains incomplete.
Efforts to identify reservoir hosts for vector-borne
zoonotic pathogens have historically been labor-intensive
exercises, often requiring the capture of potential wildlife
hosts, experimental infection with the pathogen of interest,
and a subsequent examination of the efficiency with which
these hosts pass the infectious agent to vector organisms
under controlled conditions (10). However, such laboratory-based estimates may fail to capture the true distribution
of host reservoir competencies because of unknown consequences of host selection behavior by vector organisms
or the unmeasured contributions of cryptic reservoir hosts
(11). An efficient solution has emerged in the form of host
blood meal identification by molecular methods.
Because of the challenges posed by the duration of tick
life cycles and host-seeking behavior, the feasibility of host
blood meal identification in ticks was only recently established (12). Research efforts have converged upon a 2-step
process: PCR amplification of and labeling with biotin any
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
433
RESEARCH
remnant vertebrate DNA isolated from a tick, and reverse
line blot (RLB) hybridization whereby host-specific oligonucleotide probes are used to detect the biotin-labeled
amplified host DNA. Several researchers have successfully
used this technology to identify the reservoir hosts for numerous pathogens transmitted by Ixodes ricinus, a preeminent vector of tick-borne diseases in Europe (13–16). We
describe the development of host-specific probes and the
identification of host blood meals in wild-caught nymphal
life stage A. americanum and present direct estimates of
the reservoir capacity (an estimate of the absolute contribution of a reservoir host to the prevalence of infection in a
tick population) for white-tailed deer and other reservoir
hosts for the emerging A. americanum–associated zoonotic
pathogens (17).
Materials and Methods
Field Collections
Questing A. americanum ticks were collected from
5 conservation areas and state parks in and surrounding
St. Louis, Missouri, USA, during 2005 and 2007–2008.
Ticks were collected either by dragging a 1-m2 white
cloth along the ground and over vegetation or by using
CO2-baited traps, whereby sublimating dry ice was used
to attract ticks, which then became ensnared on doublesided carpet tape surrounding the trap. Both methods
have proven effective for sampling nymphal and adult
life stages of A. americanum (18). Captured ticks were
removed and preserved in 70% ethanol for future identification and molecular analyses. Sampling efforts were
limited to deciduous forested areas, which are the primary
habitats in which A. americanum completes its life cycle
(5). All subsequent analyses were limited to host-seeking
nymphal life stage ticks, which for A. americanum are often presumed to have taken only 1 prior blood meal in the
larval life stage.
Laboratory Methods
DNA Extraction and Amplification
Nymphal life stage A. americanum were identified under a dissecting microscope before DNA extraction using
the method of Kierans and Durden (19). Ticks were individually processed using 1 of 2 methods. All ticks collected
in 2005 and most of those collected in 2007 were processed
using the ammonium hydroxide method described previously by Pichon et al. (13). The remainder of the 2007
and all of the 2008 ticks were processed using a modified
method described by Hammer et al. (20). The success of
each method of DNA extraction was confirmed by PCR
amplification and agarose gel electrophoresis of tick mitochondrial 16S rDNA as described (21,22).
434
Bacterial DNA was amplified in a multiplex PCR containing 2 sets of primers. Universal primers 0206 and 0209,
previously described by Pichon et al. (13), were used to
amplify a portion of the 16S rDNA, and primers 23SN2
and 5SCB, described previously by Rijpkema et al. (23),
were used to amplify the 23S–5S intergenic spacer of the
Borrelia burgdorferi complex. Primers 0209 and 5SCB
were biotin labeled at the 5′ end to enable detection of the
amplicons in the RLB assay. Primers were obtained from
IDT (Coralville, IA, USA). Each set of amplification reactions contained at least 1 positive control (10 μL of known
pathogen DNA) and 1 negative control (10 μL of DNA extraction negative control).
Vertebrate DNA was amplified by PCR using the biotin
labeled primer 0049, described by Pichon et al. 2003 (13),
and primer 0035 (5′-TTCTAGAGCTAATACATGCCRA
-3′). These primers amplify a portion of the vertebrate (mammal and reptile) 18S rRNA gene. Primers were obtained
from IDT. As with the bacterial DNA amplifications, at least
1 positive control (DNA from vertebrate tissue) and 1 negative control (negative DNA extraction control) were included
with each set of PCRs.
Vertebrate Tissue DNA Extraction, Sequencing,
and Probe Design
A small piece of vertebrate tissue, generally liver or
muscle, was frozen on dry ice and then pulverized. The
sample was then prepared using either the ammonium hydroxide or Chelex method. The resulting supernatant was
removed to a fresh tube and a dilution of this supernatant
was used in the PCRs.
Primers 0066 and 0067 (13) were used to amplify a
350–400-bp fragment of the vertebrate 18S rRNA gene.
This fragment contains the area amplified by primers 0049
and 0035. Primers were obtained from IDT. PCR products
were purified by using the Wizard SV Gel and PCR CleanUp System (Promega Corporation, Madison, WI, USA).
The purified amplicons were double-strand sequenced by
using primers 0066 and 0067 by the Protein and Nucleic
Acid Chemistry Laboratory at Washington University with
ABI Prism Dye Terminator BigDye Premix version 1.1
(Applied Biosystems, Foster City, CA, USA).
MegAlign and EditSeq softwares (DNASTAR, Inc.,
Madison, WI, USA) were used to align and edit sequence
data. The obtained sequences were aligned with 18S sequences found in GenBank and areas of variability were
used to design probes.
Reverse Line Blot Hybridization
An RLB assay was used to identify bacterial DNA
amplified from the tick lysates. In the assay, biotin-labeled
PCR products are hybridized against a set of bacteria-specific probes (Table 1) that have been covalently linked to
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Blood Meal Analysis for A. americanum Ticks
Table 1. Oligonucleotide sequences of bacterial probes used in reverse line blot assay
Probe ID
Nucleotide sequence (5ƍ ĺ 3ƍ)
Target organism (rRNA genes)
Ptg011
AACATGAACATCTAAAAACATAAA
Borrelia garinii (23S–5S)
Ptg012
AACATTTAAAAAATAAATTCAAGG
B. afzelii (23S–5S)
Ptg013
CATTAAAAAAATATAAAAAATAAATTTAAGG
B. valaisiana (23S–5S)
Ptg009
CTTTGACCATATTTTTATCTTCCA
B. burgdorferi s.l. (23S––5S)
Ptg010
AACACCAATATTTAAAAAACATAA
B. burgdorferi s.s. (23S–5S)
Ptg003
CGAACTTCTGGGTCAAGAC
B. burgdorferi s.l. (16S)
Ptg020
AGATAACTACTCTCCGTTTG
B. lonestari (16S)
Ptg022
TCCTAATAGGGGGAGTC
Ehrlichia chaffeensis (16S)
Ptg023
CTTTTAACAGAGGGAGTCA
E. ewingii (16S)
Ptg024
TCCTAACAGGGGGAGTC
E. canis/ovina/muris (16S)
Ptg007
Ptg021
Ptg027
Ptg026
Ptg029
Ptg028
Ptg032
Ptg030
Ptg031
Ptg035
TGGGGATTTTTTATCTCTGTG
CTACCACTGACGCTGAT
CTTCGGAACGCAGTGAC
CTTGGGGAGGACGTTAC
GCCTATRAGTTAATAGCTTGT
TCCTGCGATCTTTCTAGA
CATCCAGGGAAGTAAGC
GCTACAACTGACACTGATG
TACAACTGACGCTAATGC
TCGGAAGATTATCTTTCGG
Anaplasma phagocytophilum (16S)
Rickettsia rickettsii (16S)
Francisella tularensis + F. philomiragia (16S)
F. tularensis subsp. tularensis (16S)
F. philomiragia (16S)
F. endosymbiont of Dv (16S)
Arsenophonus spp. (16S)
R. endosymbiont of Dv (16S)
R. amblyommii + Rickettsia sp. (16S)
R. amblyommii (16S)
Reference sequence
*
*
*
*
*
†
AY166715
M73222
M73227
AY394465, AY318946,
ABO13009
†
DQ150694
Z21932, Z21933
Z21932
Z21933
AF166256
AY265347
AY375427
U11012
U11012
*Designed by Rijpkema et al. 1995 (23).
†Designed by Pichon et al. 2003 (13).
an activated Biodyne C membrane (Pall, Ann Arbor, MI,
USA) by their 5′ amino group. Our method is based on
RLB techniques previously described (13,23).
The probes were applied in lines to an activated membrane using a Miniblotter 45 (Immunetics, Cambridge, MA,
USA). The membrane was stored at 4°C until use. Before
starting the hybridization, the membrane was incubated
in hybridization buffer (0.3 mol/L sodium chloride, 0.02
mol/L sodium phosphate buffer, 0.002 mol/L EDTA, 0.1%
sodium dodecyl sulfate) for 45 min at 42°C. For the hybridization step, the membrane was placed in the Miniblotter with the orientation shifted 90° so that the probe lanes
were aligned perpendicular to the slots. Each slot was filled
with 140 μL of denatured biotinylated PCR products (10
μL PCR products in 140 μL hybridization solution, heated
at 99°C for 10 min, then cooled on ice) and incubated at
42°C for 90 min. The PCR solutions were aspirated off and
the membrane was washed twice with hybridization buffer at room temperature, then twice at 50°C with preheated
buffer. Biotin-labeled PCR products hybridized to probes
were detected using the CDP-Star Universal Detection Kit
(Sigma, St. Louis, MO, USA) and exposure to Blue Ultra
Autorad film (ISC BioExpress, Kaysville, UT, USA).
A second RLB assay using host specific probes was
used to identify vertebrate DNA amplified from the tick
lysates (Table 2). The protocol for the vertebrate RLB was
the same as for the bacterial RLB except the prehybridization wash, hybridization and high stringency wash steps
were all conducted at 62°C.
Tick Identification
To confirm correct identification of A. americanum
nymphs used in our study, we selected 4 tick samples for
which we amplified and then double-strand sequenced a
portion of the tick 16S rRNA gene. The 16S+1 and 16S-2
primers described in Black and Piesman (21) were used for
PCR amplification and sequencing.
Statistical Analyses
All statistics were calculated using Poptools version
3.0 in Microsoft Excel (Microsoft, Redmond, WA, USA)
(24). We used χ2 tests with the Yates continuity correction
to analyze patterns of pathogen co-infection and the distributions of blood meals among hosts. We estimated 95%
confidence intervals for our estimates of reservoir capacity
based upon identifiable blood meals using the Wilson score
method without continuity correction.
Results
Pathogen Detection
Three of the most widely reported pathogens associated with A. americanum (E. chaffeensis, E. ewingii, and
B. lonestari) were detected among collections from >3 of
5 study sites (i.e., each pathogen was detected from ticks
collected at >3 locations). Of the 1,383 nymphal life stage
A. americanum ticks tested, 19 (1.4%) contained E. chaffeensis, 31 (2.2%) contained E. ewingii, and 18 (1.3%)
contained B. lonestari. No co-infections with >1 pathogen
were detected in any tick. However, χ2 analyses for each
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
435
RESEARCH
Table 2. Oligonucleotide sequences of vertebrate probes used in reverse line blot assay*
Probe ID
Probe name
Nucleotide sequence (5ƍ ĺ 3ƍ)
Reference sequence
PRNA010
Aves
CCGACCTCCGGGGACGC
*
PRNA012
Passeriformes
GGGCCCGCCCGGCAGCT
*
PRNA029
Galliformes
GGGCTCGCCCGGCGGCT
*
PRNA042
Squamata/testudines
CGCTGACCTCCGGGGATGC
Sceloporus undulatus (M36359, M59400), Crotaphytus
collaris collaris† (FJ797666), Trachemys scripta†
(FJ797668), Scincella lateralis (AY217908), Eumeces
fasciatus (AY217920), Elaphe obsoleta† (FJ797667),
Heterodon platirhinos (M59392)
PRNA043
Amphibia
CGCTGACCCCCAGGGATGC
Rana amurensis (AF542043), R. chensinensis (AY145522),
Xenopus laevis (X04025)
PRNA045
Ruminantia
GGTCAGCCTCCTCCCGGC
Odocoileus virginianus† (FJ797665), Capreolus capreolus L
(AY150545), Cervus elaphus L (AY150547), Bos taurus
(AY779625)
PRNA018
Leporidae
CGGGGGGGTGGGCGCCG
*
PRNA047
Leporidae/carnivore
GGTCAGCCTCCCCCCGGC
Sylvilagus floridanus (FJ797663), Procyon lotor†
(FJ797659), Felis catus L (AY150542),
PRNA046
Canidae
GGTCAGCCTCCCTCCGGC
Canis latrans† (FJ797662), Canis lupus familiaris†
(FJ797658), C. lupus familiaris (DQ287955), Vulpes vulpes
(AY150549)
PRNA026
Sciurus
CGGTCAGCTTCCCCCCGG
*
PRNA037
Blarina
AGCCTCCCCTCGGCTCCG
Blarina sp.† (FJ797661)
PRNA030
Erinaceus
CTCCCTCCGGCTCCGGC
*
PRNA017
Myodes 1
GAGCTCCCCCGCGGCCC
*
PRNA050
Myodes 2
CGACGGGCGCCGACCCC
Myodes glareolus (AY150543)
PRNA011
Murinae/gerbilinae
CCCTCCCGGCTCCGGCCG
*
PRNA034
Rattus
CGGTCAGCCCCCTCCCGG
Rattus norvegicus (X01117)
PRNA033
Mus
CCGGTGAGCTCCCTCCCGG
Mus musculus (X00686)
PRNA035
Sigmodontinae
TCAGCTCCCTCCCGGCCCC
Peromyscus sp.† (FJ797660), Peromyscus leucopus
(AY591913)
PRNA032
Didelphis
CGGCGGCTTCCCCCTAACC
Didelphis virginiana (J311677)
PRNA048
Mephitis
GGTCAGCCTCTCCCCGGC
Mephitis mephitis† (FJ797664)
*Designed by Pichon et al. 2003 (13).
†Sequence obtained in this study.
pair of pathogens indicated that this outcome did not differ
from random chance (E. chaffeensis and E. ewingii: χ2 =
0.013, df = 1, p = 0.908; E. ewingii and B. lonestari: χ2 =
0.024, df = 1, p = 0.877; B. lonestari and E. chaffeensis: χ2
= 0.359, df = 1, p = 0.549).
Host Probes
DNA from 13 vertebrate species (for which sequences
of 18S rDNA were not available in the GenBank database)
were purified and subsequently amplified for sequencing.
The amplicons were double-strand sequenced and these
sequences together with those available in the GenBank
database were aligned to generate vertebrate host probes
(Table 2). Eventually, 20 host probes were established, and
34 vertebrate species that were identified from the literature
as potentially important hosts were correctly identified to
the matching host probe, with 1 exception (Tamias striatus
reacted with Canidae probe) (Table 3).
Detection of Host DNA
Purified lysates from all 1,383 nymphal life stage A.
americanum screened for pathogenic microbes in the previous analyses were also subjected to host blood meal iden436
tification. Remnant host DNA from 869 (62.8%) of these
ticks hybridized with 10 of the 20 host probes used (Table
4). Of these samples, 389 (44.8%) hybridized to the Ruminantia probe, which for wildlife hosts in the St. Louis, Missouri, region is likely limited to white-tailed deer (Table
3). The remaining blood meals were distributed across a
variety of taxa. DNA from more than 1 host was detected
in 141 nymphal life-stage ticks (Table 4).
Of the 68 A. americanum nymphs containing pathogenic bacteria, 47 (69.1%) contained identifiable vertebrate
DNA (i.e., that hybridized with >1 host probe; Table 5). Of
the 15 E. chaffeensis–positive samples that contained identifiable vertebrate DNA, 8 hybridized only with the Ruminantia probe, and 4 others hybridized with the Ruminantia probe
plus ≥1 additional probes; thus 12 of 15 identifiable samples
hybridized with the Ruminantia probe. The other identifiable E. chaffeensis–positive samples hybridized either with
the Sciurus (n = 2) or the Leporidae (n = 1) probes. For the
23 identifiable E. ewingii–positive samples, 12 contained
DNA that hybridized only with the Ruminantia probe, 3 that
hybridized only with the Sciurus probe, and 1 that hybridized only with the Leporidae probe. All 6 of the identifiable
mixed blood meal DNAs hybridized with ≥2 of these 3 host
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Blood Meal Analysis for A. americanum Ticks
Table 3. Hybridization by host DNA to vertebrate reverse line blot probes
Probe ID
Probe name
Vertebrate DNA hybridized
PRNA010
Aves
Turdus migratorius, Meleagris gallopavo, Gallus gallus, Chen caerulescens
PRNA012
Passeriformes
T. migratorius
PRNA029
Galliformes
M. gallopavo, G. gallus, C. caerulescens
PRNA042
Squamata/testudines
Crotophytus collaris, Elaphe obsoleta, Trachemys scripta elegans
PRNA043
Amphibia
Rana clamitans
PRNA045
Ruminantia
Odocoileus virginianus, Cervus elephus, Bos taurus, Sus scrofa domestica
PRNA018
Leporidae
Sylvilagus floridanus, Sus scrofa domestica
PRNA047
Leporidae/carnivora
S. floridanus, Felis catus, Procyon lotor
PRNA046
Canidae
Canis lupus familiaris, C. latrans, Vulpes vulpes, Tamias striatus*
PRNA026
Sciurus
Sciurus carolinensis, Sciurus niger, S. griseus, Marmota monax
PRNA037
Blarina
Blarina brevicauda, Sorex vagrans
PRNA030
Erinaceus
No hybridization with any vertebrate DNA tested
PRNA017
Myodes 1
Myodes gapperi
PRNA050
Myodes 2
M. gapperi, Microtus californicus
PRNA011
Murinae/gerbilinae
Rattus norvegicus, Mus musculus, Zapus hudsonius
PRNA034
Rattus
Rattus norvegicus
PRNA033
Mus
M. musculus
PRNA035
Sigmodontinae
Peromyscus spp., Neotoma fuscipes
PRNA032
Didelphis
Didelphis virginiana
PRNA048
Mephitis
Mephitis mephitis
*The reaction was confirmed by using 2 tissue samples. The PCR amplicon was sequenced and matches the Canidae probe.
probes. The remaining identifiable E. ewingii–positive sample hybridized only with the Passeriformes probe. For the 9
identifiable B. lonestari–positive samples, 4 hybridized with
the Ruminantia probe, 1 hybridized with the Sciurus probe,
1 hybridized with the Passeriformes probe, and 1 hybridized
with the Squamata/Testudines probe (which is expected to
detect DNA from lizards, snakes, and turtles).
Because there is evidence that B. lonestari can be
transovarially transmitted (8), it is crucial to test whether
the associations between host blood meals and pathogen
infections differ from a distribution expected by random
chance alone. The frequency of association between B.
lonestari infection and the Ruminantia probe (χ2 = 0.033,
df = 1, p = 0.855), the Sciurus probe (χ2 = 0.217, df = 1, p
= 0.641), the Passeriformes probe (χ2 = 0.209, df = 1, p =
0.647), and the Squamata/Testudines probe (χ2 = 0.639, df
= 1, p = 0.424) did not differ from a distribution expected
by random chance. Owing to the detection of host blood
meals in pathogen-positive and pathogen-negative ticks,
we were able to generate estimates of reservoir capacity
(calculated as the proportion of blood meals from a given
host that result in an infection for a given pathogen and
includes the end products of tick feeding and molting success) for each taxonomic grouping of reservoir host and
pathogen species (Table 6).
Tick Identification
Two of the tick samples analyzed contained DNA
that reacted with the Squamata/Testudines probe, 1 of
which was also positive for B. lonestari, and 2 samples
contained DNA that reacted with the Passeriformes probe,
1 of which was also positive for E. ewingii. The sequences
obtained from the 4 ticks were identical except for an extra basepair in 2 of the sequences. The sequences were
compared with 16S sequences of other potential tick species in Genbank and had 98%–100% homology with A.
Table 4. Identification of host DNA in questing Amblyomma americanum nymphs, Missouri, USA, 2005 and 2007–2008
Host data
2005
2007
2008
All
No. nymphs analyzed (no. hosts identified)
75 (33)
489 (240)
819 (596)
1,383 (869)
No. (%) nymphs per identified host
Ruminantia
5 (15.2)
147 (61.3)
237 (39.8)
389 (44.8)
Galliformes
4 (12.1)
16 (6.7)
77 (12.9)
97 (11.2)
Passeriformes
1 (3.0)
17 (7.1)
76 (12.8)
94 (10.8)
Sciurus
17 (51.5)
13 (5.4)
65 (10.9)
95 (10.9)
Leporidae
3 (9.1)
3 (1.3)
15 (2.5)
21 (2.4)
Squamata/testudines
0
15 (6.3)
3 (0.5)
18 (2.1)
Canidae
0
1 (0.4)
7 (1.1)
8 (0.9)
Leporidae/carnivora
0
0
3 (0.5)
3 (0.3)
Sigmodontinae
1 (3.0)
1 (0.4)
1 (0.2)
3 (0.3)
Mixed
2 (6.1)
27 (11.3)
112 (18.8)
141 (16.2)
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
437
RESEARCH
Table 5. Blood meal source in pathogen-positive Amblyomma
americanum nymphs, Missouri, USA, 2005 and 2007–2008
No. A. americanum nymphs infected
Ehrlichia
Borrelia
Host
chaffeensis
E. ewingii lonestari
Ruminantia
8
12
4
Sciurus
2
3
1
Leporidae
1
1
0
Passeriformes
0
1
1
Squamata/testudines
0
0
1
Mixed
4
6
2
Not identified
4
8
9
Total
19
31
18
americanum sequences, but only 84% homology with
Haemaphysalis leporispalustris and 81% homology with
A. tuberculatum.
Discussion
Three of the zoonotic pathogens primarily associated
with A. americanum (E. chaffeensis, E. ewingii, and B.
lonestari) were detected at our field sites at infection rates
in nymphal life stage ticks comparable to levels reported
elsewhere in the region (25,26). Our array of host probes
indicates that A. americanum feed from a variety of vertebrate hosts in the larval life stage, consistent with observations from field studies (5). We found that most nymphal
A. americanum infected with E. chaffeensis fed upon a
white-tailed deer in the larval stage, consistent with the
prevailing hypothesis that this is the major wildlife reservoir for this emerging pathogen (9). Analysis of 3 other E.
chaffeensis-positive blood meals associated with the Sciurus and Leporidae probes suggests that members of the
genus Sciurus (likely fox and gray squirrels, S. niger and
S. carolinensis, respectively) and eastern cottontail rabbits (Sylvilagus floridanus) may also function as wildlife
reservoirs for E. chaffeensis. Most blood meals detected
from E. ewingii–positive ticks were also associated with
the Ruminantia, Sciurus, or Leporidae probes. Considering the lack of evidence for transovarial transmission
of E. chaffeensis (6) and E. ewingii (7), we consider the
wildlife hosts in these taxa to be the major reservoir hosts
in this region.
Table 6. Estimates of reservoir capacity for reservoir hosts of
Amblyomma americanum–associated zoonoses*
% Bloodmeals associated with
pathogen infection (95% CI)
Host
Ehrlichia chaffeensis
E. ewingii
Ruminantia
2.1 (30 –75.2)
3.1 (33.0–70.8)
Sciurus
2.1 (3.7–37.9)
3.2 (4.5–32.1)
Leporidae
4.8 (1.2–29.8)
4.8 (0.8–21.0)
Passeriformes
0
1.1 (0.8–21.0)
Squamata/testudines
0
0
*CI, confidence interval. Borrelia lonestari is omitted because of the
confounding influence of transovarial transmission.
438
No consistent associations between the sources of host
blood meals and infection rates with B. lonestari in nymphal life stage ticks were found. In light of evidence that B.
lonestari can be transovarially transmitted (27), it may not
be possible to determine whether an infected tick acquired
this pathogen through a blood meal from an infective host
or through vertical transmission from mother to offspring.
Therefore, host blood meal identification may not be an
adequate means to identify reservoir hosts for this pathogen. Increased samples sizes combined with knowledge of
transovarial transmission rates may eventually enable researchers to quantify the contributions of reservoir hosts to
infection prevalence of B. lonestari in A. americanum.
Our data enable us to further generate estimates of reservoir capacity, defined as the absolute contribution of a
reservoir host to the prevalence of pathogen infection in a
tick population. This metric includes the influence of host
abundance, the probability that a host is infected, infectivity of that host, and tick feeding and molting success rates
(17). Although this metric should not be mistaken for an
estimate of actual reservoir competence (i.e., the proportion of ticks that become infected from feeding on infective
hosts), it may be more informative because it includes the
outcome of several ecologic processes that ultimately determine human risk of exposure to tick-borne pathogens.
We found that white-tailed deer do not yield the highest
absolute estimates of reservoir capacity for any of the 3
pathogens in our study. However, estimated confidence intervals suggest this outcome may be due to small sample
sizes for estimates of reservoir capacity for other reservoir
hosts. In light of evidence that white-tailed deer are often
infected with these pathogens throughout the range of A.
americanum ticks (28–30), we hypothesize that whitetailed deer may be weakly competent reservoirs for these
pathogens. However, when taking into account the frequency with which A. americanum encounter these abundant hosts, (i.e., reservoir potential) (31), it remains apparent that white-tailed deer are major reservoir hosts for A.
americanum–associated zoonoses.
From the nymphal life stage A. americanum that yielded detectable host DNA in this study, 16.2% hybridized
with >1 taxonomic probe. Mixed blood meals, presumably
caused by bouts of interrupted feeding, have been reported
from other studies on ixodid ticks using host blood meal
identification, at similar rates to those reported here (15,16).
For example, Morán Cadenas et al. reported multiple host
detections from 19.2% of detectable blood meals in Ixodes
ricinus, with no differences between nymphal and adult
life stages (15). The absence of a detectable blood meal
in 37.2% of the A. americanum nymphs examined in our
study is also consistent with results from other studies using host blood meal identification in ixodid ticks (13–16).
We speculate that the degradation of remnant host DNA is
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Blood Meal Analysis for A. americanum Ticks
the primary cause of this phenomenon, because our ability to detect host blood meals declined later in the season
(unpub. data).
It is crucial to temper our conclusions about the role
of various hosts derived from our data with some exploration of other factors that may influence the outcome of host
blood meal identification. Various factors may influence
the detectability of host blood meals, such as the presence
of nucleated erythrocytes, host blood volume, permissiveness of hosts (a measure of the ability of a tick to successfully feed to repletion on a given host), and the region of
DNA targeted for analysis (12). Because the first step of the
PCR in our study is subject to dominant template bias, remnant DNA from nucleated erythrocytes may mask mammalian DNA present in mixed blood meals. Additionally, we
did not directly quantify the sensitivity of our various host
probes, although we did attempt to identify host probe concentrations that yielded equivalent reactions. Nonetheless,
variation in host probe sensitivity may introduce another
source of error in our findings. In light of these potential
limitations to host blood meal identification, field-based
studies will remain necessary in order to determine if host
blood meal distributions are consistent with the availability
of hosts and host-vector interactions.
Host blood meal identification by molecular methods
offers a direct and efficient approach for understanding
the contributions of both reservoir competent and incompetent hosts to the transmission dynamics of tick-borne
diseases. Through this emerging technology, we show the
major role played by white-tailed deer in facilitating the
emergence of A. americanum–associated zoonoses. However, the apparent contributions of various other hosts to
pathogen transmission highlight the need for a community
approach to understanding vector-borne zoonoses. Future
applications of these methods will generate information
for approaching a variety of topics of pressing concern
to public health, including the potential impact of anthropogenic landscape change on human risk of exposure to
zoonotic pathogens.
ciety to B.F.A. and Washington University Research Support for
Senior Administrators to R.E.T.
Acknowledgments
We thank Jonathan Chase, Felicia Keesing, Richard Ostfeld, the Chase Laboratory group, and 2 anonymous reviewers
for helpful comments and suggestions. We also thank Monique
Gaudreault-Keener for help with laboratory analyses and Russell Blaine, Kelly Oggenfuss, Richard Ostfeld, Maria Thaker, and
Walter Wehtje for help with obtaining vertebrate tissue samples.
11.
This research was supported by a Doctoral Dissertation Improvement Grant from the National Science Foundation, a Science
to Achieve Results Graduate Fellowship from the Environmental
Protection Agency, and a Lewis and Clark Fund for Exploration
and Field Research Grant from the American Philosophical So-
Dr Allan is a postdoctoral fellow studying the community
ecology of vector-borne diseases at Washington University’s Tyson Research Center. His research interests include understanding
the effects of anthropogenic environmental change on the emergence of infectious diseases vectored by ticks and mosquitoes.
References
1.
2.
3.
4.
5.
6.
7.
9.
10.
12.
13.
14.
Jones KE, Patel NG, Levy MA. Global trends in emerging infectious
diseases. Nature. 2008;451:990–4. DOI: 10.1038/nature06536
Ostfeld RS, Keesing F, Schauber EM, Schmidt KA. The ecological
context of infectious disease: diversity, habitat fragmentation, and
Lyme disease risk in North America. In: Aguirre A, Ostfeld RS, Tabor G, House CA, Pearl M, editors. Conservation medicine: ecological health in practice. New York: Oxford University Press; 2002. p.
207–19.
Patz JA, Daszak P, Tabor GM, Aguirre AA, Pearl M, Epstein J,
et al. Unhealthy landscape: policy recommendations on land use
change and infectious disease emergence. Environ Health Perspect.
2004;112:1092–8.
Dobson A, Cattadori I, Holt RD, Ostfeld RS, Keesing F, Krichbaum
K, et al. Sacred cows and sympathetic squirrels: the importance of
biological diversity to human health. PLoS Med. 2006;3: e231. DOI:
10.1371/journal.pmed.0030231
Childs JE, Paddock CD. The ascendancy of Amblyomma americanum as a vector of pathogens affecting humans in the United States.
Annu Rev Entomol. 2003;48:307–37. DOI: 10.1146/annurev.
ento.48.091801.112728
Long SW, Zhang X, Zhang J, Ruble RP, Teel P, Yu XJ. Evaluation
of transovarial transmission and transmissibility of Ehrlichia chaffeensis (Rickettsiales: Anaplasmataceae) in Amblyomma americanum (Acari: Ixodidae). J Med Entomol. 2003;40:1000–4. DOI:
10.1603/0022-2585-40.6.1000
Stromdahl EY, Vince MA, Billingsley PM, Dobbs NA, Williamson PC. Rickettsia amblyommii infecting Amblyomma americanum larvae. Vector-Borne Zoonot Dis. 2008;8:1–9. DOI: 10.1089/
vbz.2007.0136
Paddock CD, Yabsley MJ. Ecological havoc, the rise of white-tailed
deer, and the emergence of Amblyomma americanum-associated
zoonoses in the United States. Curr Top Microbiol. 2007;315:289–
324. DOI: 10.1007/978-3-540-70962-6_12
LoGiudice K, Ostfeld RS, Schmidt KA, Keesing F. The ecology of
infectious disease: effects of host diversity and community composition on Lyme disease risk. Proc Natl Acad Sci U S A. 2003;100:567–
71. DOI: 10.1073/pnas.0233733100
Brisson D, Dykhuizen DE, Ostfeld RS. Conspicuous impacts of inconspicuous hosts on the Lyme disease epidemic. Proc R Soc B.
2008;275:227–35. DOI: 10.1098/rspb.2007.1208
Kent RJ. Molecular methods for arthropod blood meal identification and applications to ecological and vector-borne disease studies. Mol Ecol Resour. 2009;9:4–18. DOI: 10.1111/j.1755-0998
.2008.02469.x
Pichon B, Egan E, Rogers M, Gray J. Detection and identification of
pathogens and host DNA in unfed host-seeking Ixodes ricinus L. J
Med Entomol. 2003;40:723–31. DOI: 10.1603/0022-2585-40.5.723
Pichon B, Rogers M, Egan D, Gray J. Blood meal analysis for the
identification of reservoir hosts for tick-borne pathogens in Ireland. Vector-Borne Zoonot Dis. 2005;5:172–80. DOI: 10.1089/
vbz.2005.5.172
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
439
RESEARCH
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
Morán Cadenas FM, Rais O, Humair PF, Douet V, Moret J, Gern L.
Identification of host blood meal source and Borrelia burgdorferi
sensu lato in field-collected Ixodes ricinus ticks in Chaumont (Switzerland). J Med Entomol. 2007;44:1109–17. DOI: 10.1603/00222585(2007)44[1109:IOHBSA]2.0.CO;2
Humair PF, Douet V, Cadenas FM, Schouls LM, Van de Pol I, Gern L.
Molecular identification of blood meal source in Ixodes ricinus ticks
using 12S rDNA as a genetic marker. J Med Entomol. 2007;44:869–
80. DOI: 10.1603/0022-2585(2007)44[869:MIOBSI]2.0.CO;2
Gray JS, Kahl O, Lane RS, Stanek G, eds. Lyme borreliosis: biology,
epidemiology and control. Oxford (UK): CABI Publishing; 2002.
Schulze TL, Jordan RA, Hung RW. Biases associated with several
sampling methods used to estimate abundance of Ixodes scapularis
and Amblyomma americanum (Acari: Ixodidae). J Med Entomol.
1997;34:615–23.
Keirans JE, Durden LA. Illustrated key to nymphs of the tick genus
Amblyomma (Acari: Ixodidae) found in the United States. J Med
Entomol. 1998;35:489–95.
Hammer B, Moter A, Kahl O, Alberti G, Gobel UB. Visualization of
Borrelia burgdorferi sensu lato by fluorescence in situ hybridization
(FISH) on whole-body sections of Ixodes ricinus ticks and gerbil
skin biopsies. Microbiol. 2001;147:1425–36.
Black WC IV, Piesman J. A phylogeny of hard and soft tick taxa based
on mitochondrial 16S ribosomal DNA sequences. Proc Natl Acad
Sci U S A. 1994;91:10034–8. DOI: 10.1073/pnas.91.21.10034
DeShields A, Borman-Shoap E, Peters JE, Gaudreault-Keener M,
Arens MQ, Storch GA. Detection of pathogenic ehrlichia in ticks
collected at acquisition sites of human ehrlichiosis in Missouri. Mo
Med. 2004;101:132–7.
Rijpkema SG, Molekenboer MJ, Schouls LM, Jongejan F, Schellekens JG. Simultaneous detection and genotyping of three genomic
groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus
ticks by characterization of the amplified intergenic spacer region between 5S and 23S rRNA genes. J Clin Microbiol. 1995;33:3091–5.
Hood GM. 2008. PopTools version 3.0.6. http://www.cse.csiro.au/
poptools
25.
26.
27.
28.
29.
30.
31.
Bacon RM, Gilmore RD Jr, Quintana M, Piesman J, Johnson BJ.
DNA evidence of Borrelia lonestari in Amblyomma americanum (Acari: Ixodidae) in southeast Missouri. J Med Entomol.
2003;40:590–2. DOI: 10.1603/0022-2585-40.4.590
Mixson TR, Campbell SR, Gill JS, Ginsberg HS, Reichard MV,
Schulze TL, et al. Prevalence of Ehrlichia, Borrelia, and Rickettsial
agents in Amblyomma americanum (Acari: Ixodidae) collected from
nine states. Vector-Borne Zoonot. 2006;43:1261–8.
Stromdahl EY, Williamson PC, Kollars TM, Evans SR, Barry RK,
Vince MA, et al. Evidence for Borrelia lonestari DNA in Amblyomma americanum (Acari: Ixodidae) removed from humans. J
Clin Microbiol. 2003;41:5557–62. DOI: 10.1128/JCM.41.12.55575562.2003
Yabsley MJ, Varela AS, Tate CM, Dugan VG, Stallknecht DE, Little
SE, et al. Ehrlichia ewingii infection in white-tailed deer (Odocoileus virginianus). Emerg Infect Dis. 2002;8:668–71.
Arens MQ, Liddell AM, Buening G, Gaudreault-Keener M, Sumner
JW, Comer JA, et al. Detection of Ehrlichia spp. in the blood of wild
white-tailed deer in Missouri by PCR assay and serologic analysis.
J Clin Microbiol. 2003;41:1263–5. DOI: 10.1128/JCM.41.3.12631265.2003
Moore VA IV, Varela AS, Yabsley MJ, Davidson WR, Little SE. Detection of Borrelia lonestari, putative agent of southern tick-associated rash illness, in white-tailed deer (Odocoileus virginianus) from
the southeastern United States. J Clin Microbiol. 2003;41:424–7.
DOI: 10.1128/JCM.41.1.424-427.2003
Brunner JL, LoGuidice KL, Ostfeld RS. Estimating reservoir competence of Borrelia burgdorferi hosts: prevalence and infectivity,
sensitivity, and specificity. J Med Entomol. 2008;45:139–47. DOI:
10.1603/0022-2585(2008)45[139:ERCOBB]2.0.CO;2
Address for correspondence: Brian F. Allan, Tyson Research Center,
Washington University in St. Louis, 6750 Tyson Valley Rd, Eureka, MO
63025, USA; email: [email protected]
Notice to Readers
and Contributing Authors
Conference summaries/reports are published
online only. Manuscripts submitted for online
publication may include illustrations and
relevant links.
For more information on online only
requirements, please refer to author guidelines at
http://www.cdc.gov/ncidod/eid/instruct.htm
Submit manuscripts at
http://www.eid.manuscriptcentral.com
440
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Borrelia, Ehrlichia, and Rickettsia
spp. in Ticks Removed from Persons,
Texas, USA
Phillip C. Williamson, Peggy M. Billingsley, Glenna J. Teltow, Janel P. Seals,
Meredith A. Turnbough, and Samuel F. Atkinson
Data regarding the type, frequency, and distribution of
tick-borne pathogens and bacterial agents are not widely
available for many tick species that parasitize persons in
the southern United States. We therefore analyzed the frequency and identity of pathogens and bacterial agents in
ticks removed from humans and subsequently submitted to
the Texas Department of State Health Services, Zoonosis
Control Program, from October 1, 2004, through September
30, 2008. The data showed associations of bacterial agents
and potential vectors. Tick-related illnesses may pose unidentified health risks in areas such as Texas, where incidence of human disease related to tick bites is low but well
above zero and where ticks are not routinely suspected as
the cause of disease. Cause, treatment, and prevention
strategies can be better addressed through collecting sufficient data to establish baseline assessments of risk.
D
ata concerning the full distribution of tick-borne agents
and their potential relationship to both emerging and
characterized illnesses in the southern United States are not
widely available. Persons who become ill after a tick bite
may be at increased risk because a tick bite may not be
considered as the source of the pathogen and because of the
length of time that febrile illness may elude effective treatment. Detailed knowledge of the causative agents, their distribution, and their relationship to potential vectors is also
lacking. Most tick survey data for microorganisms in the
genera Borrelia, Rickettsia, and Ehrlichia have been collected in areas where the associated diseases are considered
Author affiliations: University of North Texas Health Science Center, Fort Worth, Texas, USA (P.C. Williamson, P.M. Billingsley, J.P.
Seals); Texas Department of State Health Services, Temple, Texas,
USA (G.J. Teltow); and University of North Texas, Denton, Texas,
USA (M.A. Turnbough, S.F. Atkinson)
DOI: 10.3201/eid1603.091333
endemic. Lyme disease, Rocky Mountain spotted fever, or
human monocytotrophic ehrlichiosis are not considered to
be endemic to Texas. Studies of microorganisms carried in
ticks in non–disease-endemic areas might provide information about potentially pathogenic organisms, their vectors,
and reservoirs. These data might also provide an opportunity to examine the ecology of emerging zoonoses for which
different ecologic determinants for disease transmission
may be present.
In 2000, the 77th Texas Legislature Subcommittee on
Administration prepared a report addressing the potentially
severe nature of tick-borne disease in Texas. As of October
1, 2004, the Tick-Borne Disease Research Laboratory at
the University of North Texas Health Science Center (UNTHSC) became the primary facility for testing ticks submitted to the Texas Department of State Health Services
(TX DSHS).
Methods
From October 1, 2004, through September 30, 2008,
tick specimens were submitted to UNTHSC through the
Zoonosis Control Program of the TX DSHS. Only ticks that
had been attached to a person were submitted to UNTHSC,
where they were screened for the genera Borrelia, Rickettsia, and Ehrlichia with genus-specific PCRs. Ticks were
identified to the species level by TX DSHS entomologists
before being transferred to UNTHSC (1–3). Poor condition
of some specimens made identification by morphologic
examination difficult. Unidentified ticks were conclusively
identified by molecular methods developed at UNTHSC,
which used amplification of 12S rDNA (Table 1) and sequence determination (data not shown). Additionally, the
identity of any tick containing an organism not previously
reported in that species was also confirmed by the same molecular methods. Of all tick specimens, 10% were screened
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
441
RESEARCH
by the same molecular identification technique to verify the
accuracy of morphologic identification.
Ticks were bisected laterally by using aseptic technique and a sterile scalpel blade. For independent verification of results, half of each tick was stored in 100% ethanol
at –80°C. For larvae and nymphs, the entire tick was used
for DNA extraction. Total DNA was isolated from the second half by using an E.N.Z.A. Mollusc DNA Isolation Kit
(Omega Bio-Tek, Inc., Norcross, GA, USA) according to
manufacturer’s recommended protocol. Extracted DNA
was subjected to PCR that used primers for the amplification of the tick’s 12S rDNA or Borrelia spp., Ehrlichia
spp., and Rickettsia spp. genes (Table 1).
The locations of PCR setup and PCR product handling
were physically separated. Reaction setup was performed
in a class II type B2 biological safety cabinet that had been
cleaned with 0.6% sodium hypochlorite daily and UV ir-
radiated for 30 min before and after each use. To minimize
risk for contamination, pipettor sets were dedicated to specific functions, i.e., reagent dispensing, template isolation,
PCR setup, and template handling. Certified DNA/RNasefree filter barrier tips were used to prevent aerosol contamination. PCR setup was never performed in the presence
of isolation materials, and reagent handling was separated
both physically and temporally from templates. PCR assays
were performed in duplicate with appropriate controls.
A typical, initial PCR was performed in a 25-μL reaction volume by using 5 pmol/L of each appropriate primer
in conjunction with a final reaction concentration of 1× GeneAmp PCR Buffer II (Applied Biosystems, Foster City,
CA, USA), 160 ng/μL bovine serum albumin, 1.0 mmol/L
MgCl2, 200 μmol/L of each dNTP, 1.25 U Amplitaq (Applied Biosystems), and 10 μL of template. To establish the
species of the tick specimen, we amplified 12S rDNA with
Table 1. Nucleotide sequence of primers used for PCR screening of tick specimens removed from humans, Texas, October 1, 2004, to
September 30, 2008*
Primer name
Gene
Primer sequence (5ƍ ĺ 3ƍ)
Specificity
Screen
TM
Reference
Tick DNA
85F
TTAAGCTTTTCAGAGGAATTTGCTC
Unknown
Primary
54.0
This study
12S
225R
TTTWWGCTGCACCTTGACTTAA
Unknown
Primary
52.7
This study
12S
Borrelia spp.
FlaLL
ACATATTCAGATGCAGACAGAGGT
Genus
Primary
58.3
(4)
flaB
FlaRL
GCAATCATAGCCATTGCAGATTGT
Genus
Primary
58.9
(4)
flaB
FlaLS
AACAGCTGAAGAGCTTGGAATG
Genus
Primary
57.5
(4)
flaB
FlaRS
CTTTGATCACTTATCATTCTAATAGC
Genus
Primary
53.3
(4)
flaB
BL-Fla 522F
GGTACATATTCAGATGCAGACAGAGGG
Primary
61.3
This study
flaB
B. lonestari
BL-Fla 1182R
GCACTTGATTTGCTTGTGCAATCATAGCC
Primary
64.0
This study
flaB
B. lonestari
BL-Fla 662F
CTGAAGAGCTTGGAATGCAACCTGC
Primary
62.8
This study
flaB
B. lonestari
BL-Fla 860R
GAGCTAATCCCACCTTGAGCTGG
Primary
61.2
This study
flaB
B. lonestari
BL-Fla 341F
AGCTGATGATGCTGCTGGTATGGG
Genus
Alternate
63.2
This study
flaB
BL-Fla 730R
GCTTGTGCTCCAGTTAGTGATGCTGG
Genus
Alternate
64.1
This study
flaB
BL-16S 227F
TCACACTGGAACTGAGATACGGTCC
Genus
Alternate
62.1
This study
16S
BL-16S 920R
GAATTAAACCACATGCTCCACCGC
Genus
Alternate
61.0
This study
16S
BL-HSP 71F
CTTATGTTGAAGGAATGCAATTTGA
Alternate
55.6
This study
groEL
B. lonestari
BL-HSP 271R
CAATATCTTCAGCAATAATTAGCAAAGGT
Alternate
58.2
This study
groEL
B. lonestari
Rickettsia spp.
Rr.190 70P
ATGGCGAATATTTCTCCAAAA
Genus
Primary
52.5
(5)
rompA
Rr.190 602N
AGTGCAGCATTCGCTCCCCCT
Genus
Primary
64.9
(5)
rompA
BG1–21
GGCAATTAATATCGCTGACGG
Genus
Alternate
55.6
(6)
rompB
BG2–20
GCATCTGCACTAGCACTTTC
Genus
Alternate
55.2
(6)
rompB
RrCS 372
TTTGTAGCTCTTCTCATCCTATGGC
Genus
Alternate
59.0
(7)
gltA
RrCS 989
CCCAAGTTCCTTTAATACTTCTTTGC
Genus
Alternate
57.5
(7)
gltA
Primer 1
GCTCTTGCAACTTCTATGTT
Genus
Alternate
52.3
(8)
17kDa
Primer 2
CATTGTTCGTCAGGTTGGCG
Genus
Alternate
57.9
(8)
17kDa
Ehrlichia spp.
Ehr DSB 330F
GATGATGTCTGAAGATATGAAACAAAT
Genus
Primary
55.5
(9)
dsb
Ehr DSB 728R
CTGCTCGTCTATTTTACTTCTTAAAGT
Genus
Primary
56.6
(9)
dsb
ECC-F
AGAACGAACGCTGGCGGCAAGCC
Genus
Alternate
68.1
(10)
16S
ECB-R
CGTATTACCGCGGCTGCTGGCA
Genus
Alternate
65.6
(10)
16S
ECAN-F
ATTTATAGCCTCTGGCTATAGGA
Alternate
54.9
(11)
16S
E. canis
HE1-F
CAATTGCTTATAACCTTTTGGTTATAAAT
Alternate
55.6
(12)
16S
E. chaffeensis
EE72-F
AATTCCTAAATAGTCTCTGACTATT
Alternate
52.6
(11)
16S
E. ewingii
HE3-R
TATAGGTACCGTCATTATCTTCCCTAT
Genus
Alternate
57.6
(13)
16S
*TM, melting temperature, °C.
442
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Borrelia, Ehrlichia, and Rickettsia spp. in Ticks
the following cycle parameters: 95°C for 5 min; then 40
cycles each consisting of 95°C for 30 s, 45°C for 30 s, 72°C
for 60 s; and a final 72°C extension for 5 min. Thermal cycling parameters for the initial PCRs of bacterial genes were
95°C for 5 min; then 40 cycles each consisting of 95°C for
60 s, 55°C for 60 s, 72°C for 30 s; and a final 72°C extension for 5 min. Nested PCR was performed by using the
same reaction setup and 1.0 μL of amplified PCR mix as
template. Nested PCR setup was performed in a dedicated
dead air space cabinet that had been decontaminated in the
same manner as the class II type B biosafety cabinet. The
thermal cycling profile for the nested reactions was 95°C
for 5 min; then 30 cycles each consisting of 95°C for 60
s, 55°C for 60 s, 72°C for 60 s; and a final 72°C extension
for 5 min.
Verification of amplification was performed by agarose
gel electrophoresis, followed by staining with 1X SYBR
Green I (BioWhittaker Molecular Applications ApS, Rockland, ME, USA). Amplicons were examined with a UVP
EC3 Imaging System (UVP, LLC, Upland, CA, USA) and
subsequently analyzed by VisionworksLS Image Acquisition and Analysis Software (UVP, LLC). Secondary PCR
systems (Table 1) were used to confirm positive results and
did not contain primers that would amplify control DNA
commonly used in the laboratory. Unincorporated primers
were removed from samples producing amplicons before
sequence determination by using ExoSAP-IT (USB Corporation, Cleveland, OH, USA).
DNA sequencing was performed for both strands of
the PCR amplicons by using a BigDye Terminator Cycle
Sequencing Kit, version 3.1 (Applied Biosystems). Unincorporated dye terminators were removed before electrophoresis by using Performa DTR Gel Filtration Cartridges
(Edge BioSystems, Gaithersburg, MD, USA). Capillary
electrophoresis was performed by using an ABI PRISM 310
Genetic Analyzer (Applied Biosystems). Final sequence
analysis and editing was performed by using Sequencer 4.7
(Gene Codes Corporation, Ann Arbor, MI, USA). Using
BLASTN, version 2.2.10 (www.ncbi.nlm.nih.gov/blast/
Blast.cgi), we then compared edited sequence data with genetic sequences from characterized examples of Borrelia
spp., Rickettsia spp., and Ehrlichia spp. published in GenBank.
Results
A total of 903 ticks, representing 11 tick species, were
submitted to UNTHSC from 138 of 254 Texas counties. Of
these, 144 ticks contained the DNA of at least 1 of the agents
in the genera Borrelia, Ehrlichia, or Rickettsia (Table 2).
The most common tick species submitted were Amblyomma
americanum, followed by Dermacentor variabilis. Spotted
fever group Rickettsia spp. (SFGR) were the most common
bacteria detected. Genetic material from SFGR was identi-
fied in A. americanum, A. cajennense, D. variabilis, Ixodes
scapularis, and Rhipicephalus sanguineus ticks. Of all tick
species submitted, minimum SFGR infection rates (MIRs)
were highest for A. americanum (20.98%) and D. variabilis (47.37%) ticks. The most predominant SFGR sequences
amplified were identical to those of Candidatus Rickettsia
amblyommii (AY062007). Some contained a single-nucleotide difference relative to AY062007 (data not shown).
SFGR amplicons produced from Ixodes spp. ticks were
identical to those of I. scapularis endosymbiont isolates
(EU544296, EF689740, EF689737) and shared >99% identity with Candidatus Rickettsia cooleyi (AF031535) (14)
or an uncharacterized rickettsial endosymbiont previously
reported for I. scapularis (AB002268) ticks (15). Amplicons with a DNA sequence identical to that of R. parkeri
strains (U43802) (16), (EF102238) (17), and (FJ986616)
were produced by 4 D. variabilis and 1 Rh. sanguineus tick
samples. Amplicons identical to R. peacockii (CP001227)
were produced by 2 A. americanum, 2 D. variabilis, and 1
I. scapularis tick samples. Amplicons identical to R. rhipicephali (U43803) and at least 99% similar to other R. rhipicephali strains (EU109175, EU109177, EU109178) (18)
were produced by 1 Rh. sanguineus tick sample.
DNA sequences consistent with those of Borrelia spp.
were derived from A. americanum, A. cajennense, D. variabilis, and I. scapularis ticks. The most commonly encountered Borrelia genetic material demonstrated at least 99%
sequence identity or was identical to that of previously sequenced Candidatus Borrelia lonestari isolates (AY850063,
AF538852) (19). Additionally, a borreliae flaB sequence
was generated from 1 D. variabilis tick, which had 94%
sequence similarity with that of Candidatus Borrelia texasensis (AF264901) (20) and sequences amplified from an
uncultured Borrelia sp. from the bat tick Carios kelleyi
(EF688577, EF688579) (21) and (EU492387). The flaB
sequence contained 11 single-nucleotide polymorphisms
relative to the corresponding section of AF264901. The
Borrelia sp. 16S rDNA sequence generated from the same
D. variabilis tick was also identical to that published for
Candidatus B. texasensis (AF467976) (20,22). This tick
was submitted from Webb County, the same Texas county
from which the borreliae that produced GenBank sequence
AF264901 were isolated. A single I. scapularis specimen
produced the flaB sequence, which had 99% identity with
B. burgdorferi (AE000783) (23).
Genetic data consistent with those from Ehrlichia spp.
were observed for A. americanum, A. cajennense, and A.
maculatum ticks. Amplicons produced from A. americanum
and A. maculatum ticks were 99% similar to the homologous region of the E. chaffeensis disulfide oxidoreductase
gene (dsb) sequences in GenBank (CP000236) (24). A
single sample from A. cajennense ticks produced a DNA
sequence that was 97% similar to that of the CP000236 se-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
443
RESEARCH
quence and contained 8 single-nucleotide polymorphisms
relative to the similar sequence. Several single-nucleotide
polymorphisms locations are at the same position as nucleotide differences identified between the dsb gene of E. ewingii (AY428950) (25) and E. canis (AF403710) (26). The
nucleotide polymorphisms found within the dsb gene did
not change the predicted amino acid sequence in relation to
E. chaffeensis (data not shown).
Discussion
By screening a diverse group of Texas tick species for
a range of microorganisms and potential pathogens, we
identified several novel associations: Candidatus B. lonestari in A. cajennense ticks, E. chaffeensis in A. cajennense
ticks, and A. maculatum, and R. parkeri in D. variabilis
ticks (Table 3). Because the geographic distribution of diseases caused by the agents is generally characterized by the
distribution of the tick vectors, these findings provide insights regarding the distributions and endemicity of several
potential emerging tick-borne agents.
SFGR were the most commonly observed agents in
this survey. Both Candidatus R. amblyommii and Candidatus R. cooleyi are not well studied and are of undetermined pathogenicity. Current average SFGR seropositivity in Texas residents is also unknown, yet prior estimates
indicate that it is higher than would be assumed from cases
of Rocky Mountain spotted fever reported to the TX DSHS
(27). Transmission through blood products has been noted
previously (28,29). Unreported subclinical infections might
cause concern about local blood products and could potentially compromise immunodeficient transfusion recipients.
Additionally, detection of R. amblyommii in questing A.
americanum larvae suggests transovarial transmission of
the microbe, and the likelihood of pathogen transmission
Table 2. Number and identity of ticks submitted to University of North Texas Health Science Center by the Texas Department of State
Health Services Zoonosis Control Program, October 1, 2004, to September 30, 2008*
No. positive/no. tested
Borrelia spp.
Ehrlichia spp.
Rickettsia spp.
Tick
Total
UNE
PE
E
UNE
PE
E
UNE
PE
E
Amblyomma americanum
Adult male
0/0
1/116
0/1
0/0
0/116
0/1
0/0
25/116
0/1
26/117
Adult female
0/0
1/109
0/11
0/0
2/109
0/11
0/0
23/109
4/11
30/120
Nymph
0/0
1/92
1/27
0/0
0/92
0/27
0/0
18/92
9/27
29/119
Larva
0/0
0/11
0/0
0/0
0/11
0/0
0/0
0/11
0/0
0/11
A. cajennense
Adult male
0/0
0/44
0/2
0/0
1/44
0/2
0/0
0/44
0/2
1/46
Adult female
0/0
1/56
0/3
0/0
0/56
0/3
0/0
0/56
0/3
1/59
Nymph
0/0
0/52
0/3
0/0
0/52
0/3
0/0
3/52
1/3
4/55
Larva
0/0
0/12
0/0
0/0
0/12
0/0
0/0
1/12
0/0
1/12
A. maculatum
Adult male
0/0
0/7
0/0
0/0
1/7
0/0
0/0
0/7
0/0
1/7
Adult female
0/0
0/1
0/1
0/0
0/1
0/1
0/0
0/1
0/1
0/2
Nymph
0/0
0/1
0/0
0/0
0/1
0/0
0/0
0/1
0/1
0/1
Larva
0/0
0/1
0/0
0/0
0/1
0/0
0/0
0/0
0/0
0/0
Dermacentor variabilis
Adult male
0/1
0/71
0/1
0/1
0/71
0/1
0/1
4/71
0/0
4/73
Adult female
0/3
1/84
0/16
0/3
0/84
0/16
0/3
6/84
1/16
8/103
Nymph
0/0
0/0
0/2
0/0
0/1
0/2
0/0
0/0
0/2
0/2
Larva
0/0
0/0
0/0
0/0
0/1
0/0
0/0
0/0
0/0
0/0
Ixodes scapularis
Adult male
0/0
0/4
0/0
0/0
0/4
0/0
0/0
0/4
0/0
0/4
Adult female
0/0
0/41
0/22
0/0
0/41
0/22
0/0
26/41
6/22
32/63
Nymph
0/0
1/8
0/1
0/0
0/8
0/1
0/0
4/8
0/1
5/9
Larva
0/0
0/0
0/0
0/0
0/0
0/0
0/0
0/0
0/0
0/0
Rhipicephalus sanguineus
Adult male
0/0
0/23
0/0
0/0
0/23
0/0
0/0
0/23
0/0
0/23
Adult female
0/2
0/35
0/6
0/2
0/35
0/6
0/2
1/35
0/6
1/43
Nymph
0/0
0/5
0/15
0/0
0/5
0/15
0/0
0/5
1/15
1/20
Larva
0/0
0/0
0/1
0/0
0/0
0/1
0/0
0/0
0/1
0/1
Total
0/6
6/772
1/112
0/6
4/772
0/112
0/6
111/772 22/112
144/890
*Testing by PCR. Only tick species that showed evidence of containing Borrelia, Ehrlichia, or Rickettsia spp. are shown. Seven specimens of Otobius
megnini, 2 of Amblyomma inornatum and Dermacentor albipictus, and 1 each of Dermacentor andersonii and Dermacentor nigrolineatus ticks were
submitted during the project period. After clarification with the submitter of the D. andersonii specimen, it was concluded that the tick attachment may
have occurred in Colorado. UNE, unengorged; PE, partially engorged; E, engorged.
444
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Borrelia, Ehrlichia, and Rickettsia spp. in Ticks
Table 3. No. ticks containing bacterial DNA sequences, Texas, October 1, 2004, to September 30, 2008*
Bacterial agent
Candidatus
Candidatus Candidatus
Borrelia
Rickettsia
Rickettsia Rickettsia
Borrelia
B.
Ehrlichia
R.
R.
Tick species
lonestari
cooleyi
spp.
burgdorferi
chaffeensis amblyommii
parkeri
peacockii rhipicephali
4
2
77
2
Amblyomma
americanum
1
1
5
A. cajennense
1
A. maculatum
1
4
4
2
1
Dermacentor
variabilis
1
35
1
Ixodes scapularis
1
1
Rhipicephalus
sanguineus
Total
1
1
5
4
87
35
5
5
1
*Ticks submitted to the Texas Department of State Health Services and identified by the University of North Texas Health Science Center, Tick-Borne
Disease Research Laboratory. Only those tick species that showed evidence of containing Borrelia, Ehrlichia, or Rickettsia spp. are shown.
by larvae could be magnified by their habit of mass attack
(huge numbers on a single host).
An overall Borrelia spp. MIR of 1.1% was observed
for the entire 4-year collection. Prevalence of Candidatus
B. lonestari in ticks from Texas was low. However, Candidatus B. lonestari sequences were detected in A. americanum ticks regardless of geographic origin. The MIR
was slightly higher for A. americanum (2.53%) ticks during periods when that tick was the most abundant species
parasitizing humans (October 1, 2007 through October
1, 2008). These rates are within ranges previously established in the literature (30–32). A single isolate of Candidatus B. lonestari was observed in A. cajennense ticks.
This represents the potential for Candidatus B. lonestari
to use hard ticks of species other than A. americanum in
its maintenance cycle and suggests that Candidatus B.
lonestari may occur in areas outside the natural distribution of A. americanum ticks. An MIR of 1.3% for Borrelia
spp. was found for in D. variabilis and may indicate the
presence of uncharacterized borreliae strains in Texas tick
populations.
A. cajennense ticks have been associated with E. ruminantium (33) and spotted fever group Rickettsia spp. (34).
According to seropositivity in a human population in Argentina, these ticks have also been suspected of transmitting ehrlichiosis (35). The presence of E. chaffeensis in an
A. cajennense tick seems novel. Long et al. (13) suggest an
E. ewingii MIR of 7.6% in southcentral Texas A. americanum ticks. Similar results for Ehrlichia spp. in A. cajennense tick populations may be plausible.
Screening ticks for a range of bacterial agents has provided several additional associations. These findings provide insights regarding the distributions and endemicity
of potentially pathogenic and emerging tick-borne agents.
Some of these tick-borne agents may pose an unknown
health risk. Because of the wide distribution of these ticks,
accurate assessments of the frequency of bacterial agents
in these tick populations, their potential for causing human
disease, and the ability for these tick species to act as competent vectors are warranted. Continued study and monitoring will play a vital role in public health assessment for
related disease risks.
Acknowledgments
We thank Chris Paddock and Bruce Budowle for their review of the manuscript.
This project was supported by the State of Texas.
Dr Williamson is an assistant professor in the Institute of
Investigative Genetics at the University of North Texas Health
Science Center and director for the Tick-borne Disease Research
Laboratory in the Center for Biosafety and Biosecurity. His primary research focus is the development of methods and tools for
rapid assessment of disease outbreak and the study of efficient
mechanisms for researching the epidemiology, genetics, and associated clinical manifestations of emerging pathogens.
References
1.
2.
3.
4.
5.
6.
United States Department of Agriculture. Ticks of veterinary importance. Agriculture Handbook no. 485. Rockville (MD): The Department; 1976. p. 21–35.
Cooley RA, Kohls GM. The genus Ixodes in North America. Washington: US Government Printing Office; 1945. p. 7–11.
Keirans JE, Litwak TR. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J
Med Entomol. 1989;26:435–48.
Barbour AG, Maupin GO, Teltow GJ, Carter CJ, Piesman J. Identification of an uncultivable Borrelia species in the hard tick Amblyomma americanum: possible agent of a Lyme disease-like illness. J
Infect Dis. 1996;173:403–9.
Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of
rickettsiae and estimation of intraspecies sequence divergence for
portions of two rickettsial genes. J Bacteriol. 1991;173:1576–89.
Eremeeva M, Yu X, Raoult D. Differentiation among spotted fever group rickettsiae species by analysis of restriction fragment
length polymorphism of PCR-amplified DNA. J Clin Microbiol.
1994;32:803–10.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
445
RESEARCH
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Kollars TM Jr, Kengluecha A. Spotted fever group Rickettsia in Dermacentor variabilis (Acari: Ixodidae) infesting raccoons (Carnivora:
Procyonidae) and opossums (Marsupialia: Didelphimorphidae) in
Tennessee. J Med Entomol. 2001;38:601–2. DOI: 10.1603/00222585-38.4.601
Webb L, Carl M, Malloy DC, Dasch GA, Azad AF. Detection of murine typhus infection in fleas by using the polymerase chain reaction.
J Clin Microbiol. 1990;28:530–4.
Doyle CK, Labruna MB, Breitschwerdt EB, Tang YW, Corstvet RE,
Hegarty BC, et al. Detection of medically important Ehrlichia by
quantitative multicolor TaqMan real-time polymerase chain reaction
of the dsb gene. J Mol Diagn. 2005;7:504–10.
Dawson JE, Stallknecht DE, Howerth EW, Warner C, Biggie K, Davidson WR, et al. Susceptibility of white-tailed deer (Odocoileus virginianus) to infection with Ehrlichia chaffeensis, the etiologic agent
of human ehrlichiosis. J Clin Microbiol. 1994;32:2725–8.
Dawson JE, Biggie KL, Warner CK, Cookson K, Jenkins S, Levine
JF, et al. Polymerase chain reaction evidence of Ehrlichia chaffeensis, an etiologic agent of human ehrlichiosis, in dogs from southeast
Virginia. Am J Vet Res. 1996;57:1175–9.
Anderson BE, Sumner JW, Dawson JE, Tzianabos T, Greene CR, Olson JG, et al. Detection of the etiologic agent of human ehrlichiosis
by polymerase chain reaction. J Clin Microbiol. 1992;30:775–80.
Long SW, Pound JM, Yu XJ. Ehrlichia prevalence in Amblyomma
americanum, central Texas. Emerg Infect Dis. 2004;10:1342–3.
Billings AN, Teltow GJ, Weaver SC, Walker DH. Molecular characterization of a novel Rickettsia species from Ixodes scapularis in Texas. Emerg Infect Dis. 1998;4:305–9. DOI: 10.3201/eid0402.980221
Weller SJ, Baldridge GD, Munderloh UG, Noda H, Simser J, Kurtti
TJ. Phylogenetic placement of rickettsiae from the ticks Amblyomma
americanum and Ixodes scapularis. J Clin Microbiol. 1998;36:1305–
17.
Roux V, Fournier PE, Raoult D. Differentiation of spotted fever
group rickettsiae by sequencing and analysis of restriction fragment
length polymorphism of PCR-amplified DNA of the gene encoding
the protein rOmpA. J Clin Microbiol. 1996;34:2058–65.
Silveira I, Pacheco RC, Szabo MP, Ramos HG, Labruna MB. Rickettsia parkeri in Brazil. Emerg Infect Dis. 2007;13:1111–3.
Wikswo ME, Hu R, Dasch GA, Krueger L, Arugay A, Jones
K, et al. Detection and identification of spotted fever group
rickettsiae in Dermacentor species from southern California.
J Med Entomol. 2008;45:509–16. DOI: 10.1603/0022-2585(2008)45[509:DAIOSF]2.0.CO;2
Moore VA IV, Varela AS, Yabsley MJ, Davidson WR, Little SE. Detection of Borrelia lonestari, putative agent of southern tick-associated rash illness, in white-tailed deer (Odocoileus virginianus) from
the southeastern United States. J Clin Microbiol. 2003;41:424–7.
DOI: 10.1128/JCM.41.1.424-427.2003
Lin T, Gao L, Seyfang A, Oliver JH Jr. ‘Candidatus Borrelia texasensis’ from the American dog tick Dermacentor variabilis. Int J Syst
Evol Microbiol. 2005;55:685–93. DOI: 10.1099/ijs.0.02864-0
Gill JS, Ullmann AJ, Loftis AD, Schwan TG, Raffel SJ, Schrumpf
ME, et al. Novel relapsing fever spirochete in bat tick. Emerg Infect
Dis. 2008;14:522–3. DOI: 10.3201/eid1403.070766
Lin T, Oliver JH Jr, Gao L. Comparative analysis of Borrelia isolates
from southeastern USA based on randomly amplified polymorphic
DNA fingerprint and 16S ribosomal gene sequence analyses. FEMS
Microbiol Lett. 2003;228:249–57. DOI: 10.1016/S0378-1097(03)00763-8
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Fraser CM, Casjens S, Huang WM, Sutton GG, Clayton R, Lathigra
R, et al. Genomic sequence of a Lyme disease spirochaete, Borrelia
burgdorferi. Nature. 1997;390:580–6. DOI: 10.1038/37551
Hotopp JC, Lin M, Madupu R, Crabtree J, Angiuoli SV, Eisen JA,
et al. Comparative genomics of emerging human ehrlichiosis agents.
PLoS Genet. 2006;2:e21. DOI: 10.1371/journal.pgen.0020021
Labruna MB, McBride JW, Camargo LM, Aguiar DM, Yabsley MJ,
Davidson WR, et al. A preliminary investigation of Ehrlichia species
in ticks, humans, dogs, and capybaras from Brazil. Vet Parasitol.
2007;143:189–95. DOI: 10.1016/j.vetpar.2006.08.005
McBride JW, Ndip LM, Popov VL, Walker DH. Identification and
functional analysis of an immunoreactive DsbA-like thio-disulfide
oxidoreductase of Ehrlichia spp. Infect Immun. 2002;70:2700–3.
DOI: 10.1128/IAI.70.5.2700-2703.2002
Taylor JP, Tanner WB, Rawlings JA, Buck J, Elliott LB, Dewlett HJ,
et al. Serological evidence of subclinical Rocky Mountain spotted
fever infections in Texas. J Infect Dis. 1985;151:367–9.
Arguin PM, Singleton J, Rotz LD, Marston E, Treadwell TA, Slater K, et al. An investigation into the possibility of transmission of
tick-borne pathogens via blood transfusion. Transfusion-associated
Tick-borne Illness Task Force. Transfusion. 1999;39:828–33. DOI:
10.1046/j.1537-2995.1999.39080828.x
McQuiston JH, Childs JE, Chamberland ME, Tabor E. Transmission of tick-borne agents of disease by blood transfusion: a review
of known and potential risks in the United States. Transfusion.
2000;40:274–84. DOI: 10.1046/j.1537-2995.2000.40030274.x
Stromdahl EY, Williamson PC, Kollars TM Jr, Evans SR, Barry RK,
Vince MA, et al. Evidence of Borrelia lonestari DNA in Amblyomma
americanum (Acari: Ixodidae) removed from humans. J Clin Microbiol. 2003;41:5557–62. DOI: 10.1128/JCM.41.12.5557-5562.2003
Taft SC, Miller MK, Wright SM. Distribution of borreliae among
ticks collected from eastern states. Vector Borne Zoonotic Dis.
2005;5:383–9. DOI: 10.1089/vbz.2005.5.383
Mixson TR, Campbell SR, Gill JS, Ginsberg HS, Reichard MV,
Schulze TL, et al. Prevalence of Ehrlichia, Borrelia, and rickettsial
agents in Amblyomma americanum (Acari: Ixodidae) collected from
nine states. J Med Entomol. 2006;43:1261–8. DOI: 10.1603/00222585(2006)43[1261:POEBAR]2.0.CO;2
Mahan SM, Peter TF, Simbi BH, Kocan K, Camus E, Barbet AF, et al.
Comparison of efficacy of American and African Amblyomma ticks
as vectors of heartwater (Cowdria ruminantium) infection by molecular analyses and transmission trials. J Parasitol. 2000;86:44–9.
de Lemos ER, Machado RD, Coura JR, Guimaraes MA, Freire NM,
Amorim M, et al. Epidemiological aspects of the Brazilian spotted
fever: seasonal activity of ticks collected in an endemic area in São
Paulo, Brazil. Rev Soc Bras Med Trop. 1997;30:181–5.
Ripoll CM, Remondegui CE, Ordonez G, Arazamendi R, Fusaro H,
Hyman MJ, et al. Evidence of rickettsial spotted fever and ehrlichial
infections in a subtropical territory of Jujuy, Argentina. Am J Trop
Med Hyg. 1999;61:350–4.
Address for correspondence: Phillip C. Williamson, University of North
Texas Health Science Center, Institute of Investigative Genetics, 3500
Camp Bowie Blvd, Fort Worth, TX 76107-2699, USA; email: [email protected]
hsc.unt.edu
Search past issues of EID at www.cdc.gov/eid
446
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
New Endemic Legionella
pneumophila Serogroup I Clones,
Ontario, Canada
Nathalie Tijet, Patrick Tang, Mya Romilowych, Carla Duncan, Victoria Ng, David N. Fisman,
Frances Jamieson, Donald E. Low, and Cyril Guyard
The water-borne pathogen Legionella pneumophila
serogroup 1 (Lp1) is the most commonly reported etiologic
agent of legionellosis. To examine the genetic diversity, the
long-term epidemiology, and the molecular evolution of Lp1
clinical isolates, we conducted sequence-based typing on
a collection of clinical isolates representing 3 decades of
culture-confirmed legionellosis in Ontario, Canada. Analysis showed that the population of Lp1 in Ontario is highly
diverse and combines lineages identified worldwide with local strains. Identical types were identified in sporadic and
outbreak-associated strains. In the past 15 years, the incidence of some lineages distributed worldwide has tended
to decrease, and local endemic clones and lineages have
emerged. Comparative geographic distribution analysis
suggests that some lineages are specific to eastern North
America. These findings have general clinical implications
for the study of Lp1 molecular evolution and for the identification of Lp1 circulating strains in North America.
egionella species are implicated in 2 clinical syndromes: Legionnaires’ disease (LD) and Pontiac fever, which are collectively known as legionellosis. Pontiac fever is a self-limited, influenza-like illness, whereas
Legionnaires’ disease is a common cause of serious bacterial pneumonia (1,2).
L
Author affiliations: Ontario Agency for Health Protection and Promotion, Toronto, Ontario, Canada (N. Tijet, P. Tang, M. Romilowych, C. Duncan, D.N. Fisman, F. Jamieson, D.E. Low, C. Guyard);
Research Institute of the Hospital for Sick Children, Toronto (V. Ng,
D.N. Fisman); Australian National University, Canberra, Australian
Capital Territory, Australia (V. Ng); University of Toronto, Toronto (F.
Jamieson, D.E. Low, C. Guyard); and Mount Sinai Hospital, Toronto
(F. Jamieson, D.E. Low, C. Guyard)
DOI: 10.3201/eid1603.081689
Among the 52 species and 70 serogroups of Legionella
species (3), L. pneumophila is the major cause of sporadic
and outbreak legionellosis (91.5%), and serogroup 1 is the
predominant serotype (84.2%) (4). In industrialized countries, L. pneumophila is the second most common pathogen
detected in cases of community-acquired pneumonia that
requires patient admission to intensive care units (5,6).
During an outbreak or after the detection of sporadic
cases, appropriate identification and typing methods are essential for epidemiologic investigations. Adequate typing
methods are also crucial to determine the degree of relatedness of bacteria and to enable the reconstruction of microevolutionary events (7). On the basis of analysis of 7 loci, a
standard sequence-based method for the typing of L. pneumophila serogroup 1 (Lp1) was developed by the European
Working Group for Legionella Infections (EWGLI) (8,9).
In previous population-based studies, a Legionella
sequence-based typing (SBT) scheme was used to analyze
clinical strains either from Europe or with limited time-span
coverage (10–12). In the present study, we applied SBT to
examine the genetic diversity, the long-term epidemiology,
and the molecular evolution of Lp1 clinical isolates using
a population-based collection that encompassed isolates
from 30 years of culture-confirmed legionellosis cases in
Ontario.
Methods
Source of Isolates
Legionellosis is a notifiable disease in Ontario (population 13 million persons). Since 1978, the diagnosis of
Legionella infections has been centralized at the Ontario
Public Health Laboratory (OPHL). This laboratory serves
as the Legionella reference laboratory and performs all
testing for outbreak investigations and most testing of clin-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
447
RESEARCH
ical specimens. Therefore, isolates analyzed in this study
are representative of the strains isolated in Ontario in the
past 3 decades. Information available in the Ontario database includes dates of onset of illness, patient’s age and
sex, and city and hospital or healthcare facility from which
specimens were submitted (13). No specimens were submitted for Legionella isolation from 1978 through 1979.
From 1980 through 1985, a mean ± SD of 424.1 ± 281.3
specimens was submitted for isolation every year. From
1986 through 2007, a mean ± SD of 1,783.5 ± 258.4 specimens was submitted for isolation every year. The mean ±
SD number of Lp1 culture-confirmed cases/year during
the study period was 7.4 ± 3.5. The proportion of cultureconfirmed case-patients with L. pneumophila infection remained stable during the period of analysis, and 66% of the
isolates were Lp1 (13).
Lung tissues, bronchial-alveolar lavage specimens,
or sputum specimens were homogenized by using a tissue
grinder, streaked on buffered charcoal yeast extract agar
plates and incubated at 37°C (3–7 days). Species and serogroups were confirmed by direct immunofluorescent antibody assay and slide-agglutination (14,15). Isolates (n =
217) were stored at –80°C in trypticase soy broth supplemented with 5% horse blood. Twenty-three isolates obtained in 1996 and 1997 could not be used and were omitted from our analysis. Outbreaks were defined as >2 cases
that were submitted from the same hospital or healthcare
facility or with links to a common source with onset during
the same 30-day period.
Sequence-based Typing
SBT using loci flaA, pilE, asd, mip, mompS, proA,
and neuA was conducted according to the EWGLI scheme
(8,9). Automated contig-assembly and base-calling of
DNA sequence traces were performed by using the EWGLI
sequence quality tool (16). The sequences obtained from
this work are available in the EWGLI-SBT database (www.
ewgli.org)
Phylogenetic and Allelic Diversity Analyses
Multiple sequence alignments of concatenated DNA
sequences and phylogram construction were carried out
with ClustalW2 (www.ebi.ac.uk/Tools/clustalw2/index.
html) by using the neighbor-joining method with 1,000
bootstrap replicates (17). Clonal analyses were performed
by using eBURST3 (http://eBURST.mlst.net) with a group
definition set to 6 identical alleles and sequence type (ST)
allelic profiles were clustered with the unweighted pair
group method with arithmetic mean (UPGMA) algorithm
by using splits Tree4 (18). The standardized index of association (IAS) and the mean genetic diversity were calculated
with LIAN 3.5 (19).
448
Ontario Health Regions and Rates Calculations
The 36 public health units of Ontario were aggregated into 7 health regions (OHRs) with populations ranging from ≈0.5 to 2 million persons: Toronto, South West,
Central South, Central West, Central East, East, and North.
Average rates were calculated by dividing disease counts
by the Statistics Canada population estimates (20,21). OHR
population estimates were not available before 1995 and
were estimated from 1990 through 1995 and 2006 through
2007 by linear extrapolation.
Statistical Analyses and Mapping
Statistical analyses were performed by using STATA
(StataCorp, College Station, TX, USA). Thematic maps
were created by using ArcGIS (ESRI, Redlands, CA,
USA).
Results
Lp1 Sequence-based Typing
The 194 isolates, collected from 1978 through 2007,
were resolved into 62 STs (online Appendix Table, www.
cdc.gov/EID/content/16/3/447-appT.htm). Seven STs were
represented by at least 10 isolates, 13 STs consisted of
groups containing 2–4 isolates, and 42 STs were represented by 1 isolate. In comparison to the EWGLI dataset,
42 STs have only been reported in North America, and 41
STs are unique to the province of Ontario. The ST with the
largest number of isolates was ST1 (n = 31). STs previously reported in the EWGLI database and responsible for
>9 cases in Ontario include ST36 (n = 10), ST37 (n = 21),
ST42 (n = 10), and ST62 (n = 16). Two STs, specific to
the province of Ontario, were detected in >9 legionellosis
cases: ST211 (n = 15) and ST222 (n = 13). STs resolved
from outbreak isolates were confirmed to be epidemiologically concordant since related isolates were assigned identical STs. ST211 strains were obtained from patients in 1
outbreak (n = 2) in 1993 and from 13 patients with sporadic cases. Seven of the 13 ST222 isolates were recovered
from a legionellosis outbreak at a long-term care facility in
Ontario in 2005 (10). ST226 was also differentiated from
strains responsible for a suspected outbreak (n = 2) and is
specific to Ontario.
Across the 7 loci, 99 alleles were identified. Three
new alleles were found, 2 of which (asd 32 and proA 33)
were identified in a ST357 strain isolated in 2002 from a
patient with a sporadic case. The third new allele (mompS
52) was identified in a ST358 strain isolated in the South
West OHR. At the individual loci level, the total number
of alleles ranged from 10 at flaA to 21 at mompS. Because
the population of Lp1 clinical isolates found in Ontario appeared to be distinct from the isolates reported in the EWGLI database, we performed linkage analyses and looked at
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
L. pneumophila Serogroup I Clones, Canada
genetic diversity of our dataset compared to that of the
EWGLI dataset. Linkage analyses showed that the IAS for
the complete dataset was 0.4913. This value is comparable
with the IAS of 0.494 in previous studies and suggests linkage disequilibrium in the dataset obtained from the population of clinical Lp1 isolates in Ontario (22). With a value
of 0.8041 ± 0.0155, the mean ± SD genetic diversity of
our dataset was similar to the mean genetic diversity of the
EWGLI dataset.
Phylogenetic Analysis
The population structure of Lp1 clinical isolates from
Ontario was analyzed by using 62 concatenated sequences
of 7 loci and compared with results of cluster analysis deduced from SBT allelic profiles. Three major clusters were
visually identified from the phylogenetic tree (Figure 1).
All clusters contain isolates from outbreak and sporadic
cases. None of the identified clusters or subgroups were
exclusively formed with strains identified with STs specifically reported in Ontario. This suggests that Ontario
strains are phylogenetically related to strains found in the
EWGLI dataset. Phylogenetic cluster I (n = 39) included
the epidemic strain ST1 and 7 STs of sporadic cases. With
114 isolates and 46 STs, cluster II was the largest and most
diverse group from the dataset. In this cluster, Ontario outbreak strains ST37 and ST211 were subgrouped with ST36
(Philadelphia strain). Cluster III comprised 8 STs and 41
isolates. With the exception of ST222 (n = 13), none of the
STs grouped in this cluster were reported to be outbreak
strains.
Next, the UPGMA algorithm was used to construct a
dendrogram based on a matrix of pairwise allelic differences
between the 62 STs of our dataset (Figure 2). The topology
of the UPGMA dendrogram was partially congruent with
the neighbor-joining tree based on allelic sequences. The
UPGMA dendrogram contains 3 major clusters of related
STs arbitrarily named A, B, and C (Figure 2). Cluster B
contains all isolates of cluster II except ST210 and ST199,
which grouped with cluster C. In contrast, STs found in
clusters I and III were separated into clusters A and C. ST1
and ST52 clustered in a separate branch at the base of the
dendrogram, (Figure 2), which suggests that they could be
phylogenetically distant from other STs. However, this divergence was not observed with the neighbor-joining method. Based on this finding, for the rest of the analysis, we
considered cluster II as a well-defined phylogenetic group
and clusters I/III were analyzed as a single group.
Identification of Clonal Lineages
The eBURST clonal analysis of our strains showed that
the province of Ontario presents a semiclonal population
with 27 single isolates and 11 clonal groups (CGs) (Figure
2). With 54 isolates and 10 STs, CG1 was the clonal group
Figure 1. Phylogenetic analysis of flaA, pilE, asd, mip, mompS,
proA, and neuA concatenated sequences from the 62 Legionella
pneumophila serogroup 1 sequence types (STs) identified in
Ontario. The tree was constructed with ClustalW2 (www.ebi.ac.uk/
Tools/clustalw2/index.html) and the neighbor-joining method with
1,000 bootstrap replicates. Scale bar indicates genetic distances
between sequences. STs in boldface were detected in outbreaks.
with the largest number of isolates and STs. This clonal
group (27.8% of Ontario isolates) contained STs that were
reported elsewhere (ST36, ST37, and ST104) but also STs
that were unique to Ontario (ST193, ST195, ST196, ST197,
ST211, and ST229). The founder of CG1 was predicted to
be ST36 (bootstrap confidence [BC] = 68%), and the predominant single locus variant of this group was ST37 (n =
21). Members of CG1 were recovered from both sporadic
and outbreak cases. CG2 (n = 7) only contained isolates
with STs that are unique to Ontario and the ancestor of this
group was predicted to be ST209 (BC = 28%). All isolates
of CG2 were obtained from sporadic cases. Other clonal
groups unique to Ontario included CG4 (n = 17), CG6 (n =
4) and CG7 (n = 2). Each of the 5 remaining clonal groups
contained only 2 STs with combinations of STs specific to
Ontario or previously reported in the EWGLI database.
We next did an eBURST comparative analysis of
the SBT dataset from Ontario with the EWGLI database.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
449
RESEARCH
ure 3). Another clonal complex of interest was CC-C accounting for 16 STs (Figure 3). This complex included isolates grouped in CG2 and CG8 as well as 7 STs that were
not identified in Ontario. Single isolates ST45, ST109, and
ST230 from the Ontario dataset also grouped in CC-C.
Finally, CC-D of the comparative eBURST analysis was
identical to CG6 (Figure 2).
Temporal Trends of Lp1 Culture-confirmed
Legionellosis in Ontario
Figure 2. Dendrogram created by the unweighted pair group method
with arithmetic mean method based on the 62 allelic profiles of
194 Legionella pneumophila serogroup 1 isolates. Clonal groups
(CGs) identified by eBURST (http://eBURST.mlst.net) are indicated
with solid lines, and STs included in CGs are in boldface. Ontario
STs included in clonal complexes (CC) identified by comparative
eBURST analysis with the European Working Group for Legionella
Infections database are indicated with dashed lines. The 3 major
clusters are indicated on the right of the figure with bold lines. The
number of strains isolated in Ontario is indicated below CG. Scale
bar indicates linkage distances.
STs detected in Ontario were only clustered in 17 of the
44 clonal complexes (CC) identified with the EWGLI database. This suggests that >60% of the clonal groups of
the EWGLI dataset are absent from Ontario. Comparative
eBURST analysis showed that CG1 is part of CC-B, which
is the most diversified clonal complex in the international
database (59 STs) (Figure 3). In addition to STs included in
CG1, Ontario isolates ST40 and ST202 grouped in CC-B.
Philadelphia strain ST36 was predicted to be the founder
(BC = 91%) of this clonal complex. The high number of
STs clustered in CC-B (12 STs) suggests that strains belonging to this group are evolving in Ontario (Figure 2).
Isolates from CG11 grouped within a CC comprising
the highest number of EWGLI isolates (n = 490). The predicted founder of this clonal complex is ST1 and despite its
high number of isolates, it comprises only 35 STs. Similarly, Ontario CG11 (n = 33) contained only 2 STs which
suggests that strains belonging to these clonal groups have
limited genetic variability.
Isolates from CG4 (n = 17) grouped with 2 North
American clinical strains ST276 and ST289 in CC-A (Fig450
During 1978–2007, differences could be observed in
the distribution of specific STs, clonal complexes and phylogroups. During 1981–1994, ST1 strains were regularly
isolated (n = 29) with case numbers ranging from 0 to 5
(peaking in 1983) (Figure 4, panel A). During this time period, ST1 caused 3 outbreaks and a significant increase in
ST1 occurrence was observed (incidence rate ratio [IRR]
15.37, 95% confidence interval [CI] 3.67–64.43, p<0.001).
In contrast, after 1994, prevalence of ST1 isolates decreased
markedly (IRR 0.07, CI 0.02–0.27, p<0.001). On average,
from 1978 through 2007, we observed a significant decrease of 9% per year of ST1 strains in Ontario (p<0.001).
From 1995 through 2007, only 2 legionellosis ST1 cultureconfirmed cases were reported.
In contrast, other STs have emerged in the past 20
years. ST47 was detected 3 times during 2003–2006. This
Figure 3. Representation of Legionella pneumophila serogroup 1
clonal complexes (CC) A, B, C, D obtained by comparative eBURST
(http://eBURST.mlst.net) analysis between the Ontario collection
and the European Working Group for Legionella Infections
database. Each circle represents a single sequence type (ST). Size
of the circle is proportional to the number of isolates. Dark circles
represent predicted founder of each CC. Labels in boldface indicate
STs found in both datasets, regular black characters indicate STs
absent from the Ontario collection, light gray characters indicate
STs exclusively found in Ontario. Solid lines represent single-locus
variants.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
L. pneumophila Serogroup I Clones, Canada
this clonal complex. Chronological evolution of Ontario
isolates belonging to CC-C is also noteworthy because it
appears to be an emerging clonal complex (Figure 5, panel
B). From 1985 through 1988, the maximum incidence of
isolates from this clonal complex was 15.4%. CC-C isolates were not reported in 1989 and 1995, but the incidence
of CC-C isolates gradually increased from 1998 until 2007
(when it peaked at 37.5%).
Geographic Distribution of Lp1 Clinical
Strains Isolated in Ontario
The geographic distribution of some individual STs,
clonal complexes and phylogenetic clusters was not homogenous. With geographic ratios between 37.5% and
100%, the 7 STs that caused >10 clinical cases were all
prevalent in the Toronto OHR. ST1 was widely distributed: South West, Central South, Central East, East, and
Toronto OHRs. ST37 was found in all OHRs except the
Figure 4. Prevalence of Legionella pneumophila serogroup
1 sequence type 1 (ST1) (A) and ST211 (B) endemic strains in
Ontario. Black bar sections indicate proportion of strains from
isolated cases and white bar sections indicate proportion of isolates
from outbreaks.
strain was not isolated before 2003 in Ontario and it corresponds to the ST of the Lorraine strain. This emerging
strain is highly prevalent in France where it was reported
as the cause of 2 major outbreaks (11). Two other emerging strains that are unique to Ontario are ST211 and ST222
(Figure 4, panel B). ST211 was first isolated in 1989 accounting for 12.5% of clinical isolates. It was regularly isolated from 1990 through 2006, and sporadic cases peaked
in 1999 (23.1%). ST222 was first reported in 1999, and the
prevalence of this strain has significantly increased (IRR
1.30 per year, CI 1.12–1.53, p<0.001). Excluding outbreak
isolates, ST222 accounted for 11.1% to 15.4% of clinical
isolates in 1999, 2000, 2006, and 2007.
At the clonal complex level, some groups of strains
have recently emerged in the province of Ontario. Ontario
strains of CC-A were not detected in Ontario before 1992
and oscillated from 10% to 25% from 1998 through 2007
(Figure 5, panel A). This observation is consistent with
the emergence of ST222, which is a major contributor of
Figure 5. Incidence of Ontario Legionella pneumophila serogroup
1 isolates from clonal complexes (CC) A and C. CC-A (A) and
CC-C (B) were identified by eBURST (http://eBURST.mlst.net)
comparative analysis using the Ontario and the European Working
Group for Legionella Infections international databases. Black bar
sections indicate proportion of strains isolated during sporadic
cases. White bar sections indicate proportion of outbreak isolates.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
451
RESEARCH
East OHR. ST62 was also homogeneously distributed in
all OHRs with the exception of the North OHR. In contrast, distributions of ST36 and ST42 were not homogenous because they were only identified in the Central
South, Central West, East, and Toronto OHRs. Distribution of ST211 was limited to the Toronto OHR. From
1978 through 2006, ST211 was identified 8 times in the
same hospital. Excluding suspected linked cases, ST211
was exclusively detected 7 times in the Toronto OHR.
Despite their recent emergence in 1999, ST222 strains
were reported in multiple OHRs, including South West,
Central West, Toronto, and East.
Comparative eBURST analysis between Ontario and
EWGLI datasets grouped Ontario single isolates ST208 (n
= 2) with ST257. ST257 was identified in a clinical case
of legionellosis from New Hampshire, USA. This small
clonal complex may be geographically restricted to eastern North America. Similarly, geographic distribution of
CC-A (CG4, ST276, and ST289) was restricted to eastern
North America. ST276 and ST289 were only reported in
the states of New York and Connecticut (23). With the exception of the North OHR, strains belonging to CC-B were
reported in all OHRs, although a high prevalence of CC-B
isolates were identified in the Toronto OHR (63.2%). Without significant geographic prevalence, CC-C isolates were
identified in all OHRs. CC-D comprised STs only reported
in Ontario (Figure 3).
Geographic distributions of Ontario major phylogenetic groups were analyzed by mapping average rates
of culture-confirmed Lp1 cases according to OHRs from
1990 through 2007 (Figure 6). Rates of clusters based
on sequence-based types and phylogroups appeared to
be partially dependent on geographic location. As expected from our distribution analyses of individual
STs and clonal complexes, the Toronto OHR was more
likely to have legionellosis cases caused by cluster I/III
(0.062/100,000 persons/year) and cluster II (0.08/100,000
persons/year) than all other OHRs. With rates ranging
from 0.02/100,000 person years for the North OHR to
0.08/100,000 person-years for the Toronto OHR, isolates
from cluster II were unevenly reported in all OHRs. In
contrast, legionellosis caused by cluster I/III were not
identified in the North OHR and the rate for the Central
OHR was only 0.01/100,000 person-years, which is 3.3×
less than the rate reported for cluster II.
Discussion
This report represents the first large-scale populationbased SBT analysis of Lp1 clinical isolates within North
America over a 30-year period. Sixty-two STs were identified among the isolates of the Ontario collection, which
reflects a high degree of genetic diversity of Lp1 clinical
isolates. Forty-one STs were unique to Ontario. Thus, the
452
Figure 6. Geographic distribution of phylogenetic clusters II and
I/III from 1990 through 2007. Rates are cases of infection with
Legionella pneumophilia serogroup 1 clones per 100,000 persons
per year. The province of Ontario was divided into 7 health regions
(OHRs) with populations ranging from ≈0.5 to 2 million persons:
Toronto, South West (SW), Central South (CS), Central West (CW),
Central East (CE), East, and North.
population of clinical Lp1 of this province consists of a
combination of widely distributed and local isolates.
Although most sporadic cases were caused by isolates
with a unique ST, some STs, like ST1, were found to be
responsible for sporadic cases and outbreaks cases. This
finding is in agreement with the recent identification of the
Paris strain in sporadic and outbreak cases (24). Moreover,
we have identified additional clones, specifically ST37,
ST211, ST222, and ST226, which were also detected in
sporadic and outbreaks cases. Although some small clonal
groups such as CG2 exclusively comprised sporadic cases,
our comparative analysis found no specific correlation be-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
L. pneumophila Serogroup I Clones, Canada
tween clonal complexes or phylogenetic clusters and ability to cause sporadic or outbreak cases.
A notable finding of our study is the high proportion
of ST1 isolates identified, which supports the hypothesis
that some specific Lp1 clones have gained widespread dissemination. This hypothesis was proposed after analyses of
protein polymorphism and pulsed-field gel electrophoresis
showed similar patterns from isolates distributed worldwide (25,26). Recently, the Paris strain was suggested to
be one of these worldwide distributed strains because it has
been identified in many European countries in patients and
environmental samples (24,27). In France, the Paris strain
was identified in 12.2% of culture-confirmed cases from
1998 through 2002, and it was shown to be the most prevalent endemic strain (28). Our study suggests that the notion of worldwide distributed strains could be broadened to
include other sequence types such as ST36 or ST37. These
2 STs have been reported in European countries for clinical and environmental isolates and comprised 16% of STs
from culture-confirmed cases in Ontario.
In previous studies, the clinical predominance and
large distribution of ST1 suggested that it is a stable clone,
well adapted to environmental survival or to host infection (28,29). Surprisingly, although ST1 was identified in
16.5% of the culture-confirmed cases of legionellosis over
the past 30 years, our study also shows that the incidence of
ST1 strains has decreased dramatically during the past 12
years. Because clonal analysis suggests that ST1 presents a
limited genetic variability in our geographic area, we can
hypothesize that its ability to colonize the environment or
to be isolated by culture or its virulence might have been
impaired in the recent years. In contrast, endemic clonal
groups and clinical strains like ST211 have emerged in our
geographic area in the past 15 years. A surveillance study
recently reported a new endemic Lorraine strain (ST47)
emerged in France (11). ST47 was only recovered 3 times
over 30 years in Ontario, but CC-C, comprising ST47, is
an emerging clonal complex in Ontario. Our analysis suggests that, globally, ST1 strains are being replaced by other
emerging strains or clonal complexes.
Geographic distribution analysis of culture-confirmed
population rates suggests that strains from cluster II are
largely distributed in Ontario, whereas clusters I/III were
mostly reported in the OHRs in close proximity to Lake
Ontario. This finding could reflect differences in ecologic
niches (either combined with degree of adaption of organisms to cause human disease or not). Some endemic emerging STs and clonal groups are exclusively detected in Ontario, in eastern North America, or in both. In the United
States, the census regions with highest incidence rates for
legionellosis are East North central and Middle Atlantic, at
the proximity of the Great Lakes (30). Legionella species
are abundant in surface waters and the Great Lakes ecosys-
tem might represent an ideal ecologic niche for these bacteria. This hypothesis is in agreement with the identification
of clonal complexes comprising isolates exclusively originating from eastern North America. This finding contrasts
with findings of a recent population structure analysis of L.
pneumophila that used allelic profiles from the EWGLI database that could not identify eBURST groups containing
profiles originating from a single geographic area (22).
In conclusion, we showed that the population of clinical Lp1 in the province of Ontario is a combination of
worldwide distributed and local strains. Our population of
isolates might represent more severe cases as human respiratory samples are more frequently taken from patients
requiring hospitalization, but the decreased prevalence of
some clones and the emergence of local group of isolates
suggest that the population of Lp1 has evolved or adapted to its environment during the past 30 years. Further
research is required to explain the changing incidence of
these STs and to investigate the fitness of emerging strains
or clonal groups. Outcomes of this research will be helpful
to improve surveillance programs for legionellosis as well
as to ensure adequacy of clinical testing procedures with
circulating strains.
Acknowledgments
We thank the European Working Group for Legionella Infections for assistance and for authorizing access to EWGLI database, and David J Farrell for reviewing the manuscript.
This study was supported by funding from the innovation
program of Ontario Ministry of Government Services (no. 07007)
and the Ontario Ministry of Health and Long term Care.
Dr Tijet is a scientist at Ontario Agency for Health Protection
and Promotion, Toronto, Ontario, Canada. Her recent research interest is the molecular epidemiology of infectious diseases and
development of molecular diagnostic tools for detecting and characterizing pathogens.
References
1.
Fraser DW, Tsai TR, Orenstein W, Parkin WE, Beecham HJ, Sharrar RG, et al. Legionnaires’ disease: description of an epidemic of
pneumonia. N Engl J Med. 1977;297:1189–97.
2. Glick TH, Gregg MB, Berman B, Mallison G, Rhodes WW Jr, Kassanoff I. Pontiac fever. An epidemic of unknown etiology in a health
department: I. Clinical and epidemiologic aspects. Am J Epidemiol.
1978;107:149–60.
3. Euzeby JP. List of prokaryotic names with standing in nomenclature—genus Legionella [cited 2008 Oct 29]. http://www.bacterio.
cict.fr/l/legionella.html
4. Yu VL, Plouffe JF, Pastoris MC, Stout JE, Schousboe M, Widmer A,
et al. Distribution of Legionella species and serogroups isolated by
culture in patients with sporadic community-acquired legionellosis:
an international collaborative survey. J Infect Dis. 2002;186:127–8.
DOI: 10.1086/341087
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
453
RESEARCH
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
454
Vergis EN, Akbas E, Yu VL. Legionella as a cause of severe pneumonia. Semin Respir Crit Care Med. 2000;21:295–304.
Smith P, Moore M, Alexander N, Hicks L, O’Loughlin R. Surveillance for travel-associated Legionnaires disease—United States,
2005–2006. MMWR Morb Mortal Wkly Rep. 2007;56:1261–3.
Feil EJ, Enright MC. Analyses of clonality and the evolution of
bacterial pathogens. Curr Opin Microbiol. 2004;7:308–13. DOI:
10.1016/j.mib.2004.04.002
Ratzow S, Gaia V, Helbig JH, Fry NK, Luck PC. Addition of neuA,
the gene encoding N-acylneuraminate cytidylyl transferase, increases the discriminatory ability of the consensus sequence-based
scheme for typing Legionella pneumophila serogroup 1 strains. J
Clin Microbiol. 2007;45:1965–8. DOI: 10.1128/JCM.00261-07
Gaia V, Fry NK, Afshar B, Luck PC, Meugnier H, Etienne J, et al.
Consensus sequence-based scheme for epidemiological typing of
clinical and environmental isolates of Legionella pneumophila. J
Clin Microbiol. 2005;43:2047–52. DOI: 10.1128/JCM.43.5.20472052.2005
Gilmour MW, Bernard K, Tracz DM, Olson AB, Corbett CR, Burdz
T, et al. Molecular typing of a Legionella pneumophila outbreak in
Ontario, Canada. J Med Microbiol. 2007;56:336–41. DOI: 10.1099/
jmm.0.46738-0
Ginevra C, Forey F, Campese C, Reyrolle M, Che D, Etienne J, et
al. Lorraine strain of Legionella pneumophila serogroup 1, France.
Emerg Infect Dis. 2008;14:673–5. DOI: 10.3201/eid1404.070961
Borchardt J, Helbig JH, Luck PC. Occurrence and distribution of
sequence types among Legionella pneumophila strains isolated from
patients in Germany: common features and differences to other regions of the world. Eur J Clin Microbiol Infect Dis. 2008;27:29–36.
DOI: 10.1007/s10096-007-0392-3
Ng V, Tang P, Jamieson F, Guyard C, Low DE, Fisman DN. Laboratory-based evaluation of legionellosis epidemiology in Ontario, Canada, 1978 to 2006. BMC Infect Dis. 2009;9:68. DOI: 10.1186/14712334-9-68
Thacker WL, Wilkinson HW, Benson RF. Comparison of slide agglutination test and direct immunofluorescence assay for identification of Legionella isolates. J Clin Microbiol. 1983;18:1113–8.
Cherry WB, Pittman B, Harris PP, Hebert GA, Thomason BM,
Thacker L, et al. Detection of Legionnaires disease bacteria by direct
immunofluorescent staining. J Clin Microbiol. 1978;8:329–38.
Ewing B, Hillier L, Wendl MC, Green P. Base-calling of automated
sequencer traces using phred. I. Accuracy assessment. Genome Res.
1998;8:175–85.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,
McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23:2947–8. DOI: 10.1093/bioinformatics/btm404
Huson DH, Bryant D. Application of phylogenetic networks in evolutionary studies. Mol Biol Evol. 2006;23:254–67.
Hudson RR. Analytical results concerning linkage disequilibrium in
models with genetic transformation and conjugation. J Evol Biol.
1994;7:535–48. DOI: 10.1046/j.1420-9101.1994.7050535.x
20.
StatsCanada. Population and dwelling counts, for Canada, Provinces
and Territories, and census divisions, 2006 and 2001 censuses [cited
2008 Nov 5]. http://www12.statcan.ca/english/census06/data/popdwell/Table.cfm?T=702&PR=35&SR=1&S=3&O=D; 2007
21. StatsCanada. Estimates of population (2001 Census and administrative data), by age group and sex, Canada, Provinces, Territories,
health regions (June 2005 boundaries) and peer groups, annual
(number) [2008 Nov 11]. http://cansim2.statcan.ca/cgi-win/CNSMCGI.EXE?Lang=E&ArrayId=01095315&Array_Pick=1&Detail=1
&ResultTemplate=CII/CII___&RootDir=CII/&TblDetail=1&C2S
UB=HEALTH. 2007
22. Edwards MT, Fry NK, Harrison TG. Clonal population structure of
Legionella pneumophila inferred from allelic profiling. Microbiology. 2008;154:852–64. DOI: 10.1099/mic.0.2007/012336-0
23. Kozak NA, Benson RF, Brown E, Alexander NT, Taylor TH Jr,
Shelton BG, et al. Distribution of lag-1 alleles and sequencebased types among Legionella pneumophila serogroup 1 clinical
and environmental isolates in the United States. J Clin Microbiol.
2009;47:2525–35. DOI: 10.1128/JCM.02410-08
24. Cazalet C, Jarraud S, Ghavi-Helm Y, Kunst F, Glaser P, Etienne J, et
al. Multigenome analysis identifies a worldwide distributed epidemic
Legionella pneumophila clone that emerged within a highly diverse
species. Genome Res. 2008;18:431–41. DOI: 10.1101/gr.7229808
25. Selander RK, McKinney RM, Whittam TS, Bibb WF, Brenner DJ,
Nolte FS, et al. Genetic structure of populations of Legionella pneumophila. J Bacteriol. 1985;163:1021–37.
26. Drenning SD, Stout JE, Joly JR, Yu VL. Unexpected similarity of
pulsed-field gel electrophoresis patterns of unrelated clinical isolates
of Legionella pneumophila, serogroup 1. J Infect Dis. 2001;183:628–
32. DOI: 10.1086/318525
27. Lawrence C, Reyrolle M, Dubrou S, Forey F, Decludt B, Goulvestre C, et al. Single clonal origin of a high proportion of Legionella
pneumophila serogroup 1 isolates from patients and the environment
in the area of Paris, France, over a 10-year period. J Clin Microbiol.
1999;37:2652–5.
28. Aurell H, Etienne J, Forey F, Reyrolle M, Girardo P, Farge P, et al.
Legionella pneumophila serogroup 1 strain Paris: endemic distribution throughout France. J Clin Microbiol. 2003;41:3320–2. DOI:
10.1128/JCM.41.7.3320-3322.2003
29. Amemura-Maekawa J, Kura F, Chang B, Watanabe H. Legionella
pneumophila serogroup 1 isolates from cooling towers in Japan form
a distinct genetic cluster. Microbiol Immunol. 2005;49:1027–33.
30. Neil K, Berkelman R. Increasing incidence of legionellosis in the
United States, 1990–2005: changing epidemiologic trends. Clin Infect Dis. 2008;47:591–9. DOI: 10.1086/590557
Address for correspondence: Cyril Guyard, Ontario Agency for Health
Protection and Promotion, 81 Resources Rd, Toronto, Ontario, M6H 2S2,
Canada; email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Invasive Haemophilus influenzae
Disease, Europe, 1996–2006
Shamez Ladhani, Mary P.E. Slack, Paul T. Heath, Anne von Gottberg, Manosree Chandra,
Mary E. Ramsay, and European Union Invasive Bacterial Infection Surveillance participants1
An international collaboration was established in 1996
to monitor the impact of routine Haemophilus influenzae
type b (Hib) vaccination on invasive H. influenzae disease;
14 countries routinely serotype all clinical isolates. Of the
10,081 invasive H. influenzae infections reported during
1996–2006, 4,466 (44%, incidence 0.28 infections/100,000
population) were due to noncapsulated H. influenzae
(ncHi); 2,836 (28%, 0.15/100,000), to Hib; and 690 (7%,
0.036/100,000), to non–b encapsulated H. influenzae. Invasive ncHi infections occurred in older persons more often than Hib (median age 58 years vs. 5 years, p<0.0001)
and were associated with higher case-fatality ratios (12%
vs. 4%, p<0.0001), particularly in infants (17% vs. 3%,
p<0.0001). Among non-b encapsulated H. influenzae, types
f (72%) and e (21%) were responsible for almost all cases;
the overall case-fatality rate was 9%. Thus, the incidence of
invasive non–type b H. influenzae is now higher than that of
Hib and is associated with higher case fatality.
aemophilus influenzae is differentiated according to its
capsular polysaccharide composition into 6 serotypes
(a–f) and noncapsulated strains (1). Before routine vaccination, H. influenzae type b (Hib) caused >80% of invasive H. influenzae infections, primarily in healthy children
<5 years of age (2). In contrast, non–type b H. influenzae
usually causes opportunistic infections (3–7), particularly
among elderly persons, who often have predisposing medical conditions such as chronic respiratory disease or immunosuppression (6–11).
H
Author affiliations: Health Protection Agency, London, UK (S. Ladhani, M.P.E. Slack, M. Chandra, M.E. Ramsay); National Institute
for Communicable Diseases, Johannesburg, South Africa (A. von
Gottberg); and St. George’s University of London, London (P.T.
Heath)
DOI: 10.3201/eid1603.090290
The introduction of the Hib conjugate vaccine into national childhood immunization programs in the 1990s has
resulted in a marked and sustained reduction in the incidence of invasive Hib disease in many countries (2). However, concern exists about the long-term effectiveness of the
Hib immunization programs (12) and possible disease replacement by other H. influenzae strains (13). Because Hib
conjugate vaccine reduces pharyngeal carriage (14), other
H. influenzae strains theoretically could take its place and
cause invasive disease (13,15). Elimination of Hib carriage
also may reduce natural boosting of immunity, thereby resulting in lower Hib antibody and increased susceptibility
to invasive Hib disease in the long term (16).
In 1996, a collaborative surveillance network was established in Europe to describe the impact of routine Hib
vaccination on the epidemiology of invasive H. influenzae disease. By 2006, a total of 28 countries participated
in surveillance, and 14 countries, comprising an annual
denominator population of 150 million persons, routinely
serotyped all invasive clinical H. influenzae isolates. We
describe the epidemiology of invasive H. influenzae disease in countries with established national Hib immunization programs, devoting particular attention to invasive
non–type b H. influenzae disease.
Methods
A 3-year European Union–funded study (the BIOMED
II Hib surveillance project) was initiated in 1996 to study
the epidemiology of invasive H. influenzae after the introduction of the Hib conjugate vaccine into national infant immunization programs. In 1998, this program was renamed
European Union Invasive Bacterial Infection Surveillance
(EU-IBIS) and expanded to include more countries; by
1
Participants listed at the end of this article.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
455
RESEARCH
2006, a total of 28 countries routinely reported cases to EUIBIS (www.euibis.org). Participating countries reported
cases of invasive H. influenzae disease to a central database,
with basic demographic details, clinical syndrome, outcome, specimen site, and serotyping data on isolates. The
UK Health Protection Agency Haemophilus Reference Unit
(HRU) coordinated development of standardized laboratory
protocols for growing, serotyping, and PCR genotyping H.
influenzae and exchange of clinical isolates to ensure consistency of results. HRU also provided genotypic confirmation of serotypes for countries without established reference
facilities and regularly distributed quality assurance strains
to participating laboratories to ensure comparability of results. Annual reports were made available to participants at
meetings and on the EU-IBIS website.
Invasive H. influenzae disease was defined as isolation
of the organism from a normally sterile site. A case of meningitis was defined as H. influenzae cultured from cerebrospinal fluid or clinical and/or radiologic features of meningitis with blood culture positive for H. influenzae. Other
clinical presentations, including epiglottitis, pneumonia,
cellulitis, and osteomyelitis, were defined as isolation of H.
influenzae from a normally sterile site (usually blood cultures but occasionally from another sterile site, e.g., joint
fluid in septic arthritis or pleural fluid in empyema) in a
person with clinical signs and symptoms consistent with
that presentation. Bacteremia was defined as growth of H.
influenzae from blood cultures only, with no distinctive
clinical syndrome identified.
This study included only countries that routinely vaccinated children against Hib before 2000 and serotyped at least
50% of all clinical isolates. Detailed surveillance methods
for all participating countries are available at www.euibis.
org. Germany and Israel reported data for children only and
were included in some of the analyses. Within the United
Kingdom, data from England and Wales were collected
separately from Scotland because the surveillance program
in England and Wales is separate from that in Scotland.
In Greece, during 1996–2002, surveillance was limited to
a single prefecture, Attiki, and provided data only for persons <15 years of age; after 2002, national data were available for Greece. Italy initially relied solely on laboratory
reporting with voluntary notification of confirmed cases of
meningitis, but a more active laboratory-based surveillance
system was established in 8 Italian regions in 1997–1998
(Campania, Liguria, Lombardia, Piemonte, Puglia, Toscana,
Trento, and Veneto), 7 regions in 1999–2002 (Lombardia
was no longer included), and nationally thereafter. All data
were collected as part of enhanced national surveillance and
rendered anonymous at the source.
Data were entered by using Microsoft Excel (Microsoft, Redmond, WA, USA), and statistical analysis was
performed by using Stata 8.0 (www.stata.com). Total and
456
age-grouped population estimates used as denominators for
incidence calculations were obtained either from the national statistics website of the relevant country or from EU-IBIS
participants (17). The denominator for disease incidence in
infants <1 month, 1–5 months, and 6–11 months of age was
estimated by dividing the number of infants (<1 year of age)
by 12 and multiplying by the number of months in each age
group, respectively. For non–type b encapsulated H. influenzae infections, we combined data on children 5–14 years of
age with data on adults 15–64 years of age because serotype
distribution, clinical presentation, and outcomes were similar for these 2 age groups. To estimate any increase in incidence of non–type b H. influenzae disease during the study
period, an overdispersed Poisson regression model was fitted for the number of non–type b cases with covariates for
year and country. To allow for changes in population and
proportion of total H. influenzae isolates serotyped by country and year, these variables were included in the model as
offsets. To control for differences in the collection of death
data, we estimated case-fatality ratios (CFRs) by using the
number of reported deaths as the numerator and all cases,
including those for which outcome was not reported, as the
denominator. We calculated age-adjusted odds ratios (ORs)
for noncapsulated H. influenzae (ncHi) and Hib using logistic regression; we inclulded age and serotype (e.g., ncHi
vs. Hib, H. influenzae type e [Hie] vs. H. influenzae type f
[Hif]) as independent variables. Ages are given as medians
and interquartile ranges (IQRs) and compared by using the
Mann-Whitney U test. Proportions were compared by using
the χ2 test or Fisher exact test; continuous variables were
compared by using Student t tests.
Results
During 1996–2006, a total of 14 countries reported 10,081 invasive H. influenzae cases, of which 2,836
(28.1%) were Hib, 690 (7.8%) were other capsulated H.
influenzae, and 4,466 (44.3%) were ncHi. For 125 (1.2%)
cases, the isolates were identified as non–type b, but complete serotyping was not performed. Capsular serotype was
not available for 1,964 (19.5%) isolates, mainly because
the isolate was not available for typing at the reference
laboratory (e.g., where the isolate could not be recultured).
The crude overall annual incidence rates for invasive Hib,
ncHi, and non–type b encapsulated H. influenzae infections
were 0.15, 0.28, and 0.036 cases per 100,000 population
(Table 1). After adjusting for the proportion of isolates not
serotyped in each country per year and population changes
over time, we found a small but statistically significant
increase in the incidence of non–type b H. influenzae disease (3.6% per year; 95% confidence interval [CI] 2.1%–
5.2%).
After 2000, when all countries included in the study
had implemented the Hib vaccine into their national im-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
H. influenzae Disease
Table 1. Incidence of invasive Hib and non–type b Haemophilus influenzae, by country and year of infection, Europe 1996–2006*
Incidence (no. cases)
Country
1996
1997
1998
1999
2000
2001
2002
2003
2004
2005
2006
Total
Austria
–
–
–
–
–
–
0
0.04
0.06
0.06
0.07
0.05
(3)
(5)
(5)
(6)
(19)
England, Wales
0.36
0.40
0.47
0.39
0.48
0.52
0.52
0.57
0.46
0.62
0.65
0.50
(183)
(205)
(244)
(202)
(248)
(274)
(273)
(302)
(245)
(333)
(350) (2859)
Finland
0.29
0.29
0.57
0.35
0.64
0.83
0.23
0.54
0.40
0.73
0.52
0.49
(15)
(15)
(29)
(18)
(33)
(43)
(12)
(28)
(21)
(38)
(27)
(279)
Greece
–
–
–
–
–
–
–
0
0.01
0
0
0.00
(1)
(1)
Iceland
–
–
–
1.08
0
0
0
0
0
0
0
0.13
(3)
(3)
Ireland
0.14
0.30
0.17
0.21
0.08
0.23
0.18
0.20
0.35
0.29
0.52
0.25
(5)
(11)
(6)
(8)
(3)
(9)
(7)
(8)
(14)
(12)
(22)
(105)
Italy
0.05
0.08
0.04
0.03
0.02
0.02
0.01
0.02
0.01
0.02
0.02
0.03
(26)
(45)
(23)
(15)
(11)
(10)
(3)
(11)
(4)
(11)
(12)
(171)
Malta
–
–
–
0
0
0
0
0
0.26
0
0
0.03
(1)
(1)
The Netherlands
0.41
0.44
0.45
0.36
0.38
0.44
0.43
0.64
0.49
0.61
0.61
0.48
(64)
(68)
(70)
(56)
(61)
(71)
(67)
(103)
(80)
(99)
(99)
(838)
Norway
–
–
–
1.51
1.12
1.04
1.39
0.92
0.83
0.85
1.12
1.10
(67)
(50)
(47)
(63)
(42)
(38)
(39)
(52)
(398)
Portugal
–
–
–
0.05
0.07
0.15
0.12
0.09
0.08
0.10
0.16
0.10
(5)
(7)
(15)
(12)
(9)
(8)
(11)
(17)
(84)
Scotland
–
–
–
0
0.04
0.10
0.34
0.55
0.61
0.65
0.57
0.36
(2)
(5)
(17)
(28)
(31)
(33)
(29)
(145)
Slovenia
–
–
–
–
0.30
0.80
0.35
0.60
0.60
0.40
0.60
0.52
(6)
(16)
(7)
(12)
(12)
(8)
(12)
(73)
0.22
0.26
0.28
0.24
0.27
0.31
0.28
0.31
0.26
0.33
0.35
0.28
Total non–type b H.
influenzae incidence
(293)
(344)
(372)
(374)
(421)
(490)
(461)
(546)
(460)
(589)
(626) (4,976)
Hib incidence
–
–
–
–
0.12
0.14
0.23
0.21
0.15
0.13
0.09
0.15
(182)
(212)
(376)
(380)
(268)
(239)
(168) (1,825)
Population, millions
132.5
132.8
132.9
153.9
156.3
156.9
165.6
177.4
178.5
179.8
180.6
*Per 100,000 population. Data for Attiki, Greece (1996–2002); Germany; and Israel were not included because their surveillance was limited to pediatric
cases. Hib, H. influenza type b.
munization programs, 7,211 H. influenzae cases occurred,
including 2,005 (27.8%) Hib and 3,172 (44.0%) ncHi
cases. Patient sex did not differ for Hib and ncHi infections (931/1,948 [47.8%]) Hib cases in female patients and
1,519/3,116 [48.7%] ncHi cases in male patients; χ2 = 0.44;
p = 0.51). However, a higher proportion of women in the
25–44-year age group developed invasive ncHi infection:
117/165 (70.9%) for those 25–34 years of age and 93/166
(56.0%) for those 35–44 years of age, compared with
1,310/2,785 (47.0%) for the other age groups. Women 25–
44 years of age who had invasive ncHi infection also were
more likely than men in the same age group to have bacteremia (173/288 [60.1%] vs. 69/175 [39.4%]; χ2 = 18.6;
p<0.001). For Hib, sex was not associated with clinical presentation for persons in any age group.
Children with Hib disease were much younger than
those with ncHi (median 4.5 years [IQR 1.5–46.3 years] vs.
58.2 [IQR 6.8–76.4]) years, p<0.0001) (Figure). More than
half of Hib cases, compared with fewer than one quarter of
ncHi cases, occurred in children <5 years of age (χ2 = 438;
p<0.0001). By contrast, only 13.7% of Hib cases occurred
in persons >65 years of age, compared with 42.7% of ncHi
(χ2 = 483; p<0.0001). The most common clinical diagnosis
was bacteremia for both Hib and ncHi, but the median age
of persons with Hib bacteremia was much lower than for
that for those with ncHi bacteremia (Table 2). Hib meningitis occurred mainly in infants, whereas ncHi meningitis occurred in all age groups. Overall, ncHi was responsible for
one third of all meningitis cases but accounted for 18.4% of
meningitis cases in children <5 years of age and for 62.9%
of persons >65 years of age. Hib was responsible for 84.1%
of epiglottitis cases; only 6.6% were caused by ncHi. Hib
pneumonia occurred mainly in adults and elderly persons;
ncHi pneumonia occurred more often in children <5 years
of age and in elderly persons.
In infants, the overall incidence of Hib and ncHi was
similar, but incidence of the latter was much higher in the
first month of life (11.4 vs. 1.2 cases per 100,000 population). In the first month, ncHi cases were more likely to
occur in the first week (148/182 [81.3%]) compared with
Hib (9/19 [47.4%] cases; χ2 = 11.6; p = 0.001); 112/148
(75.7%) of ncHi case-patients in the first week of life
had bacteremia, compared with 50.0% (17/34) of those
in whom ncHi occurred at 7–30 days of life (χ2 = 8.8;
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
457
RESEARCH
Figure. Age-specific incidence for disease caused by Haemophilus
influenzae type b (Hib) and noncapsulated H. influenzae (ncHi) for
all countries combined, Europe, 2000–2006. A) All age groups; B)
infants <1 year of age.
p = 0.003). Infections from ncHi in infants decreased after
the first month of life and remained fairly constant during
the first year (Figure).
A total of 585 (8.1%) of the 7,211 persons with H. influenzae died; CFRs were highest for persons >65 years of
age and for infants. We found no association between death
and sex or year of infection. In most age groups, CFRs were
higher for ncHi than for Hib; the largest difference was for
infants (Table 3). For both Hib and ncHi, the CFR was lower for meningitis than for other clinical presentations. The
age-adjusted OR for death from ncHi compared with Hib
was 2.4 (95% CI 1.9–3.1, p<0.0001) overall, 3.3 (95% CI
1.5–7.5; p = 0.004) for pneumonia, and 3.3 (95% CI 1.5–
7.5; p = 0.004) for bacteremia. The OR for meningitis was
not significant (OR 0.85, 95% CI 0.4–1.9 years; p = 0.68).
Invasive infections caused by non–type b encapsulated
H. influenzae were rare. Cases did not cluster by country or
time, and individual serotypes or incidence, either overall
or in any single country, did not increase during the 11-year
study period. Of the 690 cases, Hif was the most prevalent subtype (500 [72.5%] patients) followed by Hie (143
[20.7%]) (Table 4). The overall CFR was 9.1% (63/690
patients). The CFR increased with age and was highest
for bacteremia (36/292 [12.3%]) and pneumonia (15/127
[11.8%]) compared with meningitis (5/120 [4.2%]) and epiglottitis (0/10). CFR was highest for Hie infections (23/143
patients [16.1%]), particularly for persons >65 years of age
(17/72 [23.6%]); however, none of the 22 children <16
458
years of age who had Hie infection died. Compared with
Hif, the age-adjusted OR for death from Hie was 2.0 (95%
CI 1.1–3.9; p = 0.035). All 3 Hia-related fatalities occurred
in children <2 years who had meningitis.
The epidemiology of non–type b encapsulated H.
influenzae varied with age. A total of 140 (20.4% of all
infections) occurred in children <5 years of age. In this
age group, meningitis (61 [43.6%] patients) was the most
common clinical presentation and was caused by Hif (49
patients [80.3%]), Hie (7 patients [11.5%]), and Hia (5 patients [8.2%]). Children <5 years of age were more likely
to have meningitis than were older children and adults
(61/120 [50.8%] vs. 59/548 [10.8%]; χ2 = 83; p<0.0001).
Two thirds of Hia infections (17/26 [65.4%] patients) occurred in children <5 years of age, compared with 21.2%
(106/500) of Hif, 9.8% (14/143) of Hie, and 33.3% of Hic
(3/9). Persons in this age group with either Hif (49/106
[46.2%] vs. 37/392 [9.4%]; χ2 = 79.0; p<0.0001) or Hie
(7/14 [50.0%] vs. 15/129 [11.6%]; χ2 = 14.3; p<0.0001) infections were more likely to have meningitis, whereas older
children and adults were more likely to have bacteremia
and pneumonia. The CFR for children <5 years of age was
lower than that for older children and adults (6/140 [4.3%]
vs. 57/548 [10.4%]; χ2 = 5.0; p = 0.025).
Non–type b encapsulated H. influenzae infections
among the 247 persons 5–64 years of age resulted mainly
from Hif (17 [69.2%]) and Hie (57 [23.1%]). Most Hic (5/9
[55.6%]) and Hid (10/12 [83.3%]) infections also occurred
in this age group. All serotypes were responsible for the 45
meningitis cases: Hif (26 [57.8%]), Hie (12 [26.7%]), Hid
(4 [8.9%]), Hic (2 [4.4%]), and Hia (1 case [2.2%]). The
CFR for this age group was 7.3% (18/247 patients), but no
persons with meningitis died, compared with 12.0% (9/75
patients) and 11.5% (6/52 patients) of those with bacteremia and pneumonia, respectively.
Almost half the cases (301 [43.6%]) occurred among
persons >65 years of age; Hif (221/301 [73.4%]) and Hie
(72/301 [23.9%]) accounted for almost all cases. The overall CFR was highest for this age group (39/301 [13.0%]
patients) and similar for those with bacteremia (17/102
[16.7%]), pneumonia (9/59 [15.3%]), or meningitis (2/14
[14.3%]). The CFR for Hie was 23.6% (17/72 patients),
compared with 10.0% (22/221) for Hif (χ2 = 8.8; p = 0.003)
for persons >65 years of age.
Discussion
The marked reduction in invasive Hib disease after the
introduction of the Hib conjugate vaccine had prompted
concerns that other H. influenzae serotypes, ncHi, or other
respiratory pathogens might fill the ecologic niche. However, little evidence exists for a substantial or sustained
increase in invasive non–type b H. influenzae infections
(18). The rise in Hib incidence during 2000–2002 resulted
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
H. influenzae Disease
Table 2. Hib and ncHi cases, by diagnosis and age group, Europe 1996–2006*
Age group
Diagnosis
<1 mo 1–5 mo 6–11 mo
<1 y
1–4 y
5–14 y 15–44 y 45–64 y >65 y
Hib
Meningitis
6
93
98
197
282
45
26
17
12
(31.6)
(60.4)
(57.6)
(57.4)
(41.2)
(23.0)
(10.0)
(7.1)
(4.4)
Epiglottitis
0
1
4
5
110
29
45
37
22
(0.6)
(2.4)
(16.1)
(14.8)
(17.4)
(15.4)
(8.0)
(1.5)
Cellulitis
0
7
18
25
15
3
0
1
4
(4.5)
(10.6)
(7.3)
(2.2)
(1.5)
(0.4)
(1.5)
OM/SA
0
4
5
9
24
4
4
6
1
(2.6)
(2.9)
(2.6)
(3.5)
(2.0)
(1.5)
(2.5)
(0.4)
Pneumonia
0
3
5
8
20
15
35
36
47
(1.9)
(2.9)
(2.3)
(7.7)
(13.5)
(14.9)
(17.2)
(2.9)
33
30
74
193
73
102
96
134
Bacteremia
11
(21.4)
(17.6)
(21.6)
(28.2)
(37.2)
(39.4)
(39.8)
(48.9)
(57.9)
Other
0
1
2
3
10
6
10
11
7
(0.6)
(1.2)
(0.9)
(1.5)
(4.6)
(3.1)
(3.9)
(2.6)
NR
2
12
8
22
30
21
37
37
47
(10.5)
(7.8)
(4.7)
(6.4)
(4.4)
(10.7)
(14.3)
(15.4)
(17.2)
All cases
19
154
170
343
684
196
259
241
274
(100.0) (100.0) (100.0) (100.0) (100.0) (100.0) (100.0) (100.0) (100.0)
ncHi
Meningitis
8
15
19
42
76
37
65
63
45
(4.4)
(13.6)
(19.4)
(10.8)
(22.6)
(24.2)
(14.3)
(13.6)
(3.3)
Epiglottitis
2
0
0
2
2
1
5
5
3
(1.1)
(0.5)
(0.6)
(0.7)
(1.1)
(1.1)
(0.2)
Cellulitis
0
0
1
1
4
5
0
0
4
(1.0)
(0.3)
(1.2)
(3.3)
(0.3)
OM/SA
0
0
0
0
2
1
2
2
4
(0.6)
(0.7)
(0.4)
(0.4)
(0.3)
Pneumonia
10
14
11
35
39
11
34
56
226
(5.5)
(12.7)
(11.2)
(9.0)
(11.6)
(7.2)
(7.5)
(12.1)
(16.7)
Bacteremia
129
53
46
228
151
74
236
218
759
(70.9)
(48.2)
(46.9)
(58.5)
(44.8)
(48.4)
(52.0)
(47.0)
(56.1)
Other
3
8
8
19
21
5
20
9
38
(1.6)
(7.3)
(8.2)
(4.9)
(3.3)
(4.4)
(1.9)
(6.2)
(2.8)
NR
30
20
13
63
42
19
92
111
275
(16.5)
(18.2)
(13.3)
(16.2)
(12.5)
(12.4)
(20.3)
(23.9)
(20.3)
All cases
182
110
98
390
337
153
454
464
1354
(100.0) (100.0) (100.0) (100.0) (100.0) (100.0) (100.0) (100.0) (100.0)
NR
Total
1
(12.5)
0
580
(28.9)
248
(12.4)
48
(2.4)
48
(2.4)
162
(8.1)
674
(33.6)
47
(2.3)
198
(9.9)
2005
(100.0)
0
0
1
(12.5)
2
(25.0)
0
4
(50.0)
8
(100.0)
4
(20.0)
0
0
0
0
10
(50.0)
2
(10.0)
4
(20.0)
20
(100.0)
332
(10.5)
18
(0.6)
14
(0.4)
11
(0.3)
401
(12.6)
1,676
(52.8)
114
(3.6)
606
(19.1)
3,172
(100.0)
Median
age, y
1.6
6.7
1.0
2.1
46.7
13.6
34.6
39.0
4.5
19.7
42.1
11.6
56.6
70.0
59.6
31.2
61.3
58.2
*Pediatric cases only for Attiki, Greece (1996–2002); Germany (1998 onward); and Israel (1996 onward). Values are no. (%) cases except as indicated.
Hib, Haemophilus influenzae type b; ncHi, noncapsulated H. influenzae; NR, not recorded; OM/SA, osteomyelitis/septic arthritis.
mainly from an increase in the United Kingdom and the
Netherlands; however, rates remained well below those in
the prevaccine era (19,20).
Although prospective enhanced national surveillance
may be incomplete (21), comparisons over time and across
serotypes are largely valid, assuming serotyping is accurate
and complete. In addition, although lower ascertainment
might lead to lower estimation of the true incidence of invasive H. influenzae disease, it is less likely to affect the clinical presentation, age distribution, outcome, or proportion of
cases due to the different serotypes. All participating countries had reference laboratories that routinely serotyped all
invasive H. influenzae strains and participated in an external
quality assurance scheme. As a result, 80.5% of 10,081 H.
influenzae isolates identified were serotyped. The robustness
of the surveillance is demonstrated by the incidence of inva-
sive non–type b disease, which remained relatively constant
over the 11-year study period despite increasing numbers of
participating countries and provides further confidence that
replacement disease is not occurring (18,22,23).
In countries with established Hib immunization programs, the incidence of ncHi is now higher than that of
Hib. Unlike Hib, however, invasive ncHi infections occur
mainly in neonates and elderly persons. Neonatal ncHi infections are well described but account for <5% of all neonatal invasive bacterial infections (3,24,25). The infection
develops rapidly (usually within 48 hours after birth) and
follows a fulminant course with a high CFR, particularly in
preterm infants (3). Invasive ncHi disease in neonates also
is associated with septicemia in the mother, increased complications during labor, and preterm delivery (24,26,27).
In our study, ncHi was more common among women in
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
459
RESEARCH
Table 3. Case-fatality rates for Hib and ncHi, by diagnosis and patient age group, Europe, 1996–2006*
Age group
Diagnosis
<1 mo
1–5 mo 6–11 mo
<1 y
1–4 y
5–14 y
15–44 y 45–64 y
>65 y
Hib
Meningitis
1/6
3/93
2/98
6/197
11/282
4/45
0/26
1/17
2/12
(16.7)
(3.2)
(2.0)
(3.0)
(3.9)
(8.9)
(0)
(5.9)
(16.7)
Epiglottitis
–
0/1
0/4
0/5
3/110
1/29
2/45
2/37
0/22
(0)
(0)
(0)
(2.7)
(3.4)
(4.4)
(5.4)
(0)
Cellulitis
–
0/7
0/18
0/25
0/15
0/3
–
0/1
0/4
(0)
(0)
(0)
(0)
(0)
(0)
(0)
OM/SA
–
0/4
0/5
0/9
0/24
0/4
0/4
0/6
0/1
(0)
(0)
(0)
(0)
(0)
(0)
(0)
(0)
Pneumonia
–
0/3
0/5
0/8
0/20
0/15
1/35
1/36
5/47
(0)
(0)
(0)
(0)
(0)
(2.9)
(2.8)
(10.6)
2/73
7/102
4/96
18/134
Bacteremia 0/11 (0)
2/33
1/30
3/74
6/193
(3.1)
(2.7)
(6.9)
(4.2)
(13.4)
(6.1)
(3.3)
(4.1)
Other
–
1/1
0/2 (0)
1/3
1/10
0/6 (0)
2/10
0/11 (0)
0/7 (0)
(100.0)
(33.3)
(10.0)
(20.0)
NR
0/2 (0)
0/12 (0)
0/8 (0)
0/22 (0) 0/30 (0) 0/21 (0)
1/37
1/37
1/47
(2.7)
(2.7)
(2.1)
All cases
1/19
6/154
3/170
10/343
21/684
7/196
13/259
9/241
26/274
(5.3)
(3.9)
(1.8)
(2.9)
(3.1)
(3.6)
(5.0)
(3.7)
(9.5)
ncHi
Meningitis
0/8
1/15
1/19
2/42
4/76
3/37
0/65
1/63
2/45
(0)
(6.7)
(5.3)
(4.8)
(5.3)
(8.1)
(0)
(1.6)
(4.4)
Epiglottitis
1/2
–
–
1/2
0/2
0/1
0/5
0/5
0/3
(50.0)
(50.0)
(0)
(0)
(0)
(0)
(0)
Cellulitis
–
–
0/1
0/1
0/4
0/5
–
–
1/4
(0)
(0)
(0)
(0)
(25.0)
OM/SA
–
–
–
–
0/2
0/1
0/2
0/2
0/4
(0)
(0)
(0)
(0)
(0)
Pneumonia
3/10
0/14
1/11
4/35
4/39
2/11
4/34
6/56
40/226
(30.0)
(0)
(9.1)
(11.4)
(10.3)
(18.2)
(11.8)
(10.7)
(17.7)
Bacteremia 22/129
18/53
0/46
40/228
14/151
2/74
11/236
22/218
131/759
(17.1)
(34.0)
(0)
(17.5)
(9.3)
(2.7)
(4.7)
(10.1)
(17.3)
Other
2/3
6/8
5/8
13/19
6/21
1/5
0/20
0/9
4/38
(66.7)
(75.0)
(62.5)
(68.4)
(28.6)
(20.0)
(0)
(0)
(10.5)
NR
1/30
5/20
2/13
8/63
3/42
0/19
1/92
7/111
24/275
(3.3)
(25.0)
(15.4)
(12.7)
(7.1)
(0)
(1.1)
(6.3)
(8.7)
All cases
29/182
30/110
9/98
68/390
31/337
8/153
16/454
36/464
202/135
(15.9)
(27.3)
(17.4)
4 (14.9)
(9.2)
(9.2)
(5.2)
(3.5)
(7.8)
NR
Total
0/1
(0)
–
24/580
(4.1)
8/248
(3.2)
0/48
(0)
0/48
(0)
8/162
(4.9)
41/674
(6.1)
4/47 (8.5)
–
–
1/1
(100)
1/2
(50.0)
–
0/4 (0)
2/8
(25.0)
2/4
(50.0)
–
–
–
–
2/10
(20.0)
1/2
(50.0)
0/4
(0)
5/20
(25.0)
3/198
(1.5)
88/2,005
(4.4)
14/332
(4.2)
1/18
(5.6)
1/14
(7.1)
0/11
(0)
60/401
(15.0)
222/1,676
(13.2)
25/114
(21.9)
43/606
(7.1)
366/3,172
(11.5)
*Pediatric cases only for Attiki, Greece (1996–2002); Germany (1998 onward); and Israel (1996 onward). Values are no. deaths/no. cases (case-fatality
rate). Hib, Haemophilus influenzae type b; ncHi, noncapsulated H. influenzae; OM/SA, osteomyelitis/septic arthritis; NR, not recorded.
the 25–44-year age group, suggesting that childbearingaged women may be at increased risk for invasive ncHi
infections. This finding may reflect increased exposure,
for example, because of contact with children or increased
susceptibility, such as in pregnancy. In older children and
adults who develop invasive ncHi infections, studies have
reported that more than half the case-patients had serious
predisposing medical conditions, such as chronic respiratory disease and impaired immunity (3–7). Unfortunately,
because clinical information collected for individual cases
in our study was limited, we could not further elucidate
possible risk factors for invasive infections caused by the
different serotypes.
Infection from non–type b encapsulated H. influenzae
is extremely rare and mostly caused by Hif and Hie. Other
population-based studies also have reported a predomi460
nance of Hif and, to a lesser extent, Hie among non–type b
encapsulated H. influenzae in adults and children (3,6,28).
The clinical presentations of both Hif and Hie disease are
almost identical and similar to that of ncHi infections in
that almost half the cases occurred among persons >65
years of age who usually had bacteremia and pneumonia
(6,7). Although 44% of Hif infections occurred among persons >65 years of age, compared with 21% among children
<5 years, the incidence was almost the same in the 2 age
groups. Hif and Hie have considerably restricted genetic
diversity, and most infections are caused by a few strains
that may be intrinsically more pathogenic than noninvasive
strains (29). Other studies have reported that, as with ncHi,
60%–80% of persons with invasive Hif disease and Hie had
underlying conditions that predisposed them to opportunistic infections (3,6,9–11,25,30–32).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
H. influenzae Disease
Table 4. Epidemiology, diagnosis, and outcome of invasive non–type b Haemophilus influenzae infections, by serotype and age group,
Europe, 1996–2006*
Data
Hia, n = 26
Hic, n = 9
Hid, n = 12
Hie, n = 143 Hif, n = 500 Total, N = 690
Diagnosis, no. (%) cases
Bacteremia
5 (19.2)
1 (11.1)
0
44 (30.8)
157 (31.4)
207 (30.0)
Pneumonia
3 (11.5)
3 (33.3)
2 (16.7)
28 (19.6)
91 (18.2)
127 (18.4)
Meningitis
6 (23.1)
2 (22.2)
4 (33.3)
22 (15.4)
86 (17.2)
120 (17.4)
Other
6 (23.1)
0 (0)
1 (8.3)
30 (21.0)
87 (17.4)
124 (18.0)
Unknown
6 (23.1)
3 (33.3)
5 (41.7)
19 (13.3)
79 (15.8)
112 (16.2)
Total
26 (100.0)
9 (100.0)
12 (100.0)
143 (100.0)
500 (100.0)
690 (100.0)
Median age at disease onset, y (IQR)
2.1
52.0
36.5
65.3
61.0
60.7
(0.8–43.7)
(1.9–53.3)
(14.4–47.0)
(34.0–8.3)
(12.7–75.2)
(15.4–75.1)
Incidence/million cases (total no. cases) by age group, y
<5
0.12 (17)
0.02 (3)
0
0.10 (14)
0.78 (106)
1.02 (140)
5–64
0.00 (4)
0.00 (5)
0.01 (10)
0.04 (57)
0.12 (171)
0.17 (247)
0.02 (5)
0.00 (1)
0.01 (2)
0.25 (72)
0.77 (221)
1.04 (301)
>65
All age groups
0.01 (26)
0.00 (9)
0.01 (12)
0.08 (143)
0.26 (500)†
0.36 (690)†
No. cases (%) by age group, y
<5
17 (65.4)
3 (33.3)
0
14 (9.8)
106 (21.2)
140 (20.3)
5–64
4 (15.4)
5 (55.6)
10 (83.3)
57 (39.9)
171 (34.2)
247 (35.8)
>65
5 (19.2)
1 (11.1)
2 (16.7)
72 (50.3)
221 (44.2)
301 (43.6)
All age groups
26 (100.0)
9 (100.0)
12 (100.0)
143 (100.0) 500 (100.0)† 690 (100.0)†
No. (%) deaths by age group, y
<5
3 (17.6)
0
–
0
3 (2.8)
6 (4.3)
5–64
0
1 (20.0)
0
6 (10.5)
11 (6.4)
18 (7.3)
>65
0
0
0
17 (23.6)
22 (10.0)
39 (13.0)
All age groups
3 (11.5)
1 (11.1)
0
23 (16.1)
36 (7.2)†
63 (9.1)†
Median age at death, y (IQR)
0.50
55.0‡
–
70.0
72.3
70.5
(0.47–2.3)
(63.8–88.9)
(55.9–83.4)
(51.7–83.7)
*Hia, H. influenzae type a; Hic, H. influenzae type c; Hid, H. influenzae type d; Hie, H. influenzae type e; Hif, H. influenzae type f; IQR, interquartile range.
†Ages were not known for 2 persons with Hif infection.
‡Only 1 death was caused by this serotype.
In contrast to Hif and Hie, invasive Hia infections
were similar to Hib infection in that they occurred mainly
in young children who often had meningitis (2). In our
study, the incidence of Hia in children <5 years of age
(0.12/million) was much lower than that reported in Navajo and White Mountain Apache children <5 years of age
(20 cases/100,000 population) (33), Alaska Native children <2 years of age (21/100,000) (34), and northern Canadian aboriginal children <2 years of age (102/100,000)
(34). The same populations are also highly susceptible
to invasive Hib disease (35,36). Hia and Hib have the
most closely related capsules (37) and a similar degree of
genetic diversity (29).
Infections caused by Hic and Hid are rare and have low
CFRs, suggesting that they may not be particularly virulent.
There is a paucity of information on infections caused by
these serotypes, even in the form of individual case reports.
Our data suggest that these invasive Hic and Hid infections
are more common in adults. A recent US study reported
that, of 770 cases of invasive H. influenzae disease during
1996–2004 in Illinois, 3 (43%) of 7 Hic, and 4 (67%) of 6
Hid cases occurred in persons 18–64 years of age (28).
That CFR from invasive Hib disease remains low and
similar to that reported in other industrialized countries is
reassuring, even though it has not changed substantially
from the prevaccine era (2,38). In contrast, CFRs for ncHi
and non–type b encapsulated H. influenzae were significantly higher than for Hib. The CFRs in our study should
be considered a minimum because we cannot be sure that
all deaths would be reported to the surveillance systems,
particularly if death occurred a considerable time after infection. Other studies with more active follow-up in adults
with ncHi infections have reported CFRs of 13%–20% (28)
and up to 29% within 1 month after infection (7). Although
the high CFRs associated with early-onset neonatal ncHi is
well described (3), our finding of such high CFRs in infants
was unexpected. Whether these infants had any underlying medical conditions that predisposed them to death or
the organisms causing infection in this age group are more
virulent is not known. The CFR for invasive non–type b
encapsulated H. influenzae infections was also higher than
for Hib and comparable to the 15%–30% reported in other
studies (7,28). The higher CFR for invasive ncHi infections
among elderly persons and persons with other clinical diagnoses (Table 3) most likely results from a higher prevalence of underlying medical conditions predisposing them
to opportunistic infections. In the latter group, for example,
ncHi was often isolated from uncommon sterile sites, such
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
461
RESEARCH
as peritoneal and pericardial fluid, renal and spleen biopsy
specimens, and brain abscesses, suggesting that such persons may have serious underlying medical conditions at the
time of infection. Underlying medical conditions also may
explain why CFRs may be higher for persons with invasive
Hie infections; the small number of Hie cases compared
with Hib, ncHi, or Hif suggests that this serotype is not particularly virulent. Other studies have reported higher CFRs
for Hie than for Hif, particularly for elderly persons (28).
Thus, despite the reduction in Hib disease, continued
surveillance is needed for all H. influenzae infections across
all age groups to assess the long-term effectiveness of Hib
vaccination, rapidly detect unexpected population effects
and potential changes in circulating strains, and monitor
changes in the epidemiology of invasive H. influenzae disease. Further studies are needed to define more clearly host
and pathogen risk factors for invasive H. influenzae infection and factors associated with death.
European Union Invasive Bacterial Infection Surveillance
participants: Peter McIntyre, Lyn Gilbert, Geoff Hogg (Australia); Reinhild Strauss, Sigrid Heuberger (Austria); Germaine Hanquet, Francoise Crokaert (Belgium); Pavla Krizova, Vera Lebedova (Czech Republic); Kåre Mølbak, Jens Jørgen Christensen
(Denmark); Kuulo Kutsar, Unna Joks (Estonia); Elja Herva,
Tarja Kaijalainen, Maija Leinonen, Petri Ruutu (Finland); Agnes Lepoutre, Henri Dabernat (France); Anette Siedler, Heinz-J.
Schmitt (Germany); Marie Theodoridou, Anastasia Pangalis,
Georgina Tzanakaki (Greece); Miklos Fuzi, Katalin Krisztalovics
(Hungary); Thorolfur Gudnason, Hjordis Hardardottir (Iceland);
Mary Cafferkey, Suzanne Cotter, Darina O’Flanagan (Republic
of Ireland); Ron Dagan (Israel); Marina Cerquetti, Marta Ciofi
degli Atti (Italy); Irina Lucenko (Latvia); Grazina Rimseliene,
Snieguole Dauksiene (Lithuania); Pierette Huberty-Krau, Francois Schneider (Luxembourg); Jackie Maistre Melillo (Malta);
Sabine de Greeff, Hester de Melker, Lodewijk Spanjaard (Netherlands); Hans Blystad, E. Arne Hoiby, Øistein Løvoll (Norway);
Andrzej Zielinski, Waleria Hryniewicz, Anna Skoczynska, Marcin Kadlubowski (Poland); Laurinda Queirós, Paula Lavado (Portugal); Claire Cameron, Barbara Denham, Fiona Johnston (Scotland); Margareta Slacikova, Elena Novakova (Slovak Republic);
Alenka Kraigher, Metka Paragi (Slovenia); Jose Campos, Javier
Diez-Domingo (Spain); Rose-Marie Carlsson, Birgitta Henriques
Normark (Sweden); Hans-Peter Zimmermann (Switzerland).
Directorate-General for Health and Consumer Protection)
agreement no.2003202 (2001–2003), EU DG SANCO agreement no.2003202 (2003–2006). Dr Ladhani’s salary was funded
through a competitive 2-year fellowship awarded by the European
Society for Paediatric Infectious Diseases.
Dr Ladhani is a consultant in pediatric infectious diseases
at the National Centre for Infections, Health Protection Agency,
London. He was awarded a 2-year European Society for Paediatric Infectious Diseases fellowship to study the epidemiology of
invasive Hib disease. His research interests include pediatric vaccinology and genetic epidemiology.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Acknowledgments
We thank Nick Andrews for his help with statistical analysis.
This study was funded by European Union Biomedicine
and Health Research Programme II Reference BMH4960984
(1996–1999), EU DG SANCO agreement no. VS/1999/3504
99CVF4-031 (1999–2001), EU DG SANCO (European Union
462
11.
12.
Pittman M. Variation and type specificity in the bacterial species Haemophilus influenzae. J Exp Med. 1931;53:471–92. DOI:
10.1084/jem.53.4.471
Peltola H. Worldwide Haemophilus influenzae type b disease at the
beginning of the 21st century: global analysis of the disease burden
25 years after the use of the polysaccharide vaccine and a decade
after the advent of conjugates. Clin Microbiol Rev. 2000;13:302–17.
DOI: 10.1128/CMR.13.2.302-317.2000
Heath PT, Booy R, Azzopardi HJ, Slack MP, Fogarty J, Moloney
AC, et al. Non–type b Haemophilus influenzae disease: clinical
and epidemiologic characteristics in the Haemophilus influenzae type b vaccine era. Pediatr Infect Dis J. 2001;20:300–5. DOI:
10.1097/00006454-200103000-00016
Cardines R, Giufre M, Mastrantonio P, Ciofi Degli Atti ML, Cerquetti
M. Nontypeable Haemophilus influenzae meningitis in children:
phenotypic and genotypic characterization of isolates. Pediatr Infect
Dis J. 2007;26:577–82. DOI: 10.1097/INF.0b013e3180616715
O’Neill JM, St Geme JW III, Cutter D, Adderson EE, Anyanwu
J, Jacobs RF, et al. Invasive disease due to nontypeable Haemophilus influenzae among children in Arkansas. J Clin Microbiol.
2003;41:3064–9. DOI: 10.1128/JCM.41.7.3064-3069.2003
Campos J, Hernando M, Román F, Pérez-Vázquez M, Aracil B, Oteo
J, et al. Analysis of invasive Haemophilus influenzae infections after
extensive vaccination against H. influenzae type b. J Clin Microbiol.
2004;42:524–9. DOI: 10.1128/JCM.42.2.524-529.2004
Sarangi J, Cartwright K, Stuart J, Brookes S, Morris R, Slack M. Invasive Haemophilus influenzae disease in adults. Epidemiol Infect.
2000;124:441–7. DOI: 10.1017/S0950268899003611
Perdue DG, Bulkow LR, Gellin BG, Davidson M, Petersen KM,
Singleton RJ, et al. Invasive Haemophilus influenzae disease in
Alaskan residents aged 10 years and older before and after infant
vaccination programs. JAMA. 2000;283:3089–94. DOI: 10.1001/
jama.283.23.3089
Urwin G, Krohn JA, Deaver-Robinson K, Wenger JD, Farley MM.
Invasive disease due to Haemophilus influenzae serotype f: clinical and epidemiologic characteristics in the H. influenzae serotype b
vaccine era. The Haemophilus influenzae Study Group. Clin Infect
Dis. 1996;22:1069–76.
Bruun B, Gahrn-Hansen B, Westh H, Kilian M. Clonal relationship
of recent invasive Haemophilus influenzae serotype f isolates from
Denmark and the United States. J Med Microbiol. 2004;53:1161–5.
DOI: 10.1099/jmm.0.45749-0
Gilsdorf JR. Haemophilus influenzae non–type b infections in children. Am J Dis Child. 1987;141:1063–5.
Blanchard-Rohner G, Pollard AJ. Sustaining immunity after immunization against encapsulated bacteria. Hum Vaccin. 2008;4:309–
12.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
H. influenzae Disease
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
Tsang R. Capsule switching and capsule replacement in vaccinepreventable bacterial diseases. Lancet Infect Dis. 2007;7:569–70.
DOI: 10.1016/S1473-3099(07)70191-3
Takala AK, Eskola J, Leinonen M, Kayhty H, Nissinen A, Pekkanen
E, et al. Reduction of oropharyngeal carriage of Haemophilus influenzae type b (Hib) in children immunized with an Hib conjugate
vaccine. J Infect Dis. 1991;164:982–6.
Ribeiro GS, Reis JN, Cordeiro SM, Lima JB, Gouveia EL, Petersen
M, et al. Prevention of Haemophilus influenzae type b (Hib) meningitis and emergence of serotype replacement with type a strains
after introduction of Hib immunization in Brazil. J Infect Dis.
2003;187:109–16. DOI: 10.1086/345863
McVernon J, Trotter CL, Slack MP, Ramsay ME. Trends in Haemophilus influenzae type b infections in adults in England and
Wales: surveillance study. BMJ. 2004;329:655–8. DOI: 10.1136/
bmj.329.7467.655
EU-IBIS Network. Invasive Haemophilus influenzae in Europe
2006. London: Health Protection Agency; 2007 [cited 2010 Jan 18].
http://www.euibis.org/documents/2006_hib.pdf
Ladhani S, Ramsay ME, Chandra M, Slack MP. No evidence for Haemophilus influenzae serotype replacement in Europe after introduction of the Hib conjugate vaccine. Lancet Infect Dis. 2008;8:275–6.
DOI: 10.1016/S1473-3099(08)70078-1
Ladhani S, Slack MP, Heys M, White J, Ramsay ME. Fall in Haemophilus influenzae serotype b (Hib) disease following implementation of a booster campaign. Arch Dis Child. 2008;93:665–9. DOI:
10.1136/adc.2007.126888
Spanjaard L. van den Hof S, de Melker HE, Vermeer-de Bondt PE,
van der Ende A, Rijkers GT. Increase in the number of invasive
Haemophilus influenzae type b infections [in Dutch]. Ned Tijdschr
Geneeskd. 2005;149:2738–42.
Milde-Busch A, Kalies H, Ruckinger S, Siedler A, Rosenbauer J.
von KR. Surveillance for rare infectious diseases: is one passive data
source enough for Haemophilus influenzae? Eur J Public Health.
2008;18:371–5. DOI: 10.1093/eurpub/ckn023
Ribeiro GS, Lima JB, Reis JN, Gouveia EL, Cordeiro SM, Lobo TS,
et al. Haemophilus influenzae meningitis 5 years after introduction
of the Haemophilus influenzae type b conjugate vaccine in Brazil.
Vaccine. 2007;25:4420–8. DOI: 10.1016/j.vaccine.2007.03.024
Singleton R, Hammitt L, Hennessy T, Bulkow L, Debyle C, Parkinson A, et al. The Alaska Haemophilus influenzae type b experience:
lessons in controlling a vaccine-preventable disease. Pediatrics.
2006;118:e421–9. DOI: 10.1542/peds.2006-0287
Takala AK, Pekkanen E, Eskola J. Neonatal Haemophilus influenzae infections. Arch Dis Child. 1991;66:437–40. DOI: 10.1136/
adc.66.4_Spec_No.437
Falla TJ, Dobson SR, Crook DW, Kraak WA, Nichols WW, Anderson EC, et al. Population-based study of non-typable Haemophilus influenzae invasive disease in children and neonates. Lancet.
1993;341:851–4. DOI: 10.1016/0140-6736(93)93059-A
Courtney SE, Hall RT. Haemophilus influenzae sepsis in the premature infant. Am J Dis Child. 1978;132:1039–40.
Friesen CA, Cho CT. Characteristic features of neonatal sepsis due
to Haemophilus influenzae. Rev Infect Dis. 1986;8:777–80.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
Dworkin MS, Park L, Borchardt SM. The changing epidemiology of invasive Haemophilus influenzae disease, especially in
persons > or = 65 years old. Clin Infect Dis. 2007;44:810–6. DOI:
10.1086/511861
Omikunle A, Takahashi S, Ogilvie CL, Wang Y, Rodriguez CA,
St Geme JW III, et al. Limited genetic diversity of recent invasive
isolates of non-serotype b encapsulated Haemophilus influenzae. J
Clin Microbiol. 2002;40:1264–70. DOI: 10.1128/JCM.40.4.12641270.2002
Campos J, Roman F, Perez-Vazquez M, Aracil B, Oteo J, Cercenado
E. Antibiotic resistance and clinical significance of Haemophilus
influenzae type f. J Antimicrob Chemother. 2003;52:961–6. DOI:
10.1093/jac/dkh004
Campos J, Roman F, Perez-Vazquez M, Oteo J, Aracil B, Cercenado E. Infections due to Haemophilus influenzae serotype e: microbiological, clinical, and epidemiological features. Clin Infect Dis.
2003;37:841–5. DOI: 10.1086/377232
Fickweiler K, Borte M, Fasshauer M, Spencker FB, Handrick W,
Rodloff AC. Meningitis due to Haemophilus influenzae type f in an
8-year-old girl with congenital humoral immunodeficiency. Infection. 2004;32:112–5. DOI: 10.1007/s15010-004-3040-1
Millar EV, O’Brien KL, Watt JP, Lingappa J, Pallipamu R, Rosenstein
N, et al. Epidemiology of invasive Haemophilus influenzae type a
disease among Navajo and White Mountain Apache children, 1988–
2003. Clin Infect Dis. 2005;40:823–30. DOI: 10.1086/428047
Bruce MG, Deeks SL, Zulz T, Navarro C, Palacios C, Case C, et al.
Epidemiology of Haemophilus influenzae serotype a, North American Arctic, 2000–2005. Emerg Infect Dis. 2008;14:48–55. DOI:
10.3201/eid1401.070822
Scheifele D, Halperin S, Law B, King A, Halperin S, Morris R,
et al. Invasive Haemophilus influenzae type b infections in vaccinated and unvaccinated children in Canada, 2001–2003. CMAJ.
2005;172:53–6. DOI: 10.1503/cmaj.1031861
Millar EV, O’Brien KL, Levine OS, Kvamme S, Reid R, Santosham
M. Toward elimination of Haemophilus influenzae type b carriage
and disease among high-risk American Indian children. Am J Public
Health. 2000;90:1550–4. DOI: 10.2105/AJPH.90.10.1550
Follens A, Veiga-da-Cunha M, Merckx R. van SE, Van EJ. acs1 of
Haemophilus influenzae type a capsulation locus region II encodes a
bifunctional ribulose 5-phosphate reductase- CDP-ribitol pyrophosphorylase. J Bacteriol. 1999;181:2001–7.
Anderson EC, Begg NT, Crawshaw SC, Hargreaves RM, Howard AJ, Slack MP. Epidemiology of invasive Haemophilus influenzae infections in England and Wales in the pre-vaccination era
(1990–2). Epidemiol Infect. 1995;115:89–100. DOI: 10.1017/
S0950268800058155
Address for correspondence: Shamez Ladhani, Immunisation Department,
Centre for Infections, Health Protection Agency, 61 Colindale Avenue,
London NW9 5EQ, UK; email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
463
RESEARCH
Vaccine Preventability of
Meningococcal Clone, Greater
Aachen Region, Germany
Johannes Elias, Leo M. Schouls, Ingrid van de Pol, Wendy C. Keijzers, Diana R. Martin,
Anne Glennie, Philipp Oster, Matthias Frosch, Ulrich Vogel,1 and Arie van der Ende1
Emergence of serogroup B meningococci of clonal complex sequence type (ST) 41/44 can cause high levels of disease, as exemplified by a recent epidemic in New Zealand.
Multiplication of annual incidence rates (3.1 cases/100,000
population) of meningococcal disease in a defined German region, the city of Aachen and 3 neighboring countries
(Greater Aachen) prompted us to investigate and determine
the source and nature of this outbreak. Using molecular
typing and geographic mapping, we analyzed 1,143 strains
belonging to ST41/44 complex, isolated from persons with
invasive meningococcal disease over 6 years (2001–2006)
from 2 German federal states (total population 26 million)
and the Netherlands. A spatially slowly moving clone with
multiple-locus variable-number tandem repeat analysis
type 19, ST42, and antigenic profile B:P1.7–2,4:F1–5 was
responsible for the outbreak. Bactericidal activity in serum
samples from the New Zealand MeNZB vaccination campaign confirmed vaccine preventability. Because this globally distributed epidemic strain spreads slowly, vaccination
efforts could possibly eliminate meningococcal disease in
this area.
O
ur work describes the epidemiology of invasive
meningococcal disease (IMD) caused by meningococci of clonal complex (cc) 41/44 in the Netherlands and
the 2 bordering German states Lower Saxony and NorthRhine-Westphalia during 2001–2006. Neisseria meningitis
Author affiliations: University of Wuerzburg, Wuerzburg, Germany
(J. Elias, M. Frosch, U. Vogel); National Institute for Public Health
and Environment (RIVN), Bilthoven, the Netherlands (L.M. Schouls,
I. van de Pol); Academic Medical Center, Amsterdam, the Netherlands (W.C. Keijzers, A. van der Ende); Institute of Environmental Science and Research, Porirua, New Zealand (D.R. Martin, A.
Glennie); and Novartis Vaccines, Siena, Italy (P. Oster)
DOI: 10.3201/eid1603.091102
464
is a gram-negative bacterium that occasionally causes invasive disease in humans, primarily meningitis or sepsis (1).
Notwithstanding low incidence rates in most industrialized
countries, IMD remains a serious public health problem because of its predilection for affecting young persons and its
≈10% death rate despite antimicrobial drug treatment. In
contrast to the meningitis belt in Africa, where epidemic
waves cause incidence rates up to 300 cases/100,000 population (2), epidemics or case clusters are rare in industrialized countries (3). Meningococci are antigenically diverse
bacteria that can be divided into 12 serogroups by variation of their polysaccharide capsules. Despite increased
findings of serogroup C meningococci in several countries,
serogroup B has clearly controlled the epidemiology of
IMD in western Europe for the past 20 years. Dominance
of serogroup B has further been compounded by numerous
vaccination campaigns with polysaccharide C conjugate
vaccine leading to a decline in serogroup C disease (4). Unfortunately, the serogroup B polysaccharide is an unsuitable vaccine antigen because of poor immunogenicity. Despite substantial progress in the development of vaccines
based on membrane-associated antigens (5,6), a universal
vaccine against meningococci has yet to be licensed.
Typing of N. meningitidis is critical for tracking transmissions and recognition of disease clusters. In recent
years, focus has shifted to portable molecular typing methods with high discriminatory power. The preferred method
for sequence-based typing of meningococci is multilocus
sequence typing (MLST) (7), which enables identification
of strains belonging to hypervirulent clonal complexes responsible for most cases of the invasive disease (8). MLST
is complemented by antigen sequence typing of the variable
regions of the outer membrane proteins PorA and FetA (9).
Moreover, multiple-locus variable-number tandem repeat
1
These authors contributed equally to this article.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Meningococcal Outbreak, Greater Aachen Region, Germany
analysis (MLVA), which shows slightly higher discriminatory ability than MLST (10), represents a recent addition to
the arsenal of portable typing methods for N. meningitidis.
Differences in the antigenic makeup of meningococcal
clonal complexes (cc) (11) likely influence reported disparities in spatiotemporal spread. Whereas strains belonging to the multilocus sequence type (ST) 5 complex (cc5/
subgroup III) (12) and ST11 complex (cc11/ET-37 complex) (13) depend on migration to survive, strains of the
ST41/44 complex (cc41/44/lineage 3) have been described
as causing stationary and persistent hyperendemic disease,
as exemplified by the New Zealand serogroup B epidemic,
which lasted more than a decade (14).
cc41/44 is a large hypervirulent complex that revolves
around 2 STs instead of 1 central ST, namely ST41 and
ST44 (15). It was first described in the Netherlands in the
1980s (16), where it caused a substantial increase in disease
incidence (17,18). Subsequently, this lineage was reported
in Belgium in the early 1990s (19), then New Zealand since
1991 (14). In New Zealand an epidemic with incidences up
to 17.4 cases/100,000 population in 2001 prompted an immunization campaign with custom made outer-membranevesicle vaccine MeNZB (Novartis Vaccines and Diagnostics, Siena, Italy) (20).
By using cluster detection software SaTScan (www.
satscan.org) (21) for laboratory surveillance of IMD at
the German Reference Center for Meningococci (22), we
showed spatial concentrations of meningococci with antigen sequence type B:P1.7–2.4:F1–5 (serogroup B, PorA
VR1 7–2, PorA VR2 4, and FetA VR 1–5), strongly associated with cc41/44 (11), around the German city of Aachen
near its border with the Netherlands. The annual incidence
rate rose to 3.1/100,000 in 2005 among a population of
1.1 million living in Aachen and 3 neighboring counties
(Greater Aachen; Figure 1).
We mapped the epidemiology of IMD caused by
cc41/44 meningococci in the Netherlands and 2 neighboring
German states, Lower Saxony and North-Rhine-Westphalia,
during 2001–2006. Furthermore, we characterized the clone
responsible for the upsurge of IMD in Greater Aachen.
Materials and Methods
Bacterial Strains
All N. meningitidis strains analyzed in this study were
isolated from patients with IMD. One isolate was included
for each patient. During 2001–2006, a total of 239 strains
collected by NRZM and 904 isolates collected by the Neth-
Figure 1. Distribution of cc41/44 Neisseria meningitidis strains in Germany and the Netherlands during 2001–2006 with positively
associated multiple-locus variable-number tandem repeat analysis (MLVA) and multilocus sequence types (MLST). A) Distribution of MLVA
type (MT) 19/MLST (ST) 42 strains (red triangles). Full green circles represent non–MT19/ST42 strains. Black rectangle delineates the
area magnified in panel B. B) Area encompassing Limburg (orange shading) and Greater Aachen (blue shading). C–E) Spatial distribution
of other overrepresented MT/ST variants: MT27/ST40 (blue triangles); MT30/ST40 (orange triangles); MT78/ST1374 (purple triangles).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
465
RESEARCH
0.30
Germany
The Netherlands
0.25
Proportion of MT19/ST42
erlands Reference Laboratory for Bacterial Meningitis,
Academic Medical Center, Amsterdam, North Holland, the
Netherlands) were included in the study. Only strains of
serogroup B with positive amplification of cc41/44-specific
restriction-modification system Neisseria meningitis (Nme)
SI (17) and subsequent confirmation of cc41/44 by MLST
were included. In addition, 51 serogroup B, NmeSI–positive strains obtained from the Netherlands in 1985 were
analyzed as a historic reference. NZ98/254 is the meningococcal strain used to make MeNZB (Novartis Vaccines and
Diagnostics) (20).
0.20
0.15
0.10
Typing of Meningococci
MLST (7) and antigen sequence typing of PorA (23)
and FetA (24) were performed according to published protocols. MLVA targeting 8 loci was performed according to
the method described by Schouls et al. (10). However, nomenclature of repeat profiles has been changed since their
original description; current MLVA types (MTs) and conversion tables are available from www.mlva.net. Unique
combinations of serogroup, PorA variable region 1 (VR1),
PorA variable region 2 (VR2), and variable region of FetA
(FetA VR) were termed fine types. Simpson diversity indices (DIs) of the above typing schemes used alone or in
combination were calculated as outlined by Hunter and
Gaston (25). Ninety-five percent confidence intervals (CIs)
of DI were determined by using the percentile bootstrap
method after 1,000 replicates implemented in the package
boot, written by A. Canty and B. Ripley for R (R Foundation for Statistical Computing, Vienna, Austria), version
2.8.0 (www.r-project.org).
Spatiotemporal Data
Geographic coordinates (map datum World Geodetic
System [WGS] 84) were derived from German and Dutch
postal codes. Yearwise categorization of data was based on
the dates of sampling or dates of entry if sampling information was not available. Maps (Figure 1) were generated
by using Regiograph 8 (GfK GeoMarketing GmbH, Bruchsal, Germany). Yearwise spatial densities of MT19/ST42
strains in the study area (Figure 2) were calculated by using
Spatstat, version 1.15–1, created by A. Baddeley and R.
Turner for the statistical environment R.
Statistical Analyses
Covariation among MTs and STs was assessed by using the Jaccard similarity coefficient (J), as described by
Rhee et al. (26), with slight modifications. Briefly, for any
combination of MT and ST, the J coefficient is the ratio between the number of strains belonging to the combination
in question divided by the number of strains sharing either
MT or ST. It is calculated as J = NVS/(NVS + NV0 + N0S),
where NVS represents the number of strains with a certain
466
0.05
0.00
2001
2002
2003
2004
2005
2006
Figure 2. Temporal progression of the proportion of MT19/ST42
meningococcal strains in the Netherlands and the German study
region (North-Rhine-Westphalia and Lower Saxony), 2001–2006.
MT and ST, NV0 is the number of strains with the same MT
but another ST, and N0S is the number of strains with the
same ST but another MT. Observed J and expected Jaccard
coefficients (JEXP) were compared for each combination, assuming random coupling of types. JEXP was calculated as
the mean J coefficient after 2,000 random rearrangements
of the MT and ST vector (consisting of Boolean values indicating presence or absence of types). p values testing the
equality of J and JEXP for any combination of MT and ST
were derived by using an inverse quantile function based
on the distribution of 105 bootstrap replicates. We used
the Holm method to control the familywise error rate for
multiple hypothesis testing (27). The Pearson χ2 test was
calculated with R.
Serum Bactericidal Assay
German strain DE9686 (B:P1.7–2,4:F1–5:ST42:
MT19) isolated in 2004 from a patient of IMD in Aachen
was used as the target strain in a validated serum bactericidal assay (28). Because the serum complement source
used in the New Zealand trials contained interfering antibodies against strain DE9686, an alternative serum complement source for strain DE9686 was found from a range of
adult volunteers. Prevaccination and postvaccination serum
samples from 20 persons, 18 months–12 years of age, who
had been vaccinated with 3 doses of MeNZB vaccine (Novartis Vaccines and Diagnostics) during the New Zealand
trials, were tested against the German target strain, DE9686
by using the new serum complement source. Interpolated
titer values were measured by using a formula that calculates the level of antibodies on the basis of percentage kill
immediately on either side of the 50% cutoff (28).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Meningococcal Outbreak, Greater Aachen Region, Germany
Results
Performance of Typing Methods
All 1,143 strains were tested by MLVA, MLST, and
antigen sequence typing. Fine typing, i.e., serogroup, PorA
VR1, PorA VR2, and FetA VR type showed 195 unique
types, which translates to a low DI of 0.752 (95% CI
0.726–0.778). MLVA and MLST distinguished 232 (DI
0.942, 95% CI 0.933–0.948) and 222 (DI 0.893, 95% CI
0.879–0.905) types, respectively, confirming the higher
discriminatory ability of MLVA when compared with
MLST. Both neutral typing methods (MLST and MLVA)
provided higher discrimination than antigen sequence typing. Finally, combination of MLVA and MLST yielded 504
unique MLVA-MLST (MT-ST) types, demonstrating the
extremely fine-grained resolution (Simpson’s index 0.985,
95% CI 0.981–0.987) attained for the binational collection
of cc41/44 N. meningitidis strains.
Covariation and Spatial Pattern of MLVA-MLST
Combinations
Covariation was computed for MTs and STs that were
identified at least 10 times. The average J coefficient for
observed combinations was low (0.06), suggesting a limited overlap between MLVA and MLST. After controlling
the familywise error rate at <0.01, four MT-ST combinations showed marked positive association, indicating recent
clonal expansion: MT19/ST42, MT27/ST40, MT30/ST40,
and MT78/ST1374. In contrast, 3 combinations occurred
significantly less frequently than expected: MT27/ST41,
MT30/ST41, and MT78/ST41 (Table 1). Geographic coordinates were available for 1,102 (96.4%) of 1,143 strains.
Two of the positively linked MT-ST combinations showed
evidence for clustering: MT78/ST1374 around the Dutch
city of Den Haag and, more explicitly, MT19/ST42 in
Greater Aachen (Figure 1, panels A and B).
Clustering of MT19/ST42 Meningococci
Strains with MT19/ST42 occurred almost exclusively on the German side of Greater Aachen: of 50 German
MT19/ST42 strains, only 8 were isolated from outside this
region, all but 1 occurred within 100 km of Aachen (Figure 1, panel B, p<2.2 × 10–16, χ2 test). A similar, albeit less
marked concentration, was observed for the Netherlands
regarding the province of Limburg: 15 of 37 MT19/ST42
(40.1%) strains with corresponding regional data originated
from this province, compared with 97 (11.7%) of 826 other
cc41/44 isolates (p = 1.2 × 10–6, χ2 test). From a total of
91 MT19/ST42 strains, 81 (89.0%) were B:P1.7–2.4:F1–5.
In contrast to the 41 Dutch MT19/ST42 isolates, which
displayed 7 different fine types with 76% dominance of
B:P1.7–2.4:F1–5, all 50 German MT19/ST42 isolates were
B:P1.7–2,4:F1–5. Mean annual incidence rates of MT19/
ST42 per 100,000 population in the Netherlands, the German states Lower Saxony and North-Rhine Westpahlia (including Greater Aachen), and Greater Aachen were 0.04,
0.03, and 0.63, respectively. In conclusion, most of type
MT19/ST42 strains were isolated from Germany (50/91
strains), where they displayed a higher degree of clustering
and antigenic uniformity.
Temporal Trends and Migration of the Outbreak Strain
The total number of cc41/44 isolates declined from
257 in 2001 to 137 in 2006. The proportion of MT19/
ST42 strains was higher in the German region in every year
from 2001 to 2006 and peaked at 0.27 in 2004 (Figure 2.
This clone was the most common MT-ST combination in
the German region during 2001–2006, as opposed to the
Netherlands, where the most numerous combinations per
year were MT19/ST41 (2001), MT19/ST42 (2002), MT19/
ST41 (2003), MT18/ST41 (2004), MT18/ST41 (2005),
and MT19/ST41 together with MT18/ST41 (2006). Furthermore, the proportion of MT19/ST42 in the German
area never fell below 0.15, whereas in the Netherlands it
decreased to 0.01 in 2006 (Figure 3) because of slow eastward migration from the Dutch province of Limburg toward Greater Aachen (Figure 3). A historic sample from
the Netherlands from 1985 yielded 1 MT19/ST42 strain out
of 51 (proportion 1.96%, 95% CI 0.00–11.79), indicating
either reoccurrence of this type over >2 decades or independent reassociation of alleles.
Table 1. Positively and negatively correlating MLVA-MLST pairs, Neisseria meningitis clone, Greater Aachen Region, Germany, 2001–
2006*
Association
MT
ST
N
NEXP
N (MT)
N (ST)
J
JEXP
p value†
Positive
19
42
91
38
209
209
0.2783
0.1013
0
30
40
19
3
38
82
0.1881
0.0235
0
78
1374
25
2
54
39
0.3676
0.0199
0
27
40
18
4
59
82
0.1452
0.032
0.00002
Negative
27
41
3
16
60
292
0.0086
0.0462
0
30
42
1
7
38
209
0.0041
0.0287
0
78
41
4
14
54
292
0.0117
0.0416
0.00004
*MLVA, multilocus variable tandem repeat analysis; MLST, multilocus sequence type; MT, MLVA type; ST, multilocus-sequence type, N, no. strains with
MT and ST; NEXP, expected number of strains with MT and ST; N (MT), no.strains with MT; N (ST), no. strains with ST; J, Jaccard index; JEXP, expected
Jaccard index
†2-tailed.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
467
RESEARCH
Age Distribution of Case-Patients
Age information was available for 1,140 of 1,143
(99.7%) case-patients. IMD caused by MT19/ST42 occurred more commonly among patients >10 years of age
(p = 4.2× 10–4, χ2 test). A plot of the age distribution of
cases due to meningococci of cc41/44 illustrates a bimodal
pattern considered typical for IMD (Figure 4). Nevertheless, cases caused by clone MT19/ST42 disproportionately
affected adolescents, with no difference between the Netherlands and Germany (p = 0.90, χ2). This positive shift is
consistent with an epidemic age pattern described in the
1970s during an epidemic wave of meningococcal disease
in Finland (29) and during the 1980s in the Netherlands
(30).
Serum Bactericidal Antibody Responses
against DE9686
Typing methods (MLVA, MLST, “fine typing”) could
not distinguish NZ98/254 from DE9686 (B:P1.7–2.4:F1–
5:ST42:MT19). Serum bactericidal antibody responses
of persons vaccinated with MeNZB suggested protective
levels (i.e., >8) in all serum samples. These samples were
tested in a serum bactericidal assay with DE9686 as a target
strain. The test determines the maximal dilution at which
killing activity of tested serum can be observed (Table 2).
A 4-fold rise in titer was observed in the postvaccination
sample for all (10/10) toddlers (18–24 months of age) and
8 of 10 schoolchildren (8–12 years of age). Only titers in
2 persons with the highest prevaccination titers (189 and
229) rose <4-fold after vaccination with MeNZB (Novartis
Vaccines and Diagnostics).
Discussion
Our main goals were to identify the clone causing
the rise in incidence rate in Greater Aachen and to elucidate whether increased disease activity in Germany represented local emergence or cross-border spread from the
Netherlands, which had experienced a steep rise in IMD
caused by cc41/44 since 1980 (18). Tracking of variants
within cc41/44 necessitated a high level of discrimination,
achieved by the combination of typing methods MLVA
and MLST (DI 0.985). Geographic mapping showed it was
only the latter pairing of techniques that sharply delineated
a spatial accumulation of MT19/ST42 meningococci in the
region that had seen increase of disease rate (Figure 1).
The spread of the outbreak clone differed upon introducFigure 3. Yearwise spatial
distribution of MT19/ST42
strains within the study
region in Germany during
2001–2006. Color-coded
values represent estimates
of the intensity function
underlying the point pattern
data. Gray circle marks the
city of Aachen; the white
line represents the border
between the Netherlands
and Germany.
468
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Meningococcal Outbreak, Greater Aachen Region, Germany
computed the degrees of overlap (represented by J coefficients) of observed combinations between MTs and STs.
The mean overlap was low (0.06), and the number of most
combinations did not differ significantly from the expected,
suggesting random association in most types and highlighting the complementary nature of MLST and MLVA for
cc41/44. The added value of combining these typing methods is also reflected in the significantly higher DI attained.
Positively associated combinations could reflect linkage
disequilibrium in concordance with an epidemic population
concept (37), which attributes disequilibrium to transient
multiplication of successful variants doomed to dissipate
within years, secondary to recombination. Nevertheless,
recovery of MT19/ST42 over >20 years favors concepts
that accommodate the observed excessive stability, e.g.,
proposed in models including interstrain competition (36).
On the other hand, strains with a negative association might
indicate low epidemic potential. All sequence types recovered from covariation analysis (ST40, ST42, and ST41,
ST1374) represent (sub)group founders within cc41/44, attributed higher transmissibility and fitness due to persistent
recovery in both carrier and invasive collections (36). Although observed presence of founder STs could be due to
biased selection of STs for covariation analysis (only types
occurring at least 10 times were included), the clear underrepresentation of some MTs belonging to mentioned STs
suggests that at least virulence within these founder STs is
not equally distributed (Table 1).
The following observations support the hypothesis
that meningococci of the clone MT19/ST42 command
exceptional epidemic potential: dramatic spatial concentration displayed in Greater Aachen, concurrent rise of
MT19/ST42 (n = 90)
Other MT/ST (n = 1,050)
0.08
0.06
Density
tion into Germany, where it caused high levels of disease
in a confined area. The distinct level and high spread of
disease may suggest the presence of regionally specific,
as yet unknown, factors contributing to its emergence.
Because behavior-related risk factors promote acquisition
of IMD in adolescents (31), locally differing traditions in
Germany, possibly related to carnival festivities in seasons with high incidence (32), may have contributed to the
outbreak. Nevertheless, clustering was also present, albeit
less abundantly, in the Dutch province of Limburg. Higher
antigenic diversity and discrete eastward motion indicate
the clone’s longer history in the Netherlands, where it had
failed to cause an epidemic, possibly due to population immunity elicited by long-lasting exposure to related variants
of cc41/44 since the 1980s.
Although clusters of cases tend to be short-lived in
industrialized countries (33), the geographic concentration of the outbreak clone was observed during the whole
study period (Figure 3). This spatial stability might be
promoted by the clone’s more efficient evasion of induction of mucosal immunity. Notably, antigenic variation of the outbreak clone was limited and dominated
by B:P1.7–2.4:F1–5 (89%). Lower antibody avidity observed after vaccination with OMVs containing P1.7–2.4
(34) suggests that this PorA-type evokes a less potent immune response, possibly leading to decreased protection
against acquisition of carriage. Studies confirming this
hypothesis, however, have not been published. Moreover,
the higher diversity unveiled by neutral typing techniques
compared with antigen sequence typing could suggest
positive selection for strains achieving immune escape
because of their antigenic profile.
There was a significant shift toward older age of patients infected by MT19/ST42 meningococci, consistent
with observations before and during epidemics (29,30). A
recent report demonstrates an overrepresentation of meningococci harboring the meningococcal disease associated island among young adults with IMD, possibly indicating its
contribution to invasive disease in this age group (35). Frequent isolation of presumably more virulent meningococci,
such as MT19/ST42, from adolescents might be explained
by the hypotheses that 1) fewer virulence determinants are
required to cause invasion in infants, hence strains of lower
invasiveness are recovered in higher proportions among
them, and 2) invasiveness represents a smaller penalty for
highly transmissible strains in persons with abundant social contacts (36), leading to their preferential circulation
among older age groups.
In an analysis of meningococci across several clonal
complexes, Schouls et al. obtained similar groupings by
MLVA and MLST (10). To identify type pairs deviating
from their expected occurrence within strains of this study,
which pertained to a single clonal complex (cc41/44), we
0.04
0.02
0.00
0
20
40
60
80
Age, y
Figure 4. Kernel density plots of age distribution of MT19/ST42
case-patients compared with the rest of the ST41/44 complex. The
vertical gray line indicates 10 years.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
469
RESEARCH
Table 2. Serum bactericidal antibody titers before and after
vaccination with MeNZB against German strain DE9686, Greater
Aachen Region, Germany, 2001–2006*
No.
Age group vaccinees Before
After 4-fold rise >8 post
8–12 y
1
12
1,727
ĸ
ĸ
2
3
104
ĸ
ĸ
3
189
406
–
ĸ
4
50
296
ĸ
ĸ
5
229
729
–
ĸ
6
23
175
ĸ
ĸ
7
9
84
ĸ
ĸ
8
2
213
ĸ
ĸ
9
2
77
ĸ
ĸ
10
2
55
ĸ
ĸ
11
2
214
ĸ
ĸ
18–24 mo
12
4
45
ĸ
ĸ
13
2
109
ĸ
ĸ
14
7
92
ĸ
ĸ
15
2
306
ĸ
ĸ
16
6
431
ĸ
ĸ
17
2
216
ĸ
ĸ
18
3
44
ĸ
ĸ
19
3
218
ĸ
ĸ
20
2
171
ĸ
ĸ
*– represents cases where conditions 4-fold rise and >8 post are false.
Arrows represent cases where conditions 4-fold rise and >8 post are true.
incidence in the area of clustering, and age-shift to older
patients. Tendency to affect older persons has also been
noted during epidemics (29,30) and in strains carrying a
temperate bacteriophage associated with higher pathogenic
potential (35). In addition, vaccine strain NZ98/254, which
was used for generation of New Zealand’s MeNZB (Novartis
Vaccines and Diagnostics) (38), was not distinguishable
from German MT19/ST42 strains, demonstrating the
clone´s emergence on separate continents.
By using paired serum samples from vaccinated toddlers and schoolchildren (Table 2), we were able to show a
striking similarity between the serum bactericidal antibody
responses induced by the German epidemic strain and results obtained in New Zealand against NZ98/254 after vaccination of toddlers and 8–12 years of age (39,40). Similar
to the New Zealand situation, a protective vaccine effect
was strongly supported by the serum bactericidal antibody
responses induced by the German strain. Moreover, because the VR2 epitope of PorA is the major target for immune response elicited by MenZB (38), protection against
most of the analyzed cc41/44 strains (58% have VR2 type
4) can be assumed.
Although the marked concentration of meningococci
with fine type B:P1.7–2.4:F1–5 continues to exist in western
North-Rhine-Westphalia (www.episcangis.org), incidence
rates have been decreasing since 2005; this decrease has
suspended plans to implement a vaccine campaign. Nevertheless, the New Zealand experience (14) suggests that this
clone may attain high-level endemicity, and continued close
470
surveillance remains a task of high priority. Should regional
incidences rise again, implementation of an immunization
campaign with MeNZB should be considered.
Although we studied a large area involving 2 bordering countries, our study is limited. We did not include isolates from asymptomatic carriers because of the logistic
difficulties related to the collection of representative carriage samples that preceded or temporally coincided with
outbreaks. Furthermore, the sampling period only covered
6 years with 1 historic reference year because of the large
number of strains. Finally, representative population immunity data were not available. Our study does, however,
pave the ground for future epidemiologic and experimental
work aimed at confirming the distinct pathogenic potential
of MT19/ST42 meningococci and unraveling the circumstances leading to their spatially distinct occurrence.
We tracked an outbreak clone that was causing considerable disease activity on the border of 2 industrialized
European countries by using highly discriminatory and
portable typing techniques. These techniques could guide
and improve the targeting of public health efforts, which
may include vaccination, if incidence rates in North-RhineWestphalia begin to rise again.
M.F. and A.v.d.E. participate in the Sixth Framework Programme of the European Commission, Proposal/Contract no.
512061 (Network of Excellence European Virtual Institute for
Functional Genomics of Bacterial Pathogens; www.noe-epg.uniwuerzburg.de).
The project was funded in part by a grant of the Robert KochInstitute ref. 3/6400/2008 to J.E., M.F., and U.V
Dr Elias is a specialist in medical microbiology, virology,
and infection epidemiology at the Institute for Hygiene and Microbiology at the University of Würzburg. His research interests
include typing of bacterial pathogens and laboratory surveillance
of infectious diseases.
References
1.
2.
3.
4.
Rosenstein NE, Perkins BA, Stephens DS, Popovic T, Hughes JM.
Meningococcal disease. N Engl J Med. 2001;344:1378–88. DOI:
10.1056/NEJM200105033441807
Campagne G, Schuchat A, Djibo S, Ousséini A, Cissé L, Chippaux
JP. Epidemiology of bacterial meningitis in Niamey, Niger, 1981–
96. Bull World Health Organ. 1999;77:499–508.
Brooks R, Woods CW, Benjamin DK, Rosenstein NE. Increased
case-fatality rate associated with outbreaks of Neisseria meningitidis infection, compared with sporadic meningococcal disease, in the
United States, 1994–2002. Clin Infect Dis. 2006;43:49–54. DOI:
10.1086/504804
Trotter CL, Ramsay ME. Vaccination against meningococcal disease
in Europe: review and recommendations for the use of conjugate
vaccines. FEMS Microbiol Rev. 2007;31:101–7. DOI: 10.1111/
j.1574-6976.2006.00053.x
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Meningococcal Outbreak, Greater Aachen Region, Germany
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Giuliani MM, Adu-Bobie J, Comanducci M, Aricò B, Savino S,
Santini L, et al. A universal vaccine for serogroup B meningococcus. Proc Natl Acad Sci U S A. 2006;103:10834–9. DOI: 10.1073/
pnas.0603940103
Pillai S, Howell A, Alexander K, Bentley BE, Jiang H, Ambrose
K, et al. Outer membrane protein (OMP) based vaccine for Neisseria meningitidis serogroup B. Vaccine. 2005;23:2206–9. DOI:
10.1016/j.vaccine.2005.01.056
Maiden MC, Bygraves JA, Feil E, Morelli G, Russell JE, Urwin R,
et al. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci U S A. 1998;95:3140–5. DOI: 10.1073/
pnas.95.6.3140
Yazdankhah SP, Kriz P, Tzanakaki G, Kremastinou J, Kalmusova J,
Musilek M, et al. Distribution of serogroups and genotypes among
disease-associated and carried isolates of Neisseria meningitidis
from the Czech Republic, Greece, and Norway. J Clin Microbiol.
2004;42:5146–53. DOI: 10.1128/JCM.42.11.5146-5153.2004
Jolley KA, Brehony C, Maiden MC. Molecular typing of meningococci: recommendations for target choice and nomenclature.
FEMS Microbiol Rev. 2007;31:89–96. DOI: 10.1111/j.1574-6976
.2006.00057.x
Schouls LM, van der Ende A, Damen M, van de Pol I. Multiplelocus variable-number tandem repeat analysis of Neisseria meningitidis yields groupings similar to those obtained by multilocus
sequence typing. J Clin Microbiol. 2006;44:1509–18. DOI: 10.1128/
JCM.44.4.1509-1518.2006
Urwin R, Russell JE, Thompson EAL, Holmes EC, Feavers IM,
Maiden MCJ. Distribution of surface protein variants among hyperinvasive meningococci: implications for vaccine design. Infect Immun. 2004;72:5955–62. DOI: 10.1128/IAI.72.10.5955-5962.2004
Zhu P, van der Ende A, Falush D, Brieske N, Morelli G, Linz B, et
al. Fit genotypes and escape variants of subgroup III Neisseria meningitidis during three pandemics of epidemic meningitis. Proc Natl
Acad Sci U S A. 2001;98:5234–9. DOI: 10.1073/pnas.061386098
Jelfs J, Munro R, Ashton FE, Caugant DA. Genetic characterization
of a new variant within the ET-37 complex of Neisseria meningitidis
associated with outbreaks in various parts of the world. Epidemiol
Infect. 2000;125:285–98. DOI: 10.1017/S0950268899004471
Martin DR, Walker SJ, Baker MG, Lennon DR. New Zealand epidemic of meningococcal disease identified by a strain with phenotype
B:4:P1.4. J Infect Dis. 1998;177:497–500. DOI: 10.1086/517385
Brehony C, Jolley KA, Maiden MC. Multilocus sequence typing
for global surveillance of meningococcal disease. FEMS Microbiol
Rev. 2007;31:15–26. DOI: 10.1111/j.1574-6976.2006.00056.x
Caugant DA, Bol P, Høiby EA, Zanen HC, Frøholm LO. Clones of
serogroup B Neisseria meningitidis causing systemic disease in the
Netherlands, 1958–1986. J Infect Dis. 1990;162:867–74.
Bart A, Dankert J, van der Ende A. Representational difference
analysis of Neisseria meningitidis identifies sequences that are specific for the hyper-virulent lineage III clone. FEMS Microbiol Lett.
2000;188:111–4. DOI: 10.1111/j.1574-6968.2000.tb09179.x
Scholten RJ, Poolman JT, Valkenburg HA, Bijlmer HA, Dankert
J, Caugant DA. Phenotypic and genotypic changes in a new clone
complex of Neisseria meningitidis causing disease in the Netherlands, 1958–1990. J Infect Dis. 1994;169:673–6.
van Looveren M, Vandamme P, Hauchecorne M, Wijdooghe M, Carion F, Caugant DA, et al. Molecular epidemiology of recent Belgian
isolates of Neisseria meningitidis serogroup B. J Clin Microbiol.
1998;36:2828–34.
Oster P, Lennon D, O’Hallahan J, Mulholland K, Reid S, Martin
D. MeNZB: a safe and highly immunogenic tailor-made vaccine
against the New Zealand Neisseria meningitidis serogroup B disease epidemic strain. Vaccine. 2005;23:2191–6. DOI: 10.1016/j.
vaccine.2005.01.063
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
Kulldorff M. A spatial scan statistic. Comm Statist Theory Methods.
1997;26:1481–96. DOI: 10.1080/03610929708831995
Elias J, Harmsen D, Claus H, Hellenbrand W, Frosch M, Vogel U.
Spatiotemporal analysis of invasive meningococcal disease, Germany. Emerg Infect Dis. 2006;12:1689–95.
Russell JE, Jolley KA, Feavers IM, Maiden MCJ, Suker J. PorA
variable regions of Neisseria meningitidis. Emerg Infect Dis.
2004;10:674–8.
Thompson EAL, Feavers IM, Maiden MCJ. Antigenic diversity of
meningococcal enterobactin receptor FetA, a vaccine component.
Microbiology (Reading, Engl.). 2003;149:1849–58
Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity.
J Clin Microbiol. 1988;26:2465–6.
Rhee SY, Liu TF, Holmes SP, Shafer RW. HIV-1 subtype B protease
and reverse transcriptase amino acid covariation. PLOS Comput
Biol. 2007;3:e87. DOI: 10.1371/journal.pcbi.0030087
Holm S. A simple sequentially rejective test procedure. Scand J Stat.
1979;6:65–70.
Martin D, McCallum L, Glennie A, Ruijne N, Blatchford P,
O’Hallahan J, et al. Validation of the serum bactericidal assay for
measurement of functional antibodies against group B meningococci associated with vaccine trials. Vaccine. 2005;23:2218–21. DOI:
10.1016/j.vaccine.2005.01.070
Peltola H, Kataja JM, Mäkelä PH. Shift in the age-distribution
of meningococcal disease as predictor of an epidemic? Lancet.
1982;2:595–7. DOI: 10.1016/S0140-6736(82)90669-9
Scholten RJ, Bijlmer HA, Poolman JT, Kuipers B, Caugant DA, Van
Alphen L, et al. Meningococcal disease in the Netherlands, 1958–
1990: a steady increase in the incidence since 1982 partially caused
by new serotypes and subtypes of Neisseria meningitidis. Clin Infect
Dis. 1993;16:237–46.
Tully J, Viner RM, Coen PG, Stuart JM, Zambon M, Peckham C, et
al. Risk and protective factors for meningococcal disease in adolescents: matched cohort study. BMJ. 2006;332:445–50. DOI: 10.1136/
bmj.38725.728472.BE
Hauri AM, Ehrhard I, Frank U, Ammer J, Fell G, Hamouda O, et al.
Serogroup C meningococcal disease outbreak associated with discotheque attendance during carnival. Epidemiol Infect. 2000;124:69–
73. DOI: 10.1017/S0950268899003416
Olivares R, Hubert B. Clusters of meningococcal disease in France
(1987–1988). Eur J Epidemiol. 1992;8:737–42. DOI: 10.1007/
BF00145393
Vermont CL, Van Dijken HH, De Groot R, Van Alphen L, Van Den
Dobbelsteen GPJM. PorA-specific differences in antibody avidity
after vaccination with a hexavalent Men B outer membrane vesicle
vaccine in toddlers and school children. Vaccine. 2004;22:3008–13.
DOI: 10.1016/j.vaccine.2004.02.014
Bille E, Ure R, Gray SJ, Kaczmarski EB, McCarthy ND, Nassif X,
et al. Association of a bacteriophage with meningococcal disease
in young adults. PLoS One. 2008;3:e3885. DOI: 10.1371/journal.
pone.0003885
Buckee CO, Jolley KA, Recker M, Penman B, Kriz P, Gupta S, et
al. Role of selection in the emergence of lineages and the evolution
of virulence in Neisseria meningitidis. Proc Natl Acad Sci U S A.
2008;105:15082–7. DOI: 10.1073/pnas.0712019105
Smith JM, Smith NH, O’Rourke M, Spratt BG. How clonal are bacteria? Proc Natl Acad Sci U S A. 1993;90:4384–8. DOI: 10.1073/
pnas.90.10.4384
Martin DR, Ruijne N, McCallum L, O’Hallahan J, Oster P. The VR2
epitope on the PorA P1.7–2,4 protein is the major target for the immune response elicited by the strain-specific group B meningococcal vaccine MeNZB. Clin Vaccine Immunol. 2006;13:486–91. DOI:
10.1128/CVI.13.4.486-491.2006
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
471
RESEARCH
39.
Hosking J, Rasanathan K, Mow FC, Jackson C, Martin D,
O’Hallahan J, et al. Immunogenicity, reactogenicity, and safety of
a P1.7b,4 strain-specific serogroup B meningococcal vaccine given
to preteens. Clin Vaccine Immunol. 2007;14:1393–9. DOI: 10.1128/
CVI.00167-07
40. Oster P, O’Hallahan J, Aaberge I, Tilman S, Ypma E, Martin D.
Immunogenicity and safety of a strain-specific MenB OMV vaccine delivered to under 5-year olds in New Zealand. Vaccine.
2007;25:3075–9. DOI: 10.1016/j.vaccine.2007.01.023
472
Address for correspondence: Johannes Elias, University of Würzburg
– Institute for Hygiene and Microbiology, Würzburg, Bavaria 97080,
Germany; email: [email protected]
The opinions expressed by authors contributing to this journal do
not necessarily reflect the opinions of the Centers for Disease Control and Prevention or the institutions with which the authors are
affiliated.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Use of Avian Bornavirus Isolates
to Induce Proventricular Dilatation
Disease in Conures
Patricia Gray, Sharman Hoppes, Paulette Suchodolski, Negin Mirhosseini, Susan Payne,
Itamar Villanueva, H.L Shivaprasad, Kirsi S. Honkavuori, W. Ian Lipkin, Thomas Briese,
Sanjay M. Reddy, and Ian Tizard
Avian bornavirus (ABV) is a newly discovered member of the family Bornaviridae that has been associated with
the development of a lethal neurologic syndrome in birds,
termed proventricular dilatation disease (PDD). We successfully isolated and characterized ABV from the brains
of 8 birds with confirmed PDD. One isolate was passed 6
times in duck embryo fibroblasts, and the infected cells were
then injected intramuscularly into 2 healthy Patagonian
conures (Cyanoliseus patagonis). Clinical PDD developed
in both birds by 66 days postinfection. PDD was confirmed
by necropsy and histopathologic examination. Reverse
transcription–PCR showed that the inoculated ABV was in
the brains of the 2 infected birds. A control bird that received
uninfected tissue culture cells remained healthy until it was
euthanized at 77 days. Necropsy and histopathologic examinations showed no abnormalities; PCR did not indicate
ABV in its brain tissues.
P
roventricular dilatation disease (PDD) is a progressive,
invariably fatal neurologic disease that has been reported for >50 species of psittacine birds as well as many other
bird species (1). It is considered a serious disease because
many of these birds are highly endangered, and several affected species depend on captive breeding for their survival.
The clinical signs of PDD vary and may be predominately
neurologic (weakness, ataxia, proprioceptive deficits, seizures, blindness), gastrointestinal (weight loss, passage of
undigested food, regurgitation, delayed crop emptying), or
Author affiliations: Texas A&M University, College Station, Texas,
USA (P. Gray, S. Hoppes, P. Suchodolski, N. Mirhosseini, S. Payne,
I. Villanueva, S.M. Reddy, I. Tizard); California Animal Health and
Food Safety Laboratory System, Fresno, California, USA (H.L.
Shivaprasad); and Columbia University, New York, New York, USA
(K.S. Honkavuori, W.I. Lipkin, T. Briese)
DOI: 10.3201/eid1603.091257
a combination thereof (2). The gastrointestinal signs, especially proventricular dilatation, are secondary to pseudoobstruction brought about by damage to the enteric nervous
system. PDD is characterized by severe lymphoplasmacytic inflammation in peripheral, central, and autonomic nervous tissues (3–5). Definitive diagnosis of PDD requires
demonstration of lymphoplasmacytic ganglioneuritis in the
intestinal tract.
Recently, 2 independent groups of investigators identified a new member of the family Bornaviridae, named avian
bornavirus (ABV), in parrots with histopathologically confirmed PDD. Honkavuori et al. used unbiased high-throughput sequencing to identify the virus in several parrots with
histopathologically confirmed PDD (6). Quantitative PCR
confirmed the presence of the virus in brain, proventriculus,
and adrenal gland in 3 birds with PDD but not in 4 unaffected birds. Kistler (7) used a panviral microarray to identify a
bornavirus hybridization signature in 5 of 8 birds with PDD
and 0 of 8 controls. These investigators used ultra highthroughput sequencing combined with conventional PCRbased cloning to recover a complete viral genome sequence.
Before this discovery, the family Bornaviridae contained
only 1 species, Borna disease virus (BDV). BDV causes
a neurologic syndrome, Borna disease, which is restricted
to central Europe, where it is found primarily in horses and
sheep. The virus infects neurons and astrocytes, and the resulting disease appears to be mediated by an immunopathologic response of the host to the virus.
BDV can be grown in mammalian cell culture, where
it causes a noncytolytic persistent infection. Borna disease
appears as a sporadic infection affecting small numbers of
animals each year. Its epidemiology is unclear, but it may
be carried by certain species of shrews (8). BDV has also
been detected in the feces of wild birds and in captive ostriches, but the epidemiologic significance of this observa-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
473
RESEARCH
tion is unclear (9,10). Studies undertaken in this laboratory
have demonstrated some histopathologic similarities, in
particular in the selective destruction of cerebellar Purkinje
cells, between ABV and BDV infections of the brains of
birds and mammals, respectively (11).
Seven ABV genotypes have been identified based on
partial genome sequencing (12,13). In general, these ABV
strains show only ≈65% sequence identity with BDV. Nevertheless, the overall structure of the bornaviral genome is
well conserved (6,7). Thus, the number and order of genes
is unchanged, as is the structure of transcription initiation
and termination sites. Recently, Rinder et al. (14) have
shown that the region between the N and X gene in ABV
is shorter than that in BDV. ABV apparently lacks a 22nt fragment that serves a regulatory function for the genes
coding for viral proteins X and P.
Although these discoveries suggest that ABV is a
plausible cause of PDD, as described in Koch’s postulates,
proof of a causal relationship requires isolation of the agent
from infected birds; its propagation in culture; and, after
reintroduction of the isolate into a susceptible host, manifestation of the disease (15). We describe the isolation and
culture of ABV from the brains of 8 psittacine birds with
histopathologically confirmed PDD. After 6 passages, 1
of the cultured isolates was intramuscularly injected into
2 healthy Patagonian conures (Cyanoliseus patagonis).
Typical PDD subsequently developed in each bird, and the
inoculated virus was found in the brain.
Materials and Methods
Parrots
From independent sources we obtained 8 parrots that
had clinical signs of PDD, were clinically judged to be in
the late stages of the disease, and were euthanized for humane reasons. The 8 birds were 1 green-winged macaw
(Ara chloroptera), 1 scarlet macaw (A. macao), 2 blue and
yellow macaws (A. ararauna), 2 yellow-collared macaws
(Primolius auricollis), 1 African gray parrot (Psittacus erithracus), and 1 umbrella cockatoo (Cacatua alba). Four
parrots with conditions not related to PDD and euthanized
for humane reasons were also included in the study as negative controls.
Necropsy
Immediately after euthanasia, complete necropsies
were performed on all birds. Tissue samples from brain,
spinal cord, peripheral nerves, lungs, heart, liver, spleen,
pancreas, adrenal glands, kidneys, crop, proventriculus,
ventriculus, intestine, and cloaca were placed in 10% buffered formalin for histopathologic examination. Tissue sections were stained with hematoxylin and eosin to confirm
the clinical diagnosis. Half of each brain was retained for
474
virus isolation, Western blot, and reverse transcription–
PCR (RT-PCR).
Tissue Culture
Specific pathogen–free duck eggs were obtained from
the US Department of Agriculture Avian Disease Laboratory (East Lansing, MI, USA). Embryos 9–10 days old were
harvested, macerated, and cultured. Primary duck embryonic
fibroblasts (DEFs) were used for virus isolation and propagation. DEFs were maintained in Leibowitz L15–McCoy
5A medium (LM; Sigma-Aldrich, St. Louis, MO, USA)
supplemented with 5% bovine calf serum (Sigma-Aldrich)
and 1% penicillin-streptomycin at 37°C in an atmosphere of
5% CO2. DEFs were seeded to confluency 24 h before inoculation. DEFs not inoculated with tissue homogenate were
maintained in parallel throughout the experiment.
Virus Isolation and Culture
Brain tissue was harvested immediately after euthanasia. Sections of the cerebrum and cerebellum were homogenized, minced, and then passed through an 18-gauge
needle in LM complete medium. In instances where immediate culture inoculation was not possible, the brain tissue was frozen at –80°C within minutes of being harvested
and was thawed in a 37°C water bath immediately before
inoculation. One milliliter of the brain suspension was used
to inject previously plated DEF monolayers that were then
incubated for 24 h. The injected DEF cultures were then
washed once with phosphate-buffered saline (PBS), replaced with fresh LM medium supplemented with 2% fetal
calf serum, and incubated for 5–7 days. Infected DEFs were
trypsinized and cocultivated with freshly plated DEFs. This
procedure was repeated for a minimum of 3 passages.
Western Blot Analysis
Infected DEFs passaged a minimum of 3 times were
used for Western blot analyses. Samples from infected
DEFs were collected by trypsinization and pelleted by centrifugation, and pellets resuspended in PBS were sonicated
on ice at 50% intensity for 5 min (Sonifier 250; Branson
Ultrasonics Corp, Danbury, CT, USA); 50% intensity).
Western blotting was performed as described by Towbin
et al. (16) by using 10% polyacrylamide gels and a MiniProtean II gel electrophoresis apparatus (Bio-Rad, Hercules, CA, USA). The tissue culture preparations were diluted
in sample loading buffer containing β-mercaptoethanol at
a ratio of 1:1 and heated to 95°C for 5 min before being
loaded (30 μg/slot). A prestained sodium dodecyl sulfate–
polyacrylamide gel electrophoresis standard covering the
6.5- to 200-kDa range was used for molecular weight estimation (Bio-Rad).
The size-fractionated antigen preparations were transferred to Immobilon polyvinylidene fluoride transfer mem-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Propagation of Avian Bornavirus
branes (Millipore, Bedford, MA, USA) as described by
Towbin et al. (16). Transfer efficiency was indicated by
the presence of prestained bands on the membranes. After
transfer, the membranes were incubated for 2 h in PBS,
0.05% Tween-20, 3% skimmed milk (PBST blocking buffer), then with histopathologically confirmed PDD-positive
parrot serum diluted 1:5,000 in PBST blocking buffer for
2 h and with horseradish peroxidase–conjugated goat antimacaw immunoglobulin Y (Bethyl Inc., Montgomery, TX,
USA) diluted 1:10,000 in PBST blocking buffer for 1 h.
Membranes were washed with PBST after each step, and
all steps were performed at room temperature under constant shaking. Finally, the membranes were incubated for
30 min in Sigma-Fast 3,3′-diaminobenzidine developing
substrate (Sigma-Aldrich) and then rinsed in distilled water. The serum from a confirmed PDD-positive parrot used
in this experiment has been shown to contain antibodies
specific for the 38-kDa ABV N-protein by its reaction with
2 preparations of recombinant protein prepared in Escherichia coli and in mammalian cell systems (11).
primers, which were developed using GenBank submissions
NC_001607.1, FJ169441.1, and FJ169440.1 for reference.
Amplification conditions were as follows: 1 cycle at 94°C
for 2 min; 35 cycles at 94°C for 30 sec, 50°C for 30 sec,
and 72°C for 80 sec; final extension at 72°C for 7 min. PCR
products were cloned in TOPO-TA vector (Invitrogen), and
individual clones were sequenced after transformation into
E. coli. DNA sequencing reactions were performed by using the ABI BigDye Terminator Cycle Sequencing Kit, and
sequences were generated with an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems). Sequences were assembled and aligned by using Geneious Pro 4.6.2 software
(www.geneious.com). Isolates were assigned to previously
defined ABV groups by comparing a 397-nt region to sequences representing avian bornaviruses 1–5 (GenBank
accession nos. FJ002329, FJ603688, FJ002328, FJ603687,
FJ002335). Evolutionary distances were computed by using a Kimura 2-parameter model with MEGA4 software
(www.megasoftware.net).
Experimental Infections
Indirect Immunofluorescent Assay
Infected DEF were washed 2 times for 5 min each in
0.02M PBS, fixed for 10 min in 2% paraformaldehyde in
0.02 M PBS, and washed 2 times for 5 min each in 0.02 M
PBS. Cells were permeabilized in 1% Triton X-100/0.02
M PBS for 10 min and washed 3 times for 5 min each in
0.3% Tween/0.02 M PBS. Blocking was performed for 2 h
in 5% dried milk/0.3% Tween/0.02 M PBS. The cells were
incubated in a humidified chamber for 30 min at 37°C with
the primary antibody (serum from a parrot with histopathologically confirmed PDD) at a 1:500 dilution in 1% dried
milk/0.3% Tween/0.02 M PBS. Cells were washed 3 times
for 5 min each in 0.03% Tween/0.02 M PBS. The cultures
were then incubated in a humidified chamber for 30 min at
37°C with the secondary antibody (horseradish peroxidase–
or fluorescein isothiocyanate–conjugated goat anti-macaw
immunoglobulin G; Bethyl Inc.) at a 1:500 dilution in 1%
dried milk/0.3% Tween/0.02M PBS. Cells were washed 3
times for 5 min each in 0.03% Tween/0.02M PBS and then
rinsed in distilled water and mounted with ProLong antifade reagent with DAPI (Invitrogen, Carlsbad, CA, USA).
Experimental infections were performed under Animal
Use Protocol no. 2009–033B approved by the Texas A&M
University Institutional Animal Care and Use Committee.
Three adult Patagonian conures were shown to be seronegative by Western blotting and to be ABV negative by fecal PCR. All 3 birds were known to be chronic carriers of
psittacine herpes virus; 1 had a cloacal papilloma, but all
were otherwise in good health. Psittacine herpes virus has
never been implicated in PDD. Two birds were placed in
isolation and inoculated by intramuscular injection with infected DEFs containing 8 × 104 focus-forming units (17) of
an ABV4 (M24) originally isolated from a yellow-collared
macaw. A large batch of the M24 strain was grown for 5
days on passage 6, and 500-μL aliquots of this batch were
frozen at –80°C in freezing medium. Two of the 500-μL
aliquots were grown for 5 days, and immunohistostaining
(by using the immunofluorescent antibody [IFA] assay described, substituting the fluorescein isothiocyanate–labeled
antibodies with horseradish peroxidase–labeled antibodies)
was used to visualize and quantify the focus-forming units.
Results
RT-PCR
Total RNA was isolated from collected brain tissue
and passaged DEF by using the RNeasy Mini Kit (QIAGEN, Valencia, CA, USA). First-strand cDNA was generated by using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA), with
1μg RNA and random primers. PCR for ABV N-protein
was performed by using 1–2 μL cDNA and forward (5F:
5′-GCGGTAACAACCAACCAGCAA3-′) and reverse
(1212R: 5′-GTTCATTAGTTTGCRAATCCRGTTA3-′)
Isolation and Culture of Avian Bornavirus Isolates
Cytopathic effects were not observed in any of the 12
DEF cultures inoculated with brain tissue harvested from
birds with or without clinical signs of PDD. Western blot
analyses showed a pronounced ABV N-protein band in extracts of 8 of the 12 cultures. Only DEF cultures inoculated
with samples from parrots displaying histopathologically
confirmed PDD were positive by Western blotting (Figure 1).
ABV N-protein was not detectable in the 4 cultures injected
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
475
RESEARCH
kDa
66.2
45.0
31.0
21.5
1
2
3
4
5
6
7
8
9
33 and thereafter. Fecal PCR testing showed that both birds
were negative on days 33 and 43. One bird was weakly
positive on day 60, but both were strongly positive on day
62. One inoculated bird died on day 66. Necropsy showed
a dilated proventriculus and gross lesions characteristic of
PDD. Subsequent histopathologic examination confirmed
that the bird had a lymphoplasmacytic ganglioneuritis typical of PDD in the crop, proventriculus, gizzard, and intestine (Figure 3). This gangloneuritis included mild to severe
infiltration of lymphocytes and a few plasma cells in the
serosa, subserosal nerves, and ganglia. The bird also had
adrenalitis, encephalitis, and neuritis, as well as a myocarditis. The heart showed a lymphocytic infiltration of the
Figure 1. Western blot of infected duck embryonic fibroblasts
(DEFs) showing avian bornavirus N-protein during culture. Lanes
1–4 are supernatant fluids. Lane I is from an African gray parrot
(AG5). Lanes 2 and 3 are from a yellow-collared macaw (M24).
Lane 4 is from uninfected DEFs. Lanes 5–8 are sonicated cell
extracts. Lane 5 from AG5; 6 and 7 from M24; and Lane 8 from
uninfected DEFs. Lane 9 is an infected brain control. The virus is
strongly cell associated.
with brain tissue from birds with no histologic evidence of
PDD. IFA of infected DEFs also demonstrated ABV N-protein within cells. Foci of antigen-positive cells were apparent 3 days after culture inoculation. Many cells showed both
nuclear and diffuse cytoplasmic staining. Other cells showed
the characteristic punctate nuclear staining of infected cultures (Figure 2). No positive immunofluorescence was observed in uninfected DEFs or in DEFs inoculated with brain
tissue from negative control birds.
Characterization of Avian Bornavirus Isolates
RNA was isolated from the brain tissues and infected
DEF cultures of 8 parrots with PDD and 4 parrots that were
PDD negative. A 397-bp region of the ABV N-gene was
amplified from all 8 PDD brain and tissue culture samples
but not those from the 4 negative parrots. The amplicons
were cloned and their sequences compared with previously
described ABV groups (7). One isolate, M25, was most
closely related to ABV group 1, whereas the other 7 ABV
isolates were most closely related to ABV group 4 (Table).
Pairwise comparisons among the group 4 isolates ranged
from 94.2% to 99.7% nucleotide identity. When 2–3 complete N-protein gene sequences (1,143 nt) originating from
any bird were compared, nucleotide sequence identity
ranged from 99.2% to 100% (data not shown).
Experimental Infections
Two Patagonian conures were challenged with ABV4,
strain M24. They were tested by fecal PCR before challenge
and at 33, 43, 60, and 62 days postchallenge. Both conures
were seronegative by Western blotting before challenge but
seropositive for antibodies to the 38-kDa N-protein on day
476
Figure 2. A) Avian bornavirus (ABV)–infected duck embryonic
fibroblast (DEF) cell culture 6 days after injection with
hindbrain tissues from an African gray parrot with confirmed
proventricular dilatation disease (AG5) and staining by an
indirect immunofluorescence assay for ABV N-protein. Speckled
immunofluorescence is typical of bornavirus infection. Original
magnification ×40. B) DEFs 3 days after injection with forebrain
from a yellow-collared macaw with confirmed proventricular
dilatation disease (M24). Nuclear and cytoplasmic fluorescence in
DEFs stained by immunofluorescence assay for ABV N-protein.
Original magnification ×40.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Propagation of Avian Bornavirus
Table. Percent nucleotide identity between partial N genes in avian bornavirus isolates
Gene
ABV Type 1a*
M25
M20
AG5
M15
M10
ABV Type 1a
100.0
M25
89.4
100.0
M20
80.9
82.0
100.0
AG5
80.9
82.0
99.7
100.0
M15
80.9
82.0
99.9
99.7
100.0
M10
80.9
82.0
99.6
99.5
99.7
100.0
M14
81.1
81.7
99.6
99.6
99.7
99.6
M24
81.1
81.7
95.0
94.8
94.7
94.5
06
81.4
81.8
94.5
94.5
94.4
94.3
ABV Type 4b
80.6
81.4
94.0
94.7
94.7
94.7
M14
M24
06
ABV Type 4b†
100.0
94.5
94.2
95.0
100.0
99.3
92.7
100.0
94.5
100.0
*ABV genotype 1 accession no. FJ002329.
†ABV genotype 4 accession no. FJ603687.
epicardial ganglia as well as in and around Purkinje fibers.
Thus, the brain and spinal cord showed multifocal perivascular cuffing and gliosis (Figure 4). The adrenal medulla
was infiltrated with lymphocytes and plasma cells.
The second inoculated bird was examined on day 66
and was found to be emaciated and had clinical signs consistent with PDD. It was euthanized for humane reasons.
This bird also had gross and histopathologic lesions characteristic of PDD, essentially identical to those described
above. The brains of both conures were subjected to PCR
for ABV N-protein as described above. Results for both
were positive (Figure 5). Sequence analysis of the PCR
products confirmed that bird brains contained ABV4 identical to the M24 challenge strain. Brain homogenates from
these 2 birds were also cultured on DEFs, and a strong positive PCR signal was obtained at day 16 of culture.
The third conure in this study received uninfected
DEFs by both intramuscular and oral routes as described
for experimentally infected birds. This bird was housed in
an aviary separate from the isolation facilities of the infected birds. It was in apparent good health when euthanized
on day 77. Necropsy of the bird conducted, including histopathologic examination of its tissues, and PCR was performed on 4 regions of its brain. No evidence of PDD was
seen during necropsy or histopathologic examination, and
all 4 brain samples were negative for ABV nucleic acid.
Discussion
Although it has long been proposed that a viral pathogen was responsible for PDD, past attempts to identify a
causal agent through inoculation of chick embryos and a
variety of tissue cultures were unsuccessful. Because no
cytopathic effects were detected in the DEF cultures after several passages, prior attempts to grow the agent may
have been successful but had not been recognized because
of lack of immunologic or PCR detection tools. We were
able to isolate and propagate ABV from all studied birds
with clinical PDD. IFA of infected DEF using this same antiserum showed the punctate nuclear staining that is typical
of cells infected with bornaviruses and appears to be the re-
sult of the formation of N-and P-protein complexes known
as Joest-Degen inclusion bodies (18–20). It is noteworthy
that we were unable to grow ABV in primary chicken embryo fibroblasts handled the same as the DEFs. Rinder et
al. reported successful propagation of ABV in the chicken
LMH hepatoma cell line (14). However, they noted slow
growth and only a few positive cells compared with propagation in the quail fibroblast cell line CEC32 and the quail
skeletal muscle cell line QM7. Thus ABV appears to have
constraints in host cell range. PDD in chickens has not been
reported. Rinder et al., like ourselves (P. Gray et al., unpub.
data), were unable to grow ABV in cell lines of mammalian
origin, such as Vero cells or MDCK cells in which BDV
grows routinely. This research finding suggests that ABV
may be unable to infect mammals.
Bornavirus has a nonsegmented negative strand genome. It encodes at least 6 proteins: N, X, P, M, G ,and L.
The N or nucleoprotein interacts with the viral RNA and
accumulates in the nucleus during the life cycle of the virus (21,22). The nucleoprotein of BDV exists in 2 isoforms
of 40 and 38 kDa (23,24). P40 is primarily nuclear, and
Figure 3. Proventriculus wall from conure PG8 showing
characteristic lymphoplasmacytic infiltration of the subserosal
enteric ganglia as well as infiltration of submucosa. This bird had
been inoculated 55 days earlier with avian bornavirus, genotype 4.
Original magnification ×325.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
477
RESEARCH
Figure 4. Lymphoplasmacytic encephalitis with multifocal perivascular cuffing in the cerebrum of conure PG8 inoculated 55 days
earlier with avian bornavirus genotype 4. Original magnification
×725.
P38 is primarily cytoplasmic. Both isoforms can bind to
the viral phosphoprotein. The immunofluorescent staining
pattern observed with ABV-infected DEFs, which showed
a punctate nuclear staining combined with a more diffuse
cytoplasmic staining, is thus compatible with the known
properties of the BDV nucleoprotein. Of 8 isolates reported
here, 7 were of genotype 4 and 1 was of genotype 1. This
finding may suggest that genotype 4 is a more pathogenic
type associated with disease, or it may simply be the predominant strain circulating in Texas.
Rinder et al. (14) reported on 6 isolates from Germany, 4 of which were genotype 4 and the others were genotype 2. This finding supports the suggestion that genotype 4 may be predominant worldwide and possibly more
virulent than other genotypes. The experimental infection
of 2 Patagonian conures with cultured virus that resulted in clinical PDD 66 days postinfection fulfills Koch’s
postulates. PCR and sequencing of the amplified product
demonstrated large amounts of ABV4 in the brains of the
challenged birds. The birds did seroconvert for anti-N
antibodies at 33 days, whereas fecal shedding was not
detected until days 60–62. This finding is in contrast to
observations on naturally infected birds in which fecal
shedding may precede seroconversion by many months
(25). ABV RNA was detected by RT-PCR after a minimum of 3 passages in DEF primary cell culture subsequent to inoculation with brain tissue from all 8 necropsyconfirmed PDD-positive birds. PCR detection in the brain
tissue and ready isolation of the virus from freshly harvested brain tissue are compatible with the concept that
PDD originates as a viral encephalitis (11).
Gancz et al. (26) have induced PDD in cockatiels
(Nymphicus hollandicus) after inoculation of brain homogenates from PDD-affected, ABV-positive birds. Although
478
the findings of Gancz et al. support our results and are in
line with previous findings (27), interpretation of their results is difficult because of evidence for an autoimmune
component in PDD similar to that which occurs in Guillain
Barré syndrome (28). We also have detected autoantibodies
to myelin basic protein and other nervous system autoantigens in PDD cases, suggesting that in this study, the brain
homogenate may have contributed to the abnormalities observed. (25). The known pathogenesis of mammalian bornavirus infections fits well with the causative role of ABV
in PDD. Both PDD and mammalian Borna disease share
many attributes, including a viral encephalitis and polyneuritis with selective destruction of Purkinje cells, lymphocyte infiltration, and dysfunction of the central, peripheral,
and autonomic nervous systems (29–31).
In conclusion, the results reported here together with
previous findings confirm unequivocally that the longsought cause of proventricular dilatation disease is indeed
Figure 5. PCR of avian bornavirus N-protein in different areas of
the brains of A) 2 Patagonian conures (PG7 and PG8) inoculated
55 days earlier with avian bornavirus–infected duck embryonic
fibroblasts and B) control, uninfected bird, PG5. HB, hindbrain; FB,
forebrain; MB, midbrain; Cerebr., cerebrum.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Propagation of Avian Bornavirus
avian bornavirus. Investigations into this virus and the complex disease that it causes may provide useful insights into
the pathogenesis of mammalian Borna disease. The origin
and epidemiology, as well and prevention and treatment, of
this infection remain to be elucidated.
This research was supported by the Richard M. Schubot Endowment at Texas A&M University.
Dr Gray is a resident in avian studies and works at the
Schubot Exotic Bird Health Center, where she has been conducting research on proventricular dilatation disease.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Gregory CR, Latimer KS, Niagro FD, Ritchie BW, Campagnoli RP,
Norton TM, et al. A review of proventricular dilatation syndrome. J
Assoc Avian Vet. 1994;8:69–75.
Steinmetz A, Pees M, Schmidt V, Weber M, Krautwald-Junghanns
M-E, Oechtering G. Blindness as a sign of proventricular dilatation disease in a grey parrot (Psittacus erithracus erithracus). J
Small Anim Pract. 2008;49:660–2. DOI: 10.1111/j.1748-5827
.2008.00608.x
Shivaprasad HL, Barr BC, Woods LW, Daft BM, Moore JD, Kinde
H, et al. Spectrum of lesions (pathology) of proventricular dilation
syndrome. Proceedings of the Association of Avian Veterinarians;
1995 Aug 28–Sep 2; Philadelphia, Pennsylvania, USA. p. 507–8.
Schmidt RE, Reavill DR, Phalen DN. Pathology of pet and aviary
birds. Ames (IA): Iowa State Press, 2003. p. 47–55.
Berhane Y, Smith DA, Newman S, Taylor M, Nagy E, Binnington B, et al. Peripheral neuritis in psittacine birds with proventricular dilatation disease. Avian Pathol. 2001;30:563–70. DOI:
10.1080/03079450120078770
Honkavuori KS, Shivaprasad HL, Williams BL, Quan P-L, Hornig
M, Street C, et al. Novel bornavirus in psittacine birds with proventricular dilatation disease. Emerg Infect Dis. 2008;14:1883–6. DOI:
10.3201/eid1412.080984
Kistler AL, Gancz A, Clubb S, Skewes-Cox P, Fischer K, Sorber
K, et al. Recovery of divergent avian bornaviruses from cases of
proventricular dilatation disease: identification of a candidate etiologic agent. Virol J. 2008;5:88. DOI: 10.1186/1743-422X-5-88
Hilbe M, Herrsche R, Kolodziejek J, Nowotny N, Zlinszky K,
Ehrensperger F. Shrews as reservoir hosts of Borna disease virus.
Emerg Infect Dis. 2006;12:675–7.
Berg M, Johansson M, Montell H, Berg A-L. Wild birds as a possible natural reservoir of Borna disease virus. Epidemiol Infect.
2001;127:173–8. DOI: 10.1017/S0950268801005702
Malkinson M, Weismann Y, Ashash E, Bode L, Ludwig H. Borna
disease in ostriches. Vet Rec. 1993;133:304.
Ouyang N, Storts R, Tian Y, Wigle W, Villanueva I, Mirhosseini N,
et al. Detection of avian bornavirus in the nervous system of birds
diagnosed with proventricular dilatation disease. Avian Pathol.
2009;38:393–401. DOI: 10.1080/03079450903191036
Weissenböck H, Bakonyi T, Sekulin K, Ehrensperger F, Doneley
RJT, Dürrwald R, et al. Avian bornaviruses in psittacine birds from
Europe and Australia with proventricular dilatation disease. Emerg
Infect Dis. 2009;15:1453–9. DOI: 10.3201/eid1509.090353
Weissenböck H, Sekulin K, Bakonyi T, Högler S, Nowotny N.
Novel avian bornavirus in a nonpsittacine species (canary; Serinus canaria) with enteric ganglioneuritis and encephalitis. J Virol.
2009;83:11367–71. DOI: 10.1128/JVI.01343-09
14.
Rinder M, Ackermann A, Kempf H, Kaspers B, Korbel R, Staeheli
P. Broad tissue tropism of avian bornavirus in parrots with proventricular dilatation disease. J Virol. 2009;83:5401–7. DOI: 10.1128/
JVI.00133-09
15. Koch R. Ueber bakteriologische Forschung, Verhandl. des X. Interntl. Med. Congr., Berlin 1890, August Hirschwald, Berlin; 1891.
p. 35.
16. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure
and some applications. Proc Natl Acad Sci U S A. 1979;76:4350–4.
DOI: 10.1073/pnas.76.9.4350
17. Pauli G, Grunmach J, Ludwig H. Focus-immunoassay for Borna disease virus–specific antigens. Zentralbl Veterinarmed B.
1984;31:552–7.
18. Joest E, Degen K. Über eigentümliche Kerneinschlüsse der Ganglienzellen bei der enzootischen Gehirn-Rückenmarksentzündung
der Pferde. Z Infkrankh Haustiere. 1909;6:348–56.
19. Schwemmle M, Salvatore M, Shi L, Richt J, Lee CH, Lipkin WI.
Interactions of the borna disease virus P, N, and X proteins and their
functional implications. J Biol Chem. 1998;273:9007–12. DOI:
10.1074/jbc.273.15.9007
20. Sasaki S, Ludwig H. In borna disease virus infected rabbit neurons
100 nm particle structures accumulate at areas of Joest-Degen inclusion bodies. Zentralbl Veterinarmed B. 1993;40:291–7.
21. Briese T, de la Torre JC, Lewis A, Ludwig H, Lipkin WI. Borna disease virus, a negative-strand RNA virus, transcribes in the nucleus
of infected cells. Proc Natl Acad Sci U S A. 1992;89:11486–9. DOI:
10.1073/pnas.89.23.11486
22. Schwemmle M, Lipkin WI. Models and mechanisms of Bornavirus
pathogenesis. Drug Discov Today. 2004;1:211–6. DOI: 10.1016/j.
ddmec.2004.09.001
23. Pyper JM, Gartner AE. Molecular basis for the different subcellular
localization of the 38-and 39-kilodalton structural proteins of Borna
disease virus. J Virol. 1997;71:5133–9.
24. Kobayashi T, Shoya Y, Koda T, Takashima I, Lai PK, Ikuta K, et al.
Nuclear targeting activity associated with the amino terminal region
of the Borna disease virus nucleoprotein. Virology. 1998;243:188–
97. DOI: 10.1006/viro.1998.9049
25. Tizard I, Villanueva I, Gray P, Hoppes S, Mirhosseini N, Payne S.
Update on avian bornavirus and proventricular dilatation disease.
In: Cross G, editor. Proceedings of the Association of Avian Veterinarians, Australasian Chapter; 2009 Sep 14–17; Adelaide, South
Australia, Australia. p. 93–100.
26. Gancz AY, Kistler AL, Greninger AL, Farnoushi Y, Mechani S, Perl
S, et al. Experimental induction of proventricular dilatation disease
in cockatiels (Nymphicus hollandicus) inoculated with brain homogenates containing avian bornavirus 4. Virol J. 2009;6:100. DOI:
10.1186/1743-422X-6-100
27. Gough RE, Drury SE, Harcourt-Brown NH. Virus-like particles associated with macaw wasting disease. Vet Rec. 1996;139:24.
28. Rossi G, Crosta L, Pesaro S. Parrot proventricular dilatation disease.
Vet Rec. 2008;163:310.
29. Ludwig H, Kraft W, Kao M, Gosztonyi G, Dahme E, Krey H. Bornavirus infection (Borna disease) in naturally and experimentally
infected animals: its significance for research and practice. Tierarztl
Prax. 1985;13:421–53.
30. Stitz L, Bilzer T, Richt JA, Rott R. Pathogenesis of Borna disease.
Arch Virol Suppl. 1993;7:135–51.
31. Briese T, Hornig M, Lipkin WI. Bornavirus immunopathogenesis
in rodents: models for human neurological diseases. J Neurovirol.
1999;5:604–12. DOI: 10.3109/13550289909021289
Address for correspondence: Ian Tizard, Schubot Exotic Bird Health
Center, Veterinary Pathobiology, Texas A&M University, 4467 TAMU,
College Station, TX 77843-4467, USA; email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
479
RESEARCH
Economic Cost Analysis of West
Nile Virus Outbreak, Sacramento
County, California, USA, 2005
Loren M. Barber, Jerome J. Schleier III, and Robert K.D. Peterson
In 2005, an outbreak of West Nile virus (WNV) disease
occurred in Sacramento County, California; 163 human cases were reported. In response to WNV surveillance indicating increased WNV activity, the Sacramento-Yolo Mosquito
and Vector Control District conducted an emergency aerial
spray. We determined the economic impact of the outbreak,
including the vector control event and the medical cost to
treat WNV disease. WNV disease in Sacramento County
cost ≈$2.28 million for medical treatment and patients’ productivity loss for both West Nile fever and West Nile neuroinvasive disease. Vector control cost ≈$701,790, including
spray procedures and overtime hours. The total economic
impact of WNV was $2.98 million. A cost-benefit analysis
indicated that only 15 cases of West Nile neuroinvasive disease would need to be prevented to make the emergency
spray cost-effective.
A
fter its introduction into the eastern United States in
1999, West Nile virus (WNV) reached California in
2003 (1). In response, the state enhanced mosquito management programs to reduce vector populations and virus
transmission (2). By late summer 2005, WNV disease was
epidemic in Sacramento County, with more cases reported
in Sacramento County than in any other county in the nation that year (3). The Sacramento-Yolo Mosquito and Vector Control District (SYMVCD) responded by conducting
emergency aerial spraying over the city of Sacramento and
surrounding areas to reduce mosquito populations.
Effective management of infection rates, illness, and
death from mosquito-borne pathogens such as WNV requires reduced contact between humans and infected mosquitoes (4). No effective treatment exists for WNV; pre-
Author affiliation: Montana State University, Bozeman, Montana,
USA
DOI: 10.3201/eid1603.090667
480
vention of disease relies on management of mosquitoes
through various control tactics. Elnaiem et al. (5) and Carney et al. (6) examined the efficacy of the 2005 emergency
aerial spray in Sacramento County, which used pyrethrins
as the active ingredients to control adult mosquitoes. In
both studies, an unsprayed area within the county was used
as the control. Elnaiem et al. showed a total decrease in
WNV-competent vector mosquitoes, Culex pipiens and Cx.
tarsalis, of 57.5%, compared with the prespray population
in the treated area (5). They also observed a decrease in
WNV infection rates in mosquitoes to 3.9/1,000 for trapped
females in the treated areas, compared with 6.7/1,000 in the
untreated areas (5). Carney et al. used illness onset dates
and residential locations for 152 of the 163 WNV disease
cases reported in humans in 2005 to determine the efficacy
of the spray event (6). Their results showed no incident human cases in the treated area after the spray event, compared with 18 cases in the untreated area. Consequently, the
emergency aerial spray seemed to effectively reduce both
mosquito populations (5) and human WNV cases (6).
WNV infection can be asymptomatic or symptomatic
in humans, with a 4:1 ratio (7,8). The disease can be mild,
resulting in influenza-like symptoms (as in West Nile fever
[WNF]), or severe, affecting the central nervous system
symptom (as in West Nile neuroinvasive disease [WNND])
(7). Many WNF cases are not reported because they are not
recognized as WNF; symptoms can resemble a cold or mild
influenza-like illness, for which medical care is not sought,
or is underdiagnosed because the additional cost of testing
would not provide alternative direction to effective palliative medical care (7,9).
Zohrabian et al. (10) estimated the economic impact
of the WNV disease outbreak in 2002 in Louisiana, which
resulted in 24 deaths. They included costs of inpatient and
outpatient medical care, productivity loss, the state’s public
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Cost Analysis of WNV Outbreak
health department, and vector control. Total epidemic costs
were ≈$20.14 million for the 329 cases, including $9.2 million for mosquito control and public health agency costs.
Zohrabian et al. (11) used the economic data from their
2004 study to determine the cost-effectiveness of the initiation of a potential WNV vaccination and found that the cost
of vaccination would not offset the costs in medical care.
Several studies have demonstrated the efficacy of
mosquito management in response to WNV, but only the
study by Carney et al. (6) suggested a reduction in human
WNV cases associated with aerial adult-mosquito control.
We estimated the economic cost of the 2005 WNV disease
outbreak in Sacramento County, California, and evaluated
the reduction in WNV disease necessary to offset the cost
of emergency vector control. Economic costs for patients’
productivity loss and for treatment of disease symptoms, as
well as for emergency vector control conducted in response
to the outbreak were also investigated.
Methods
Medical Costs
We estimated costs for the total number of Sacramento County WNV cases in 2005. Different costs were
associated with WNF and the more severe WNND. The
Centers for Disease Control and Prevention (CDC) summarizes the reported number of WNV cases for each state,
including patient’s age, sex, date of onset, case reporting
date, county of residence, diagnosis (WNF or WNND),
and outcome (e.g., fatal). According to the CDC database
for 2005, a total of 935 human WNV cases were reported in California, including 163 cases from Sacramento
County (3). A total of 117 (71.8%) were diagnosed as
WNF and 46 (28.2%) as WNND; 1 (0.6%) case was fatal.
Forty-six (28.2%) patients were >60 years of age, and 2
(1.2%) were <18 years of age.
For WNND, we calculated costs using similar methods
as and specific data from Zohrabian et al. (10). Costs of
inpatient and outpatient care, lost productivity, and miscellaneous expenses were summed to estimate the total cost
of an individual WNND case. Costs for WNF, including
average price for a physician visit, CDC-approved diagnostic testing, and productivity loss during symptomatic WNV
disease, were summed to estimate the total cost of an individual WNF case.
WNND
We obtained inpatient costs for WNND using the 2005
hospital patient discharge database from California’s Office of Statewide Health Planning and Development (OSHPD) (J. Teague and J. Morgan, pers. comm.). This database
included patients with a WNV-related diagnosis who were
admitted to hospitals within Sacramento County’s ZIP
codes. It also included average inpatient hospital charge per
stay and average length of stay for the different WNV diagnosis codes (Table 1). Cost data were available for 16 of the
27 WNND cases reported by Sacramento County hospitals
in 2005 (some hospitals do not report cost data). Charges
were averaged for each diagnosis code, and the average
charge was determined for WNND (no hospital cases were
reported for WNF). The average charge was then converted
to the true economic cost by using the average Sacramento
County hospital cost-to-charge ratio (CCR). Individual
hospitals’ CCRs were obtained from California’s Department of Industrial Regulations (12), and the average was
based on the number of cases reported at each hospital in
the county, also obtained from OSHPD. The resulting inpatient cost was extrapolated to all WNND cases in Sacramento County for the total economic impact.
We estimated outpatient costs for WNND using the
2002 outpatient costs determined by Zohrabian et al. (10)
and updated to 2005 using data from the Consumer Price
Index (CPI) for the western United States, obtained from
the US Department of Labor, Bureau of Labor Statistics
(13–15). Zohrabian et al. used hospital cost data reported
from 119 patients and phone surveys of 139 patients to
determine related treatment costs for WNV disease symptoms. CPI data included the percentage increase for medical
care services for 2002–2003, 2003–2004, and 2004–2005.
These increases were applied to the service categories orig-
Table 1. WNF diagnosis codes and cases, Sacramento County, California, 2005*
No. hospitalized casepatients reported†
Diagnosis code
Diagnosis
Classification
66.40
WNF, unspecified
0
WNF
66.41
WNF with encephalitis
17
Severe (WNND)
66.42
WNF with other neurologic
8
Severe (WNND)
manifestation
66.49
WNF with other complications
2
Severe (WNND)
WNND totals or averages
27
Cases with
cost data‡
0
14
2
Average ALOS§
(range¶)
0
16
21 (13–29)
15 (10–36)
16 (12–36)
13 (10–14)
*WNF, West Nile fever; ALOS, average length of stay (J. Teague and J. Morgan, pers. comm.); WNND, West Nile neuroinvasive disease.
†Cases in 2005 obtained from the Patient Discharge Data from California’s Office of Statewide Health Planning and Development (J. Teague and J.
Morgan, pers. comm.).
‡Cases that included cost data from the Patient Discharge Database and incorporated into the study.
§Average length of stay, in days (J. Teague and J. Morgan, pers. comm.).
¶Not the true ALOS range, determined from data for each diagnosis code.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
481
RESEARCH
inated by Zohrabian et al.: hospital treatment, physician
visits, outpatient physical therapy, occupational therapy,
and speech therapy. Percentages of total patients for whom
the service applied were determined by using information
from Zohrabian et al. for each outpatient category; these
percentages were then applied to the Sacramento County
WWND cases for the costs per patient per category.
Miscellaneous costs included nursing home, transportation, home-health aides, and child care costs accrued
during recovery from WNND. Average nursing home costs
per day in 2005 were obtained from the Survey of Nursing
Home and Home Care Costs (16). We calculated the value
by averaging the national costs for the daily rate of a private
and semiprivate room in 2005. The total associated costs for
a nursing home stay was then determined by multiplying
this value by the average number of days a WNND patient
spent in a nursing home (96 days) (10). We applied this
cost to 3.6% of the WNND patients and rounded it to the
nearest whole number of patients. Transportation, homehealth aides, child care, and other home-help costs were
calculated by using the cost values determined in Zohrabian et al., updated to 2005 by using the CPIs mentioned
previously (13–15). We applied the resulting transportation
cost to all WNND cases, and applied costs for home-help
aides to 14.4% of the 2005 WNND cases and rounded to
the nearest whole number of patients.
We assumed that productivity loss differentially affected persons in 2 age groups: >60 years and <60 years.
Productivity loss was also calculated for nonprofessional
caretakers of WNND patients. We determined the cost for
a day of work missed by an average Sacramento adult citizen using the mean annual earnings for full-time workers in
2005 (17). Annual income was divided by 250 work days
per year. The resulting value was the cost for a day of work
missed by persons <60 years of age. We calculated the cost
for a nonwork day missed using Productivity Loss Tables
from 2000 (18) and updated to 2005 dollars using the US
Department of Labor, Bureau of Labor Statistics, annual
earnings (17). The percentage increase from 2000 to 2005
was applied to the Productivity Loss Tables’ value for a
nonwork day loss. The resulting value for a nonwork day
missed also was used for productivity loss for persons >60
years of age who had WNND. We conservatively assumed
an average of 50 work days missed (10) and 10 nonwork
days missed (1 weekend day per week).Thus, total productivity loss was 60 days. For caretakers of WNND patients,
productivity loss was assumed to be 25 days, and the associated cost was the value of a nonwork day missed (10).
The cost attributed to productivity loss is an estimate; true
monetary value for pain and distress and the productivity
loss associated with chronic WNND are uncertain.
482
WNF
Assumed costs for treating WNF were those of a physician visit, a diagnostic test, and productivity loss during
symptomatic WNF. We obtained the average costs for a
physician visit for a diagnosis or treatment in the western
United States from 2004 data (19) and updated to 2005, using the CPI (15) as discussed above.
The CDC-approved diagnostic test for human WNV is
an immunoglobulin (Ig)M and IgG ELISA for either serum
or cerebrospinal fluid (7). According to CDC, an additional
test is needed to indicate a false-positive result; however,
our analysis assumed only costs for the initial diagnostic
test. We obtained this value by contacting 4 laboratories
suggested by the California Department of Public Health
(C. Jean, pers. comm.) (ARUP Laboratories, Salt Lake
City, UT, USA; Focus Diagnostics Inc., Cypress, CA, USA;
Quest Diagnostics Inc., Madison, NJ, USA; and Specialty
Laboratories, Valencia, CA, USA); the costs obtained were
then averaged. Productivity loss for a missed day of work
and a missed day of nonwork were calculated by using
the methods detailed previously. We assumed 5 workdays
missed because of WNF for persons <60 years of age and 5
nonwork days missed for persons >60 years of age.
Cost of Mosquito Vector Control
We obtained cost information for the 2005 emergency
mosquito control aerial spray from SYMVCD. It included
aerial ultra-low–volume adulticiding over 2 areas in Sacramento County comprising ≈477 km2 (6). Aerial spraying
was conducted on 6 nights in early and mid-August (5).
The event costs incorporated overtime hours for SYMVCD
employees for August 2005. We calculated total overtime
hours spent on the emergency spray using the difference
between paid overtime hours for August 2005 and August
2004. Overtime hours for August 2005 were assumed to
be additional hours to SYMVCD’s usual vector control
program, including hours for additional prespray and postspray application mosquito trapping, plane preparation
time, and preparation time for completing the spraying.
These hours included time spent on other spray events and
vector control procedures not directly involved in the emergency spray. However, our study incorporated total overtime hours for August to ensure conservatism. Total cost
for the emergency spray also included outsource contracts
(e.g., plane rental, pilot hours) and the insecticide used.
Results
Medical Costs for WNND
A total of 46 WNND cases occurred in Sacramento
County in 2005. Costs were ≈$33,143 per inpatient and
≈$6,317 per outpatient for all treatments (Table 2). Cost
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Cost Analysis of WNV Outbreak
Table 2. Estimated inpatient and outpatient economic costs of WNND cases, Sacramento County, California, 2005*
Total cost if
% Cases to
No. cases to
which cost
Total cost for treatment/service were
which cost
used in all cases
applies§
all cases
applies‡
Item
Cost per case†
Inpatient treatment costs
$33,143
46
100
$1,524,570
$1,524,570
Outpatient costs
Cost per case¶
Outpatient hospital treatment
$333
17
36
$5,668
$15,337
Physician visits
$450
46
100
$20,708
$20,708
Outpatient physical therapy
$909
46
100
$41,810
$41,810
Occupational therapy
$4,037
3
7
$12,111
$185,699
Speech therapy
$588
1
1
$588
$27,032
Total
$80,885
$290,586
Nursing home costs
Cost#
Nursing home stay**
$190
2
4
$36,195
$36,195
Transportation
$65
46
100
$2,977
$2,977
Home health aides, babysitters, etc.
$1,569
7
14
$10,983
$505,211
Total
$50,154
$544,383
Total for all WNND
$2,140,409
$2,844,339
*WNND, West Nile neuroinvasive disease; BLS, Bureau of Labor Statistics of the US Department of Labor.
†Estimated by using 2005 data from California’s Office of Statewide Health Planning and Development (J. Teague and J. Morgan, pers. comm.).
‡WNND cases from the total number of cases reported by the Centers for Disease Control and Prevention (3).
§See (10).
¶Estimated by using data from Zohrabian et al. (10) and updated using data from the US Department of Labor’s Bureau of Labor Statistics (BLS) (13–15).
#Estimated by using data from MetLife Mature Market Institute (16), Zohrabian et al. (10), and BLS (13–15).
**Average length of nursing home stay was 96 days.
for each WNND patient estimated to have spent time in
a nursing home was ≈$18,097. Productivity loss during
symptomatic WNND cost $10,800 per patient <60 years
of age and $7,500 per patient >60 years of age (Table 3).
Total medical costs accrued by all WNND patients was
≈$2,140,409; total costs for all cases (medical cost plus
productivity loss) was ≈$2,844,338.
We performed sensitivity analysis for medical treatment of WNND in which we had a range of values using
10,000 iterations. The hospitals’ CCRs contributed the
largest amount of variance to the total cost (68.5%), followed by the average inpatient cost per WNND patient
from the 2005 hospital patient discharge database from
OSHPD (J. Teague and J. Morgan, pers. comm.) (31.4%),
range $1,910,421–$7,770,354. Results were similar for the
cost per WNND inpatient (range $13,201–$140,257) and
the total medical cost for treating WNND.
Medical Costs for WNF
A total of 117 WNF cases were reported for Sacramento County in 2005. Treating each WNF patient cost
≈$167 for the diagnostic physician visit and ≈$135 for the
diagnostic test. Productivity loss cost ≈$955 for each patient <60 years of age and $625 for each patient >60 years
of age. The total cost for treating reported WNF cases was
≈$136,839 (Table 4).
Sensitivity analysis for the cost of treating WNF (range
$132,008–$144,458) showed that the average cost for the
diagnosis test contributed the largest amount of variance to
the total cost (84.2%). The cost of a missed day of work for
patients <60 years of age was 15.8%.
Emergency Vector Control Spray
The emergency spray comprised 1,157 additional
overtime hours in SYMVCD for August 2005. These
overtime hours cost ≈$41,790. The emergency spray cost
≈$660,000 (D. Brown, pers. comm.). Therefore, the emergency aerial spray response to the WNV epidemic cost a
total of $701,790.
Total Costs and Potential Benefits
Total cost of the 2005 Sacramento County WNV
epidemic was ≈$2,979,037. Costs for treating WNND patients alone exceeded costs of emergency vector control by
$1,438,619, a ratio of 3:1. This difference suggests that for
the benefits of the vector control to outweigh the cost of the
epidemic, the spray event would need to prevent only 15
WNND cases.
Table 3. Estimated economic costs of WNND cases due to productivity loss, Sacramento County, California, 2005*
No. patients
Value of work Value of nonwork
No. work
No. nonwork
Productivity loss
day missed†
day missed‡
days missed
days missed
% Cases
<60
>60
For patients <60 y
$191
$125
50
10
31
100
For patients >60 y
$125
60
15
100
For caretakers
$125
25
8
4
26
Total costs
Total costs for
all cases
$334,800
$112,500
$37,500
$484,800
*WNND, West Nile neuroinvasive disease.
†Estimated by using data from BLS (17).
‡Estimated by using data from Grosse (18) and BLS (17).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
483
RESEARCH
Table 4. Estimated economic impact for WNF cases (N = 117), Sacramento County, California, 2005*
No. patients by age, y
Item
Cost
<60
>60
Physician visit for diagnosis or treatment in
$167
86
31
the western US, cost per case†
Diagnostic tests, average cost per case‡
$135
Productivity loss
Per work day missed§ Per nonwork day missed¶ Total individual cost#
Value of a lost day
$191
$125
$955
$625
Total costs for WNF
Total cost
$19,539
$101,505
$136,839
*WNF, West Nile fever; BLS, Bureau of Labor Statistics, US Department of Labor.
†Estimated by using data from Brown and Beauregard (19) and BLS (15).
‡ELISA immunoglobulin (Ig) G and IgM serum and cerebrospinal fluid. Estimated by using laboratory list prices (ARUP Laboratories, Salt Lake City, UT,
USA; Focus Diagnostics Inc., Cypress, CA, USA; Quest Diagnostics Inc., Madison, NJ, USA; Specialty Laboratories, Valencia, CA, USA).
§Estimated by using data from BLS (17).
¶Estimated by using data from Grosse (18) and BLS (17).
#Based on 5 workdays missed per person <60 y and 5 nonwork days missed per person >60 y.
Discussion
Since 1999, when WNV was detected in the United
States, several studies have evaluated the efficacy of vector
control, especially adulticide treatments. Palmisano et al.
(20) observed an 86% decrease (compared with a 5-year
average) in WNV-vectoring mosquitoes in 2002 resulting
from control efforts over a 4-month period in St. Tammany
Parish, Louisiana. Simpson (21) observed a 64% reduction
in WNV-carrying mosquito species measured during emergency aerial sprays in 26 Florida counties during 2004 in
response to hurricanes. Carney et al. (6) and Elnaiem et
al. (5) provided evidence of the effectiveness of the 2005
emergency aerial spray as a mosquito control measure in
Sacramento County by showing a reduction both in mosquito populations and WNV disease cases in humans.
Carney et al. (6) documented 18 total WNV disease
cases outside the spray area after the Sacramento County
emergency spray and no cases within the spray area, after
they adjusted for the maximum incubation period of the virus from infection to onset of symptoms. Of these 18 cases,
13 were diagnosed as WNF and 5 as WNND. Treating these
18 patients cost ≈$241,462. However, given the possibility
of unreported or underdiagnosed WNF cases, the spray
event may actually have prevented >18 cases (7,9,22,23).
SYMVCD activities conducted before the emergency period most likely prevented some cases.
Estimating the medical costs of WNV patients and the
true number of cases prevented by the emergency spray are
uncertain. The estimated dollar amount designated for productivity loss from WNV disease was based on the average
annual salary of a Sacramento County citizen in 2005 and
an estimated number of work days missed because of the
disease. This study does not take into account extreme cases of WNND and total number of days a patient is affected
by the disease. Therefore, the actual cost values associated
with WNV may be higher.
Our analysis may underestimate the actual cost of the
WNV outbreak. Pain and distress are difficult to estimate
monetarily but probably are important factors in the comprehensive costs of WNV disease. We also did not include
484
medical costs associated with non-WNV issues, such as
mosquito-bite allergenicity or sequelae, which are difficult
to quantify but may be substantial (24). Additionally, we
did not incorporate the benefits to the human population
of reducing the nuisance of mosquito bites, irrespective of
WNV transmission. In Jefferson County, Texas, the ratio of
the cost of the total household benefit to the program cost
for mosquito abatement was 1.8, according to a countywide study on the benefit of mosquito control in reducing
the nuisance of mosquito bites (25). In addition, the actual
number of persons affected with WNF remains unknown
because the total number of WNF cases probably was underreported and underdiagnosed (7,9). Busch et al. (26)
found 353 infections for each reported case of WNND in
North Dakota from blood screening data in 2003 compared
with CDC data indicating ≈256 WNV incident infections
for each WNND case in the United States.
We did not assess human and ecologic risks associated with the emergency spray. However, previous risk
assessments that used exposure scenarios for pyrethroids
and pyrethrins that would exceed those of the Sacramento
County emergency aerial spray have shown risks substantially below Environmental Protection Agency levels of
concern (27–34).
The total economic impact of the 2005 WNV disease
outbreak in Sacramento County was ≈$2.98 million. The
total cost of medical treatment for the outbreak was $2.28
million. The actual number of WNV disease cases prevented by the emergency spray is uncertain. However, the offset
in cost for the number of cases that may have been prevented can be compared with the costs of the vector control. If
only 34 WNF and 14 WNND cases (by using the percentages of each from the diagnoses for Sacramento County in
2005) were prevented by the spray event, ≈$702,809 would
have been averted in medical and productivity loss costs,
thus offsetting the cost of the emergency spray. Also, the
costs of the emergency spray would have been offset by
preventing only 15 WNND cases at ≈$706,833.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Cost Analysis of WNV Outbreak
Acknowledgments
We thank D. Brown, G. Goodman, and P. Macedo for providing information about the vector control costs. We also thank
J. Teague and J. Morgan for relaying the hospital cost data to us
and E. Geraghty and G. Trochet for their input. We appreciate the
assistance of the California Department of Public Health, especially C. Jean, A. Kjemtrup, V. Kramer, and M. Novak for help in
data acquisition and review of earlier manuscripts.
13.
14.
15.
16.
The research was supported by Montana State University
and the Montana Agricultural Experiment Station.
Ms Barber is an environmental consultant with Reclamation
Research Group in Bozeman, Montana. Her research interests include human and ecological risk assessment, land rehabilitation and
soil reclamation, and geographic information system applications.
17.
18.
19.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
California Department of Health Services. Division of Communicable Disease Control. West Nile activity in California, 2005 [cited
2008 Nov 28]. http://www.westnile.ca.gov/reports.php?report_category_id=8
California Department of Public Health. Mosquito and Vector Control Association of California; University of California. California
mosquito-borne virus surveillance and response plan [cited 2008
Nov 28]. http://www.westnile.ca.gov/resources.php
Centers for Disease Control and Prevention. Human West Nile virus
(WNV) cases in California, 2005 (reported as of 03/30/2006) [cited
2008 Nov 5]. http://www.westnile.ca.gov/website/maps_data/2005_
maps_data/2005%20Human%20WNV%20Case%20Linelist.pdf
Marfin AA, Gubler DJ. West Nile encephalitis: an emerging disease in the United States. Clin Infect Dis. 2001;33:1713–9. DOI:
10.1086/322700
Elnaiem DE, Kelley K, Wright S, Laffey R, Yoshimura G, Reed M,
et al. Impact of aerial spraying of pyrethrin insecticide on Culex
pipiens and Culex tarsalis (Diptera: Culicidae) abundance and
West Nile virus infection rates in an urban/suburban area of Sacramento County, California. J Med Entomol. 2008;45:751–7. DOI:
10.1603/0022-2585(2008)45[751:IOASOP]2.0.CO;2
Carney RM, Husted S, Jean C, Glaser C, Kramer V. Efficacy of
aerial spraying of mosquito adulticide in reducing incidence of West
Nile virus, California, 2005. Emerg Infect Dis. 2008;14:747–54.
DOI: 10.3201/eid1405.071347
Centers for Disease Control and Prevention. West Nile virus: clinical
description [cited 2008 Dec 15]. http://www.cdc.gov/ncidod/dvbid/
westnile/clinicians/clindesc.htm#diag
Petersen LR, Martin AA, Gubler DJ. West Nile virus. JAMA.
2003;290:524–8. DOI: 10.1001/jama.290.4.524
Centers for Disease Control and Prevention. West Nile virus: media facts [cited 2009 Mar 23]. http://www.cdc.gov/ncidod/dvbid/
westnile/resources/FightTheBite_FactSheet/MediaTools/print/
WNV%20media%20factsheet_natnl.pdf
Zohrabian A, Meltzer MI, Ratard R, Billah K, Molinari NA, Roy
K, et al. West Nile virus economic impact, Louisiana, 2002. Emerg
Infect Dis. 2004;10:1736–44.
Zohrabian A, Hayes EB, Petersen LR. Cost-effectiveness of West
Nile virus vaccination. Emerg Infect Dis. 2006;12:375–80.
State of California Department of Industrial Regulations. California
code of regulations. Title 8, CCR §9789.23. Hospital cost to charge
ratios, hospital specific outliers, and hospital composite factors
[cited 2010 Jan 15]. http://www.dir.ca.gov/dwc/OMFS_Inpatient/
OMFS_Inpatient_table9789_23.pdf
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
Bureau of Labor Statistics, US Department of Labor. Consumer
Price Index, 2003 [cited 2010 Jan 15]. http://www.bls.gov/cpi/cpid03av.pdf
Bureau of Labor Statistics, US Department of Labor. Consumer
Price Index, 2004 [cited 2010 Jan 15]. http://www.bls.gov/cpi/cpid04av.pdf
Bureau of Labor Statistics, US Department of Labor. Consumer
Price Index, 2005 [cited 2010 Jan 15]. http://www.bls.gov/cpi/cpid05av.pdf
MetLife Mature Market Institute. MetLife, Inc. The MetLife market
survey of nursing home and home care costs [cited 2008 Nov 6].
http://www.metlife.com/WPSAssets/41453139101127828650V1F2
005%20NH%20and%20HC%20Market%20Survey.pdf
Bureau of Labor Statistics, US Department of Labor. Sacramento–
Yolo, CA, National Compensation Survey, July 2005. Bulletin 3130–
48 [cited 2008 Nov 8]. http://www.bls.gov/ncs/ocs/sp/ncbl0789.pdf
Grosse SD. Appendix I. Productivity loss tables. In: Haddix AC,
Teutsch SM, Corso PS, editors. Prevention effectiveness, 2nd ed.
New York: Oxford University Press; 2003. p. 255–7.
Brown E, Beauregard K. Statistical brief #157. Regional differences
in total and out-of-pocket expenditures for selected types of officebased visits, 2004. Rockville (MD): Medical Expenditure Panel
Survey, Agency for Healthcare Research and Quality; 2007 [cited
2010 Jan 15]. http://www.meps.ahrq.gov/mepsweb/data_files/publications/st157/stat157.pdf
Palmisano CT, Taylor V, Caillouet K, Byrd B, Wesson DM. Impact
of West Nile virus outbreak upon St. Tammany Parish mosquito
abatement district. J Am Mosq Control Assoc. 2005;21:33–8. DOI:
10.2987/8756-971X(2005)21[33:IOWNVO]2.0.CO;2
Simpson JE. Emergency mosquito aerial spray response to the 2004
Florida hurricanes Charley, Frances, Ivan, and Jeanne: an overview
of control results. J Am Mosq Control Assoc. 2006;22:457–63. DOI:
10.2987/8756-971X(2006)22[457:EMASRT]2.0.CO;2
Centers for Disease Control and Prevention. Epidemic/epizootic
West Nile virus in the United States: guidelines for surveillance, prevention, and control. Reported as of 2003 Aug. Fort Collins (CO):
The Centers; 2003 [cited 2009 Mar 23]. http://www.cdc.gov/ncidod/
dvbid/westnile/resources/wnv-guidelines-aug-2003.pdf
Peleman RA. New and re-emerging infectious diseases: epidemics in waiting. Curr Opin Anaesthesiol. 2004;17:265–70. DOI:
10.1097/00001503-200406000-00012
Antwi FB, Shama LM, Peterson RKD. Risk assessments for the
insect repellents DEET and picaridin. Regul Toxicol Pharmacol.
2008;51:31–6. DOI: 10.1016/j.yrtph.2008.03.002
John KH, Stoll JR, Olson JK. An economic assessment of the benefits of mosquito abatement in an organized mosquito control district.
J Am Mosq Control Assoc. 1987;3:8–14.
Busch MP, Wright DJ, Custer B, Tobler LH, Stramer SL, Kleinman
SH, et al. West Nile virus infections projected from blood donor
screening data, United States, 2003. Emerg Infect Dis. 2006;12:395–
402.
Peterson RK, Macedo PA, Davis RS. A human-health risk assessment for West Nile virus and insecticides used in mosquito management. Environ Health Perspect. 2006;114:366–72.
Davis RS, Peterson RK, Macedo PA. An ecological risk assessment for insecticides used in adult mosquito management. Integr
Environ Assess Manag. 2007;3:373–82. DOI: 10.1897/1551-3793(2007)3[373:AERAFI]2.0.CO;2
Schleier JJ III, Macedo PA, Davis RS, Shama LM, Peterson RKD.
A two-dimensional probabilistic acute human-health risk assessment
of insecticide exposure after adult mosquito management. Stochastic
Environ Res Risk Assess. 2009;23:555–63. DOI: 10.1007/s00477008-0227-5
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
485
RESEARCH
30.
31.
32.
486
Schleier JJ III, Davis RS, Barber LM, Macedo PA, Peterson RK.
A probabilistic risk assessment for deployed military personnel
after the implementation of the “Leishmaniasis Control Program”
at Tallil Air Base, Iraq. J Med Entomol. 2009;46:693–702. DOI:
10.1603/033.046.0337
Schleier JJ III, Peterson RK, Macedo PA, Brown DA. Environmental concentrations, fate, and risk assessment of pyrethrins and piperonyl butoxide after aerial ultralow-volume applications for adult
mosquito management. Environ Toxicol Chem. 2008;27:1063–8.
DOI: 10.1897/07-532.1
Suffolk County Department of Public Works and Department of
Health Services. Draft generic environmental impact statement [cited 2009 Mar 1]. http://www.suffolkmosquitocontrolplan.org/tasks/
task14.html
33.
34.
Carr WC, Iyer P, Gammon DW. A dietary risk assessment of the
pyrethroid insecticide resmethrin associated with its use for West
Nile virus mosquito vector control in California. Scientific World
Journal. 2006;6:279–90. DOI: 10.1100/tsw.2006.56
New York City Department of Health. Adult mosquito control programs: environmental impact statement (EIS). New York: The Department; 2001 [cited 2009 Mar 1]. http://www.nyc.gov/html/doh/
html/wnv/feis.shtml
Address for correspondence: Robert K.D. Peterson, Montana State
University, 334 Leon Johnson Hall, PO Box 173120, Bozeman, MT
59717-3120, USA; email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Paenibacillus
larvae Bacteremia
in Injection
Drug Users
Siegbert Rieg, Tilman Martin Bauer,
Gabriele Peyerl-Hoffmann, Jürgen Held,
Wolfgang Ritter, Dirk Wagner,
Winfried Vinzenz Kern, and Annerose Serr
Paenibacillus larvae causes American foulbrood in
honey bees. We describe P. larvae bacteremia in 5 injection drug users who had self-injected honey-prepared
methadone proven to contain P. larvae spores. That such
preparations may be contaminated with spores of this organism is not well known among pharmacists, physicians,
and addicts.
A
s a consequence of needle sharing and repeated parenteral administration of nonsterile material, injection
drug users risk becoming ill from a variety of infections,
including HIV, hepatitis C, endocarditis, and skin and soft
tissue infections (1). Febrile episodes in injection drug users
are common, yet distinguishing between febrile reactions
caused by toxins or impurities in the injected substance and
true infections may be difficult (2,3). Methadone hydrochloride, which is widely used for opioid substitution, can
be mixed with viscous substances such as syrup to yield
a solution that is not suitable for misuse through self-injection. Methadone syrup is intended to be taken only as
an oral medication. Some pharmacies use honey instead of
syrup to prepare such a solution.
Paenibacillus larvae is a spore-forming gram-positive
microorganism known for its ability to cause American
foulbrood, a severe and notifiable disease of honey bees
(Apis mellifera) (4) (Figure). P. larvae is endemic to bee
colonies worldwide. The organism can be cultured from
<10% of honey samples from Germany but from >90% of
samples from honeys imported from other countries (5). P.
larvae spores are highly resilient and can survive in honey
for years (6,7). We describe P. larvae bacteremia in 5 patients who had a history of intravenous drug abuse and were
in a program of opioid substitution that used methadone.
Author affiliations: University Hospital, Freiburg, Germany (S. Rieg,
T.M. Bauer, G. Peyerl-Hoffman, J. Held, D. Wagner, W.V. Kern, A.
Serr); and Reference Laboratory of the World Organisation for Animal Health, Freiburg (W. Ritter)
DOI: 10.3201/eid1603.091457
The Study
All patients sought treatment for fever ranging from
37.8°C to 39.8°C and admitted to continuing to inject illicit
drugs or methadone. Information about patient characteristics, clinical signs and symptoms, laboratory and micobiologic investigations, and treatment details are summarized in the Table. P. larvae was identified in blood cultures
(BacT/ALERT 3D-System; bioMérieux, Marcy l’Etoile,
France) of each patient described. The clinical course of
P. larvae bacteremia was benign in 3 patients, and complications developed in 2 patients. Patient 1 had relapsing
disease and spontaneous bacterial peritonitis; patient 4 had
pulmonary embolism without definite evidence of septic embolism. Patients 2 and 3 recovered without specific
antimicrobial drug treatment; for patients 4 and 5, defervescence and negative follow-up blood cultures were observed after they received treatment with β-lactam agents
(imipenem or cefuroxime). The recurrent P. larvae infection observed in patient 1 was probably the consequence of
repeated injection of contaminated methadone rather than
an inadequate response to antimicrobial drug therapy.
In 2 cases, culture of the honey used to prepare methadone or of honey-containing ready-to-use methadone also
yielded P. larvae. Honey and methadone samples were diluted in sterile phosphate-buffered saline and cultured with
or without heat pretreatment (90°C, 10 min) under aerobic
and anaerobic conditions at 37°C for 3–4 days by using
Columbia blood agar and MYPGD (Mueller-Hinton broth,
yeast extract, potassium phosphate, glucose, pyruvate)
agar. Colonies from positive blood or honey or methadone
cultures with an appropriate macroscopic appearance and
gram-stain morphology as well as negative catalase reaction were further identified by PCR amplification and 16S
rRNA gene sequencing according to published protocols
(8). Obtained sequences were analyzed by using the BLAST
algorithm (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Conclusions
We detected P. larvae in sterile compartments of 5
patients with clinical and laboratory evidence of infection.
Given the fact that all patients were injection drug users,
the mode of infection was thought to be intravenous administration of contaminated methadone, resulting in P. larvae
bacteremia. Our hypothesis is supported by the isolation
of P. larvae from honey or honey-containing methadone
provided to 2 patients.
Recently, several Paenibacillus species have been reported to cause bacteremic infections in humans. Among
these are P. thiaminolyticus (bacteremia in a patient undergoing hemodialysis) (9), P. konsidensis (bacteremia in a
febrile patient with hematemesis) (10), P. alvei (prosthetic
joint infection with bacteremia) (11), and P. polymyxa (bacteremia in a patient with cerebral infarction) (12). Further-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
487
DISPATCHES
Figure. Paenibacillus larvae gram-positive, spore-forming, rod-shaped bacteria (A) (Gram stain, original magnification ×1,000) with the
ability to form giant whips upon sporulation (B) (nigrosine stain, original magnification ×1,000). In American foulbrood (AFB), newly hatched
honey bee larvae become infected through ingestion of brood honey containing P. larvae spores. After germination and multiplication,
infected bee larvae die within a few days and are decomposed to a ropy mass, which releases millions of infective spores after desiccation.
C) AFB-diseased larvae are beige or brown in color and have diminished segmentation (healthy and AFB-diseased larvae). D) Clinical
diagnosis of AFB can be made by a matchstick test, demonstrating the viscous, glue-like larval remains adhering to the cell wall.
more, the novel species P. massiliensis, P. sanguinis, and
P. timonensis were isolated from blood cultures of patients
with carcinoma, interstitial nephropathy, and leukemia,
respectively (13). Pseudobacteremia of P. hongkongensis
and P. macerans has been reported (14,15).
Several aspects provide strong evidence for a genuine P. larvae bacteremia in the cases described here. First,
the present cases were observed over a period of several
years, and detection of P. larvae thus occurred in different charges of blood culture bottles, which argues against
pseudobacteremia. Second, isolation of P. larvae was
reported independently by 2 microbiology laboratories,
making contamination highly unlikely. Third, in patient 1
isolation succeeded at different times and in samples of different compartments. Moreover, the detection of P. larvae
in honey-prepared methadone and honey strongly suggests
genuine bacteremia as a consequence of injection of contaminated material.
488
Biochemical and molecular identification of P. larvae
may be difficult and time-consuming. Misinterpretation of
blood culture results because of incomplete differentiation
or confusion with other gram-positive spore forming-bacteria (e.g., Bacillus species) has to be taken into consideration. Underestimation of the frequency of true P. larvae
bacteremia therefore cannot be excluded. Thus, infectious
disease physicians, microbiologists, and pharmacists need
to be aware that injection of material contaminated with
P. larvae, such as honey-prepared methadone, may cause
bacteremic infection.
Dr Rieg is an infectious diseases fellow at the University
Medical Center in Freiburg, Germany. His research interests focus on innate defense antimicrobial peptides and Staphylococcus
aureus infections.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
P. larvae Bacteremia
Table. Patient characteristics, clinical presentation, treatment, and laboratory and microbiologic results of 5 patients with Paenibacillus
larvae bacteremia*
Patient no.
Characteristic
1
2
3
4
5
Age, y/sex
28/F
32/M
20/M
35/M
27/F
Date evaluated
2003 Jul
2003 Sep
2003 Oct
2004 Feb
2008 May
Clinical samples with
Culture of ascites
Blood culture
Blood culture
Blood culture
Blood culture
identification of P. larvae†
(2003 Jul), blood
culture (2003 Aug)
CRP, mg/L
43
17
11
37
40
9
23.0
13.0
9.3
11.8
19.2
Leukocyte count, × 10 /L
Medical history
IVDA, hepatitis C,
IVDA, hepatitis C,
IVDA, hepatitis
IVDA, hepatitis C,
IVDA, hepatitis C,
hepatitis B
C
alcohol abuse
Child B liver cirrhosis
history of hepatitis
with refractory ascites
A
Clinical signs and
Decompensated liver
Persistent
Somnolence,
Tachypnoe, rightSevere anemia,
symptoms
fever (38.2°C) sided pleuritic chest
cirrhosis, ascites,
weakness and
spontaneous
fever (39.2°C)
pain, fever (37.8°C) mucosal bleeding,
malaise, fever
(39.2°C)
fever (39.8°C)
Subsequently
Methadone/
Pulmonary
Acute hepatitis B
Clinical conditions other
Bacterial peritonitis,
than bacteremia
diazepam
embolism, infarction diagnosed with ITP,
diagnosed 1 mo
hepatic
overdose
pneumonia, deep
encephalopathy after before bacteremia,
Paracoccus yeei
vein thrombosis
eosinophilia
TIPS placement
and Micrococcus
luteus bacteremia
Treatment (duration)
Meropenem (7 d)
None
None
Cefuroxim IV (7 d)
Imipenem (21 d)
followed by ampicillin
IV (2 d), then
meropenem (7 d)
followed by penicillin
G (14 d)
*CRP, C-reactive protein (reference range <5 mg/L); IVDA, intravenous drug abuse; TIPS, transjugular intrahepatic portosystemic shunt; ITP, idiopathic
thrombocytopenic purpura; IV, intravenous.
†P. larvae identified after culture using 16S rRNA gene sequencing.
10.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
Irish C, Maxwell R, Dancox M, Brown P, Trotter C, Verne J, et al.
Skin and soft tissue infections and vascular disease among drug users, England. Emerg Infect Dis. 2007;13:1510–1.
Hopper JA, Shafi T. Management of the hospitalized injection drug
user. Infect Dis Clin North Am. 2002;16:571–87. DOI: 10.1016/
S0891-5520(02)00009-0
Levine DP, Brown PD. Infections in injection drug users. In: Mandell GL, Bennett JE, Dolin R, editors. Principles and practice of infectious diseases, 6th ed. New York:; Elsevier 2005. p. 3462–76.
de Graaf DC, Alippi AM, Brown M, Evans JD, Feldlaufer M,
Gregorc A, et al. Diagnosis of American foulbrood in honey bees:
a synthesis and proposed analytical protocols. Lett Appl Microbiol.
2006;43:583–90. DOI: 10.1111/j.1472-765X.2006.02057.x
Ritter W. Early detection of American foulbrood by honey and wax
analysis. Apiacta. 2003;38:125–30.
Von der Ohe W, Dustmann JH. Efficient prophylactic measures
against American foulbrood by bacterial analysis of honey for spore
contamination. Am Bee J. 1997;8:603–6.
Hasemann L. How long can spores of American foulbrood live? Am
Bee J. 1961;101:298–9.
Sander A, Ruess M, Bereswill S, Schuppler M, Steinbrueckner B.
Comparison of different DNA fingerprinting techniques for molecular typing of Bartonella henselae isolates. J Clin Microbiol.
1998;36:2973–81.
Ouyang J, Pei Z, Lutwick L, Dalal S, Yang L, Cassai N, et al. Case
report: Paenibacillus thiaminolyticus: a new cause of human infection, inducing bacteremia in a patient on hemodialysis. Ann Clin Lab
Sci. 2008;38:393–400.
11.
12.
13.
14.
15.
Ko KS, Kim YS, Lee MY, Shin SY, Jung DS, Peck KR, et al. Paenibacillus konsidensis sp. nov., isolated from a patient. Int J Syst Evol
Microbiol. 2008;58:2164–8. DOI: 10.1099/ijs.0.65534-0
Reboli AC, Bryan CS, Farrar WE. Bacteremia and infection
of a hip prosthesis caused by Bacillus alvei. J Clin Microbiol.
1989;27:1395–6.
Nasu Y, Nosaka Y, Otsuka Y, Tsuruga T, Nakajima M, Watanabe Y,
et al. A case of Paenibacillus polymyxa bacteremia in a patient with
cerebral infarction. Kansenshogaku Zasshi. 2003;77:844–8.
Roux V, Raoult D. Paenibacillus massiliensis sp. nov., Paenibacillus
sanguinis sp. nov. and Paenibacillus timonensis sp. nov., isolated
from blood cultures. Int J Syst Evol Microbiol. 2004;54:1049–54.
DOI: 10.1099/ijs.0.02954-0
Noskin GA, Suriano T, Collins S, Sesler S, Peterson LR. Paenibacillus macerans pseudobacteremia resulting from contaminated blood
culture bottles in a neonatal intensive care unit. Am J Infect Control.
2001;29:126–9. DOI: 10.1067/mic.2001.111535
Teng JL, Woo PC, Leung KW, Lau SK, Wong MK, Yuen KY.
Pseudobacteraemia in a patient with neutropenic fever caused by a
novel paenibacillus species: Paenibacillus hongkongensis sp. nov.
Mol Pathol. 2003;56:29–35. DOI: 10.1136/mp.56.1.29
Address for correspondence: Siegbert Rieg, Center for Infectious Diseases
and Travel Medicine, University Hospital Freiburg, Hugstetter Strasse 55,
D-79106 Freiburg, Germany; email: [email protected]
The opinions expressed by authors contributing to this journal do
not necessarily reflect the opinions of the Centers for Disease Control and Prevention or the institutions with which the authors are
affiliated.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
489
DISPATCHES
Rickettsia
helvetica in Patient
with Meningitis,
Sweden, 2006
Kenneth Nilsson, Karin Elfving, and Carl Påhlson
Pathogenicity of Rickettsia helvetica is relatively unknown. We isolated a spotted fever group rickettsial organism from a patient with subacute meningitis. Nucleotide
sequences of the 16S rRNA, ompB, and 17kDa genes
identified the isolate as R. helvetica. This organism may be
associated with serious infections such as central nervous
system disorders.
ickettsia helvetica, a member of the spotted fever group
rickettsiae (SFGR), has been isolated from Ixodes ricinus ticks in many European and Asian countries. Although
I. ricinus ticks are the main vector and natural reservoir, the
organism has recently been found in Dermacentor reticulates ticks (1–5). Serosurveys have found antibodies reactive to R. helvetica in 1.9%–12.5% of the population in Lao
People’s Democratic Republic, France, Italy, Denmark,
and Sweden (1,4,6–8). The organism has mainly been considered nonpathogenic; several patients with a serologic
diagnosis have had mild, self-limited disease with associated fever, headache, and myalgia. However, a more severe
clinical disease has been demonstrated (1,9).
It is well known that Q fever and the rickettsial diseases typhus and spotted fever may cause central nervous
system infection and that, of the SFGR, R. rickettsii, R.
conorii, and R. japonica have a documented association
with meningitis (10,11). We document a case of subacute
meningitis caused by R. helvetica. The study was reviewed
and approved by the Ethics Committee, Uppsala University, Sweden.
R
The Case
In September 2006, a 56-year-old woman was hospitalized in Falun, Sweden, after 3 weeks of illness with gradually worsening headache and fever. She had no lymphadenopathy, rash, eschar, or history of tick bite or tick exposure.
Radiographs showed a small, retrocardial pulmonary infiltrate, but the patient had few, if any, respiratory symptoms.
Author affiliations: Uppsala University Hospital, Uppsala, Sweden
(K. Nilsson, K. Elfving,); Mälardalens University, Eskilstuna, Sweden (C. Påhlson); Center of Clinical Research Dalarna, Falun, Sweden (K. Nilsson); and Falu Hospital, Falun (K. Nilsson, K. Elfving)
DOI: 10.3201/eid1603.090184
490
Laboratory tests showed elevated C-reactive protein (56–
128 mg/L), slightly elevated to reference-level leukocyte
count (9,800–12,000 cells/μL), slightly low thrombocyte
count (150,000 cells/μL), and reference values of hemoglobin and of aspartate and alanine aminotransferases.
Cerebrospinal fluid (CSF) showed a slight pleocytosis (28
cells × 108/L, of which 18 ×108/L were mononuclear cells)
but was otherwise within reference limits. CSF was stored
at –20°C in a regular freezer and thawed only when used
1 year later. Negative results were obtained for blood and
CSF cultures and for investigation for herpesviruses, tickborne encephalitis, and enteroviruses. Urine was negative
for Legionella and pneumococcal antigens, and serum was
negative for antibodies against Borrelia burgdorferi. Computed tomography images of the brain and sinuses were
unremarkable.
Intravenous administration of cefuroxime had no effect
on the fever. Because atypical pneumonia was suspected,
treatment was changed after 3 days to doxycycline (100 mg
2×/day). After 2–3 days the patient’s fever was gone, and
she slowly recovered. The treatment was continued for 10
days. At a follow-up visit 1 year later, the patient was still
well but had been asthenic for several months. No antibodies against Mycoplasma pneumoniae or Coxiella burnetii
were found at the follow-up visit, and no other possible
causative agent was confirmed. After giving informed consent, the patient was retrospectively included in an ongoing
project that involved searching for fastidious organisms.
The patient’s previously frozen CSF was divided into
2 aliquots; bacterial DNA was extracted by using a MagNa
Pure Kit (Roche Diagnostics GmbH, Mannheim, Germany)
according to the manufacturer’s instructions. A genus-specific real-time PCR, as described by Stenos et al. (12), was
used to detect SFGR. The PCR was performed in a Lightcycler 1.0 Real-Time PCR System (Roche Diagnostics GmbH)
by using an LC Taqman Master Kit (Roche Diagnostics
GmbH), primers, and TaqMan probe targeting the citrate
synthase gene (12). To minimize risk for contamination,
0.25 μL LC uracil-DNA glycosylase (Roche Diagnostics
GmbH) was included in each reaction. The positive control
contained purified DNA of R. helvetica originally isolated
from a domestic I. ricinus tick (3); the negative control contained sterile water. Positive samples were further analyzed
by using 3 nested PCRs that amplify the 17kDa, outer membrane protein B (ompB), and 16S rRNA gene fragments as
previously described (3,13,14) (Table). Amplification was
conducted in a DNA thermal cycler (Hybaid, Ashford, UK)
and a MJ Mini Gradient Thermal Cycler (Bio-Rad, Hercules, CA, USA), and expected fragment sizes were confirmed
by gel electrophoresis in 2% agarose. Direct cycle sequencing analysis of both strands of nested PCR products was
performed at the Center for Genomics and Bioinformatics,
Karolinska Institutet, Stockholm, Sweden.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
R. helvetica in Patient with Meningitis
Rickettsial DNA was amplified by real-time PCR from
both CSF aliquots. Positive samples were further examined
by using nested PCRs. The sequences obtained were 165
(17 kDa) and 253 bp (ompB) and shared 100% similarity with the corresponding gene sequences of R. helvetica
(GenBank accession nos. EU407139, EU407140).
To isolate the pathogen, we injected CSF from the
frozen aliquot in volumes of 10 μL in a 25-cm3 flask into
confluent monolayers of Vero cells and 80 μL in the other
(15). After incubation, the cell culture was maintained in
Dulbecco modified Eagle medium containing 10% fetal
calf serum and kept in a humid cell chamber in 5% CO2,
at 32°C, to allow rickettsiae to multiply. All cell lines and
reagents were checked weekly for growth or bacterial contamination. Detection of growing rickettsiae was monitored
by using Gimenez staining and an immunofluorescence assay of cells collected after centrifuging the medium and
staining with rabbit antirickettsial hyperimmunserum and
Alexa Fluor 488 goat antirabbit immunoglobulin (Ig) G
(H+L) conjugate (Invitrogen, Carlsbad, CA, USA) as secondary antibody (Figure).
After 6 weeks, many intracellular bacteria were observed in the cells. Rickettsial DNA was verified by realtime PCR (12). The sequences obtained by nested PCR for
the 17kDa and ompB genes in the isolate grown in Vero
cells were identical to the sequences of the isolates obtained
from the CSF (3,13,14). Amplification and partial sequencing of the 16S ribosomal RNA gene of the isolate produced
fragments of 1,400 and 750 bp, respectively, which were
100% homologous to fragments of the deposited 16S ribosomal DNA sequence of R. helvetica from ticks (GenBank
accession no. L36212).
SFGR antigen prepared from isolates grown in Vero
cells of R. helvetica from an I. ricinus tick and from the
patient was applied to each well of microscope slides. The
antigen was dried, fixed in acetone, and incubated with serial dilutions of serum or CSF, as previously described (7).
The positive control was serum from a patient with proven
Mediterranean spotted fever and end-point IgG titers of
160 (provided by the Swedish Institute for Infectious Disease Control); the negative control was phosphate-buffered
Figure. Rickettsiae in infected Vero cells. Sample from cerebrospinal
fluid of patient with subacute meningitis, Sweden, 2006. Gimenez
stain; original magnification ×1,000.
saline and serum from 3 healthy blood donors. IgG was detected by fluorescein isothiocyanate–conjugated γ-chain–
specific polyclonal rabbit antihuman IgG (DakoCytomation A/S, Glostrup, Denmark). Microimmunofluorescence
assay showed IgG end titers of 160 and 320 in the earlyphase serum sample when the isolates of R. helvetica from
tick and patient, respectively, were used as antigens. No
antirickettsial IgG was detected in CSF when either isolate
was used as antigen.
Conclusions
For patients with fever and headache but no rash or
eschar, diagnosis is difficult and can probably not be based
only on epidemiologic, clinical, and standard laboratory
criteria. It therefore seems that in SFGR-endemic areas,
SFGR should routinely be included in the differential diagnosis of cause of meningitis. Appropriate antimicrobial
drug therapy is essential for prompt recovery and prevention of complications.
SFGR isolation is usually not available in ordinary
hospital laboratories and is too time-consuming to be a di-
Table. Selected inner primers and probe used to amplify genes from cerebrospinal fluid of patient with subacute meningitis, Sweden,
2006*
Gene
Primers and probe
Nucleotide sequences, 5ƍ ĺ 3ƍ
Product size, bp
ompB-IF
CCAATGGCAGGACTTAGCTACT
267
ompB
ompB-IR
AGGCTGGCTGATACACGGAGTAA
17 kDa
RH 17-IF
GCATTACTTGGTTCTCAATTGG
214
RH 17-IR
AACCGTAATTGCCGTTATCCGG
16SrDNA
Ric-F
TCTAGAACGAACGCTATCGGTAT
757
Ric-R
TTTCATCGTTTAACGGCGTGGACT
gltA
SFG-CS-F
TGCCAAATGTTCACGGTACTTT
74
SFG-CS-R
CACAATGGAAAGAAATGCACGA
SFG-CS-Probe
TGCAATAGCAAGAACCGTAGGCTGGATG
*ompB, outer membrane protein B; gtlA, citrate synthase.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
491
DISPATCHES
agnostic alternative in clinical settings. Although this patient’s CSF had been stored in a regular freezer for 1 year,
the rickettsial organisms were still viable.
PCR seems to be the most practical way to diagnose a
suspected central nervous system disorder such as meningitis. The amplified nucleotide sequences were long enough
to exclude other related rickettsial species. For example,
the differences from other related rickettsiae were 10 and 5
nt for the R. monacensis 17kDa and ompB gene fragments,
respectively, and 8 nt for R. slovaca ompB. Our study suggests that R. helvetica may cause infection of the CNS.
When seeking to diagnose possible agents of meningitis,
the usefulness of PCR and the relevance of the broader
clinical spectrum of acute febrile illness caused by R. helvetica should be considered.
5.
6.
7.
8.
9.
10.
The study was supported in part by grants from the Center of
Clinical Research Dalarna (project no. 9028).
11.
Dr Nilsson is a physician who works in infectious disease
medicine and clinical microbiology at Uppsala University Hospital. His research interests include the clinical, diagnostic, and
epidemiologic features of rickettsioses.
12.
References
14.
Fournier PE, Grunnenberger F, Jaulhac B, Gastinger G, Raoult. D.
Evidence of Rickettsia helvetica infection in humans, eastern France.
Emerg Infect Dis. 2000;6:389–92. DOI: 10.3201/eid0604.000412
2. Fournier PE, Fujita H, Takada N, Raoult D. Genetic identification of rickettsiae isolated from ticks in Japan. J Clin Microbiol.
2002;40:2176–81. DOI: 10.1128/JCM.40.6.2176-2181.2002
3. Nilsson K, Jaenson TG, Uhnoo I, Lindquist O, Pettersson B, Uhlén
M, et al. Characterization of a spotted fever group Rickettsia from
Ixodes ricinus ticks in Sweden. J Clin Microbiol. 1997;35:243–7.
4. Parola P, Raoult D. Ticks and tickborne bacterial diseases in humans:
an emerging infectious threat. Clin Infect Dis. 2001;32:897–928.
DOI: 10.1086/319347
13.
1.
492
15.
Dobec M, Golubic D, Punda-Polic V, Kaeppeli F, Sievers F. Rickettsia helvetica in Dermacentor reticulates ticks. Emerg Infect Dis.
2009;15:98–100. DOI: 10.3201/eid1501.080815
Phongmany S, Rolain JC, Phetsouvanh R, Blacksell S, Soukhaseum
V, Rosachack B, et al. Rickettsial infections and fever, Vientiane,
Laos. Emerg Infect Dis. 2006;12:256–8.
Elfving K, Lindblom A, Nilsson K. Seroprevalece of Rickettsia spp. infection among tick-bitten patients and blood donors in Sweden. Scand J Infect Dis. 2008;40:74–7. DOI:
10.1080/00365540701509907
Nielsen H, Fournier PE, Pedersen IS, Krarup H, Ejlertsen T,
Raoult D. Serological and molecular evidence of Rickettsia helvetica in Denmark. Scand J Infect Dis. 2004;36:559–63. DOI:
10.1080/00365540410020776
Nilsson K. Septicaemia with Rickettsia helvetica in a patient with
acute febrile illness, rash and myasthenia. J Infect. 2009;58:79–82.
Epub 2008 Jul 22. DOI: 10.1016/j.jinf.2008.06.005
Araki M, Takatsuka K, Kawamura J, Kanno Y. Japanese spotted fever Involving the central nervous system: two case reports and a
literature review. J Clin Microbiol. 2002;40:3874–6. DOI: 10.1128/
JCM.40.10.3874-3876.2002
Gűnther G, Haglund M. Tick-borne encephalopathies: epidemiology, diagnosis, treatment and prevention [review]. CNS Drugs.
2005;19:1009–32.
Stenos J, Graves S, Unsworth N. A highly sensitive and specific realtime PCR assay for the detection of spotted fever and typhus group
rickettsiae. Am J Trop Med Hyg. 2005;73:1083–5.
Choi YJ, Lee SH, Park KH, Koh YS, Lee KH, Baik HS, et al.
Evaluation of PCR-based assay for diagnosis of spotted fever group
rickettsiosis in human serum samples. Clin Diagn Lab Immunol.
2005;12:759–63.
Leitner M, Yitzhaki S, Rzotkiewicz S, Keysari A. Polymerase chain
reaction-based diagnosis of Mediterranean spotted fever in serum
and tissue samples. Am J Trop Med Hyg. 2002;67:166–9.
La Scola B, Raoult D. Diagnosis of Mediterranean spotted fever by
cultivation of Rickettsia conorii from blood and skin samples using
the centrifugation shell-vial technique and by detection of Rickettsia
conorii in circulating endothelial cells, a 6 year follow-up. J Clin
Microbiol. 1996;34:2722–7.
Address for correspondence. Kenneth Nilsson, Department of Clinical
Microbiology, Uppsala University Hospital, SE-751 85 Uppsala, Sweden;
email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Rare Influenza A
(H3N2) Variants
with Reduced
Sensitivity to
Antiviral Drugs
Clyde Dapat,1 Yasushi Suzuki,1 Reiko Saito,
Yadanar Kyaw, Yi Yi Myint, Nay Lin,
Htun Naing Oo, Khin Yi Oo, Ne Win,
Makoto Naito, Go Hasegawa, Isolde C. Dapat,
Hassan Zaraket, Tatiana Baranovich,
Makoto Nishikawa, Takehiko Saito,
and Hiroshi Suzuki
In 2007 and 2008 in Myanmar, we detected influenza
viruses A (H3N2) that exhibited reduced sensitivity to both
zanamivir and amantadine. These rare and naturally occurring viruses harbored a novel Q136K mutation in neuraminidase and S31N mutation in M2.
A
damantanes and neuraminidase inhibitors (NAIs)
are the 2 classes of drugs indicated for preventing or
treating influenza virus infection. In 2005, the high prevalence of influenza viruses A (H3N2) with S31N mutation
in M2 limited the effectiveness of amantadine (1,2). In
2008, the emergence of subtype H1N1 with H274Y mutation in neuraminidase (NA) raised concerns about the use
of oseltamivir (3,4). On the other hand, the incidence of
zanamivir-resistant viruses was low (5). In 1998, 1 case of
zanamivir-resistant influenza B virus, which was isolated
from an immunocompromised child who underwent prolonged zanamivir treatment, was reported (6). In 2008, subtype H3N2 with D151A/V mutations in NA demonstrated
reduced zanamivir sensitivity by chemiluminescent NAI
assay (5). Recently, zanamivir-resistant subtype H1N1 isolates with a novel Q136K mutation in NA were isolated in
Oceania and Southeast Asia (7).
Author affiliations: Niigata University, Niigata, Japan (C. Dapat, Y.
Suzuki, R. Saito, M. Naito, G. Hasegawa, I.C. Dapat, H. Zaraket,
T. Baranovich, H. Suzuki); National Institute of Animal Health, Tsukuba City, Japan (T. Saito); Niigata Prefectural Institute of Public
Health and Environmental Sciences, Niigata (M. Nishikawa); Sanpya Hospital, Yangon, Myanmar (Y. Kyaw); National Health Laboratory, Yangon (K.Y. Oo, N. Win); and Central Myanmar Department
of Medical Research, Nay Pyi Taw, Myanmar (Y.Y. Myint, N. Lin,
H.N. Oo)
DOI: 10.3201/eid1603.091321
We report the detection of influenza viruses A (H3N2)
harboring a Q136K mutation in NA and an S31N mutation
in M2, which respectively confer reductions in zanamivir
and amantadine susceptibility. In 2007 and 2008, we performed phenotypic and genotypic analyses in characterizing these viruses from Myanmar.
The Study
Nasopharyngeal swabs were collected from patients
with influenza-like illness at Sanpya Hospital in Yangon,
Myanmar, and outpatient clinics affiliated with the Department of Medical Research (Central Myanmar) in Nay Pyi
Taw. Rapid test kit–positive samples were sent to Niigata
University, Japan, for subsequent analyses. Virus isolation and subtyping PCR were performed as previously described (8). The NAI susceptibility test was performed by
a fluorescence-based NA activity assay that measures the
50% inhibitory concentration (IC50) by using zanamivir and
oseltamivir carboxylate (9). All samples were assayed in
duplicates in >2 independent experiments. A sample was
considered an extreme outlier if its IC50 value was 10×
higher than the mean values for sensitive strains with >3
interquartile range from the 25th and 75th percentiles in
the box-and-whisker plot analysis (9). So far, all known
NAI-resistant viruses are extreme outliers (10). Screening
for S31N mutation in M2 was done by cycling probe realtime PCR (11). Sequencing and phylogenetic analysis of
the hemagglutinin (HA) and NA genes were performed as
previously described (8).
A total of 253 and 802 rapid test kit–positive samples
were collected in Myanmar in 2007 and 2008, respectively. Of these, 64 isolates of subtype H3N2 were detected
in 2007 and 211 in 2008. NAI susceptibility assay showed
1 (1.5%) isolate (A/Myanmar/M187/2007) with a zanamivir IC50 value of 59.72 nM, which was collected in August
2007, and 1 (0.5%) isolate (A/Myanmar/M114/2008) with
a zanamivir IC50 of 33.37 nM, which was collected in July
2008. These isolates respectively demonstrated a 53× and
30× reduction in zanamivir susceptibility (Table) and were
extreme outliers (data not shown). On the basis of cycling
probe real-time PCR assay, these viruses had an S31N mutation in M2, which confers resistance to amantadine. All
subtype H3N2 viruses analyzed in this study remain sensitive to oseltamivir carboxylate (Table).
Phylogenetic analysis of the HA and NA genes showed
that the isolates with reduced sensitivity to zanamivir belonged to 2 distinct clusters (Figure 1). These viruses accumulated 2 and 3 amino acid (aa) substitutions in HA and
6 and 2 aa changes in NA in 2007 and 2008 (Figure 1),
respectively. Epidemiologic and sequencing data did not
suggest any link between the cases. Analysis of the NA
1
These authors contributed equally to this article.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
493
DISPATCHES
Table. Characteristics of subtype H3N2 influenza viruses with Q136K mutation in NA and S31N substitution in M2*
IC50s of NA inhibitors
Passage
NA
Amantadine sensitivity†
Zanamivir,
Fold
Oseltamivir,
Fold
Strains
history
mutation
(M2 mutation)
nM ± SD
change
nM ± SD
change
All NAI-sensitive subtype
MDCK2
None
1.12 ± 0.40
1
0.86 ± 0.44
1
Resistant (S31N)
H3N2 isolates‡
A/Myanmar/M187/2007
MDCK2
Q136K
59.72 ± 3.83
53.3
0.13 ± 0.05
0.2
Resistant (S31N)
A/Myanmar/M114/2008
MDCK2
Q136K
33.37 ± 7.02
29.8
0.16 ± 0.03
0.2
Resistant (S31N)
A/Texas/131/2002§
None
1.43 ± 0.09
1.3
0.99 ± 0.09
1.2
Sensitive
A/Texas/131/2002_E119V§
E119V
5.43 ± 0.68
4.8
94.33 ± 2.06
109.7
Sensitive
*NA, neuraminidase;IC50, inhibitory concentration; NAI, neuraminidase inhibitors.
†Amantadine sensitivity was based on M2 genotyping data.
‡Average IC50 was calculated excluding the control viruses (n = 47).
§Reference strains used as drug-sensitive and -resistant control viruses in the NAI assay.
gene showed that the isolates with reduced sensitivity to
zanamivir had a glutamine (Q) to lysine (K) substitution at
aa position 136. Sequence chromatograms showed a heterogeneous population of virus possessing either Q or K
at position 136, with a dominant peak for the K136 mutant
(Figure 2). Direct sequencing of primary samples showed
a similar profile of chromatogram with a higher signal for
the K136 mutant and a minor peak for the Q136 wild-type
strain (Figure 2). The rest of the zanamivir-sensitive isolates in 2007 and 2008 had the Q136 genotype, and no
NAI-resistant-associated mutations were detected elsewhere in the NA gene.
Conclusions
In this study, we detected a novel influenza virus A
(H3N2) with Q136K mutation in NA and S31N mutation
in M2, which demonstrated reduced susceptibility to both
zanamivir and amantadine but remained susceptible to
oseltamivir. These Q136K viruses were isolated at a low
frequency (<1.5%) in Myanmar in 2007 and 2008. Phylogenetic analysis showed that these viruses were already
amantadine-resistant with S31N mutation in M2. Amantadine-resistant viruses with S31N mutation have been the
predominant circulating strains among subtype H3N2 viruses in Myanmar since 2005 (8). The Q136K substitution
in NA was probably generated by spontaneous point mutation. The HA and NA gene sequences of Q136K mutants
Figure 1. Phylogenetic analysis of the A) hemagglutinin (HA) and B) neuraminidase (NA) genes of influenza virus A (H3N2) isolates in
Myanmar in 2007 and 2008. Trees were generated by using the neighbor-joining method. Bootstrap values >70% of 1,000 replicates and
amino acid changes that characterize a branch are indicated on the left side of the node. Amantadine-resistant isolates with S31N mutation
in M2 are marked with asterisks, and isolates with reduced sensitivity to zanamivir with Q136K mutation in NA are marked with squares.
GenBank accession no. of the genomic sequences of isolates are GQ478849–GQ478866. Nucleotide sequences of the HA and NA genes
of vaccine strains and isolates from other countries were obtained from the National Center for Biotechnology Information Influenza Virus
Resource (www.ncbi.nlm.nih.gov/genomes/FLU). Scale bar indicates nucleotide substitutions per site.
494
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Rare Influenza (H3N2) Variants
A/Myanmar/M114/2008
A/Myanmar/M187/2007
Primary
samples
A
A
C
C
Figure 2. Detection of Q136K substitution
in neuraminidase by sequencing in
primary samples and virus isolates.
Arrows indicate the first peak of the
codon encoding amino acid position
136. Comparison of the sequence
chromatogram showed a mixed population
of bases in both original clinical samples
and virus isolates, with a dominant peak
for 136K (AAG) mutants, compared with
wild-type 136Q (CAG) viruses.
Virus
isolates
A
A
C
were submitted to GenBank under accession nos. A/Myanmar/M187/2007: FJ229893 (HA), FJ229860 (NA) and
A/Myanmar/M114/2008: GQ478854 (HA), GQ478863
(NA).
Hurt et al. recently reported the characterization of
zanamivir-resistant subtype H1N1 with Q136K mutation
in NA (7). Zanamivir IC50s of these viruses ranged from 6
nM to 238 nM (7); which differed from the 1–60 nM range
of subtype H3N2 viruses obtained in this study. This finding may be due to differences in subtype and variations in
the assay. The Q136K mutation was not detected in the primary clinical samples by sequencing (7); however, in our
study, the Q136K mutation in subtype H3N2 isolates was
detected in primary samples. Comparison of the sequence
chromatograms between original samples and virus isolates showed a similar profile, suggesting that the Q136K
mutants were present in primary samples of subtype H3N2
isolates. The presence of Q136K variants in primary samples appears to be subtype-specific because these mutants
were present in very low proportions among subtype H1N1
viruses (12). To determine whether mutations exist in other
gene segments associated with Q136K mutations, we performed a full genome analysis of Q136K mutants and wildtype viruses. We found no additional mutations in Q136K
strains, which suggest that the genetic background of these
viruses can compensate for the K136 mutation. However,
further study is needed to confirm whether the accumulated
5 aa changes in HA and 8 substitutions in NA would compensate for the Q136K mutation.
We searched the database for NA sequences of influenza viruses A (H3N2) with Q136K mutation that are
available on GenBank. Of the 3,381 sequences obtained,
4 sequences from human influenza, which were isolated in
1995, 2003, 2004, and 2007, and 1 sequence from swine
C
influenza, which was isolated in Japan in 1997, contained
the Q136K substitution. Sequences from Q136K mutants
isolated before 2007 showed no mutations in the M2 gene.
The data indicate that these viruses occur naturally because
some of the isolates in the database were obtained before
introduction of zanamivir into clinical practice in 1999 in
Australia, New Zealand, United States, and Europe (9,13).
In addition, Myanmar patients who shed these Q136K viruses did not receive any NAIs. The clinical relevance of
Q136K mutants is unknown. Further study is needed to
evaluate the effectiveness of zanamivir in patients infected
with Q136K mutants.
Continued monitoring of viruses with reduced sensitivity to NAI and adamantanes is needed, and routine surveillance should include both phenotypic and genotypic
assays. The Q136K substitution in NA should be used as
a molecular marker associated with reduced NAI susceptibility not only in subtype H1N1 isolates but also among
subtype H3N2 isolates.
Acknowledgments
We thank the staff of the Chest Medical Unit of Sanpya Hospital, Respiratory Medicine Department of Yangon General Hospital, and Department of Medical Research for sample collection;
Akemi Watanabe for excellent technical support; and Akinori Miyashita and Ryozo Kuwano for support with DNA sequencing.
This work was supported by the Special Coordination Funds
for Promoting Science and Technology of the Ministry of Education, Culture, Sports, Science and Technology, Japan.
Mr Dapat is a PhD student in the Department of Public
Health, Niigata University, Japan. He is currently working on the
laboratory surveillance of human influenza viruses. His research
interests include virology and immunology.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
495
DISPATCHES
9.
References
1.
Barr IG, Hurt A, Iannello P, Tomasov C, Deed N, Komadina N. Increased adamantane resistance in influenza A(H3) viruses in Australia
and neighbouring countries in 2005. Antiviral Res. 2007;73:112–7.
DOI: 10.1016/j.antiviral.2006.08.002
Saito R, Li D, Suzuki H. Amantadine-resistant influenza A (H3N2)
virus in Japan, 2005–2006. N Engl J Med. 2007;356:312–3. DOI:
10.1056/NEJMc062989
Hauge SH, Dudman S, Borgen K, Lackenby A, Hungnes O. Oseltamivir-resistant influenza viruses A (H1N1), Norway, 2007–08.
Emerg Infect Dis. 2009;15:155–62. DOI: 10.3201/eid1502.081031
Hurt AC, Ernest J, Deng Y, Iannello P, Besselaar T, Birch C, et al.
Emergence and spread of oseltamivir-resistant A (H1N1) influenza
viruses in Oceania, South East Asia and South Africa. Antiviral Res.
2009;83:90–3. DOI: 10.1016/j.antiviral.2009.03.003
Sheu TG, Deyde V, Okomo-Adhiambo M, Garten R, Xu X, Bright
R, et al. Surveillance for neuraminidase inhibitor resistance among
human influenza A and B viruses circulating worldwide from 2004
to 2008. Antimicrob Agents Chemother. 2008;52:3284–92. DOI:
10.1128/AAC.00555-08
Gubareva LV, Matrosovich M, Brenner M, Bethell R, Webster R.
Evidence for zanamivir resistance in an immunocompromised child
infected with influenza B virus. J Infect Dis. 1998;178:1257–62.
DOI: 10.1086/314440
Hurt AC, Holien J, Parker M, Kelso A, Barr I. Zanamivir-resistant
influenza viruses with a novel neuraminidase mutation. J Virol.
2009;83:10366–73.Medline DOI: 10.1128/JVI.01200-09
Dapat C, Saito R, Kyaw Y, Naito M, Hasegawa G, Suzuki Y, et
al. Epidemiology of human influenza A and B viruses in Myanmar from 2005 to 2007. Intervirology. 2009;52:310–20. DOI:
10.1159/000237738
2.
3.
4.
5.
6.
7.
8.
10.
11.
12.
13.
Hurt AC, Barr I, Hartel G, Hampson A. Susceptibility of human
influenza viruses from Australasia and South East Asia to the
neuraminidase inhibitors zanamivir and oseltamivir. Antiviral Res.
2004;62:37–45. DOI: 10.1016/j.antiviral.2003.11.008
Tashiro M, McKimm-Breschkin J, Saito T, Klimov A, Macken C,
Zambon M, et al. Surveillance for neuraminidase-inhibitor-resistant
influenza viruses in Japan, 1996–2007. Antivir Ther. 2009;14:751–
61. DOI: 10.3851/IMP1194
Suzuki Y, Saito R, Zaraket H, Dapat C, Caperig-Dapat I, Suzuki H.
Rapid and specific detection of amantadine-resistant Ser31Asn mutated influenza A viruses by the cycling probe method. J Clin Microbiol. 2009; Epub ahead of print.
Okomo-Adhiambo M, Nguyen HT, Sleeman K, Sheu TG, Deyde
VM, Garten RJ, et al. Host cell selection of influenza neuraminidase
variants: implications for drug resistance monitoring in A (H1N1)
viruses. Antiviral Res. 2009 Nov 13. Epub ahead of print.
McKimm-Breschkin J, Trivedi T, Hampson A, Hay A, Klimov A,
Tashiro M, et al. Neuraminidase sequence analysis and susceptibilities of influenza virus clinical isolates to zanamivir and oseltamivir.
Antimicrob Agents Chemother. 2003;47:2264–72. DOI: 10.1128/
AAC.47.7.2264-2272.2003
Address for correspondence: Clyde Dapat, Department of Public Health,
Graduate School of Medical and Dental Sciences, Niigata University,
1-757 Asahimachi-dori, Niigata City, Niigata Prefecture, 951-8510, Japan;
email: [email protected]
The opinions expressed by authors contributing to this journal do
not necessarily reflect the opinions of the Centers for Disease Control and Prevention or the institutions with which the authors are
affiliated.
etymologia
Yersinia
[yər-sin´-e-ə]
This genus of gram-negative bacteria was named after bacteriologist Alexandre-Émile-John Yersin (1863–1943).
Born in Switzerland, he studied medicine in Paris and began a successful early career in the laboratory. He worked
on rabies with Pierre Roux and on the tubercle bacillus under Robert Koch in Germany. He later worked at the
Institut Pasteur on the toxic properties of the diphtheria bacillus and eventually signed on as a doctor on a ship
headed for Saigon and Manila. In 1894, while he still worked for a French shipping company, he investigated an
outbreak of plague in Hong Kong. After 7 days in a makeshift laboratory, he isolated the plague bacterium, which
he called Pasteurella pestis.
Japanese bacteriologist Shibasaburo Kitasato had arrived in Hong Kong, a few days before Yersin and also had
isolated the bacterium. Kitasato published his findings in English and Japanese. Yersin published his in French.
He also established a laboratory in Nha Trang, Vietnam, where he developed an antiplague serum that reduced the
death rate from 90% to ≈7%. Since 1970, the organism has been called Yersinia pestis.
Source: Burns W. Alexandre Yersin and his adventures in Vietnam. 2003; Medical Research Council National Institute for
Medical Research. http://www.himr.mrc.ac.uk/millhillessays/2003/yersin/; http://www.whonamedit.com/doctor.cfm/2454.html;
Dorland’s illustrated medical dictionary, 31st ed. Philadelphia: Saunders Elsevier; 2007.
496
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Sarcocystis
Species Lethal for
Domestic Pigeons
Philipp Olias, Achim D. Gruber, Andrea Kohls,
Hafez M. Hafez, Alfred Otto Heydorn,
Heinz Mehlhorn, and Michael Lierz1
A large number of Sarcocystis spp. infect birds as intermediate hosts, but pigeons are rarely affected. We identified a novel Sarcocystis sp. that causes lethal neurologic
disease in domestic pigeons in Germany. Experimental
infections indicated transmission by northern goshawks,
and sequence analyses indicated transnational distribution.
Worldwide spread is possible.
A
large number of Sarcocystis spp. (Protozoa: Apicomplexa) may infect birds as intermediate hosts, but wild
Columbiformes, which include pigeons, are rarely affected
(1–3). Among the few species affecting domestic poultry
are S. horvathi and S. wenzeli, which affect chickens, and S.
rileyi, for which ducks are intermediate hosts (4,5). S. falcatula has been known to cause clinical disease in pigeons
only after experimental infection; whether this species is
pathogenic under natural conditions is not known (6).
We recently reported an emerging neurologic disease
with lethal outcome for domestic pigeons (Columba livia f.
domestica) in Berlin, Germany, caused by a novel Sarcocystis sp. (3). When compared with S. falcatula and other
bird-infecting Sarcocystis spp. such as S. lindsayi, the novel species differed in its ultrastructural and genetic features
(3,6,7). Clinical signs in naturally infected pigeons, which
were similar to those caused by Paramyxovirus-1 or Salmonella typhimurium var. cop. infection, were depression,
polyuria, torticollis, opisthotonus, paralysis, trembling,
and death. Pigeons had numerous parasitic cysts in their
muscles. We hypothesized that pigeons serve as intermediate hosts in a 2-host life cycle characteristic for Sarcocystis
spp., in which pigeons are infected by ingestion of sporocysts shed in feces from an unidentified definitive host (8).
We further characterized the parasite genetically, identified
its definitive host and life cycle, and determined its causative role in this novel disease of pigeons.
Author affiliations: Freie Universität Berlin, Berlin, Germany (P.
Olias, A.D. Gruber, A. Kohls, H.M. Hafez, A.O. Heydorn, M. Lierz); and Heinrich-Heine-Universität, Düsseldorf, Germany (H.
Mehlhorn)
DOI: 10.3201/eid1603.090860
The Study
In 2008, DNA was extracted from the pectoral muscles
of a pigeon that had been naturally infected during a recent
outbreak in Germany. DNA sequences encoding the 18S
rRNA and D2-region of the 28S rRNA of the Sarcocystis
sp. were PCR amplified and sequenced, after which multiple sequence alignments and construction of phylogenetic
relationships were conducted (3,9–11). The 18S rRNA
and D2-region sequences were deposited in the GenBank
database (accession no. GQ245670). Comparison of the
18S rRNA with published sequences of Sarcocystis spp.
identified 1 matching sequence of 783 bp isolated from a
Cooper’s hawk (Accipiter cooperii) (GenBank accession
no. EU810398). Sequence analysis of a combination of the
18S rRNA and D2 region showed close homologies to other bird-infecting Sarcocystis spp. (Figure 1) and only 4 nt
differences from a Sarcocystis sp. found in a white-fronted
goose (Anser albifrons) (12).
To identify the definitive host, we conducted an experimental infection study using predators that had possible contact with the naturally infected pigeons: 2 dogs
(Canis familaris, beagles), 2 ferrets (Mustela putorius
furo), 2 rats (Rattus norvegicus f. domestica), 2 mice
(Mus musculus domesticus), 2 northern goshawks (Accipiter gentilis), and 2 Gyr-Saker hybrid falcons (Falco
rusticolus × Falco cherrug). Fecal samples from all animals were negative for parasites before infection. Each
animal was fed 1 regular-sized meal of pectoral muscle
of 2 racing pigeons naturally infected with cysts from the
2008 outbreak in Germany (3). Starting on day 6 after
infection, only the goshawks shed sporocysts (7.9 × 11.9
μm) in their feces. Microscopically, many oocysts (each
containing 2 sporocysts) were detected in the mucosa of
the small intestine, which is characteristic for Sarcocystis spp. Identical D2-region sequences were detected in
sporocysts from goshawk feces and in Sarcocystis-infested muscles from naturally infected pigeons. All other
animals failed to shed sporocysts. No clinical signs developed in the goshawks or the other animal species.
To experimentally reproduce the disease, we infected
domestic pigeons with an oral dose of purified sporocysts
from 1 goshawk. Pectoral muscle biopsy samples taken
before experimental infections were free of parasites. Fecal examination confirmed absence of Salmonella spp. and
endoparasites. We separated 16 pigeons into 8 groups of 2
birds each and gave pigeons in groups 1–7 infectious doses
(IDs) of 3 × 106, 3 × 105, 105, 8 × 104, 104 , 103, or 102.
Pigeons in group 8 served as controls. Animals with neurologic signs were euthanized, and surviving pigeons were
euthanized at 59 and 120 days after infection, respectively.
Current affiliation: Justus-Liebig-Universität Giessen, Giessen,
Germany.
1
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
497
DISPATCHES
taneous development of merozoites above a giant nucleus
of the schizont, the typical endopolygeny for a Sarcocystis
parasite, was noted. Identical D2-region DNA sequences
were detected in the livers and skeletal muscles from all
experimentally infected pigeons and from the Sarcocystisinfested muscles from naturally infected pigeons.
Figure 1. Phylogenetic comparison of novel Sarcocystis sp. with
related Sarcocystis spp. Tree constructed by neighbor-joining
using Kimura 2-parameter method based on the partial 18S rRNA
gene comprising 1,391 bp and the D2 region of 28S rRNA gene
comprising 325 bp of the novel Sarcocytis sp. (GenBank accession
no. GQ245670/FJ232949) and the following available Sarcocystis
sequences: Frenkelia microti (S. buteonis) (AF009244/AF044252);
Frenkelia glareoli (S. glareoli) (AF009245/AF044251); S. sp. (cyst
type I) ex Anser albifrons (EU502869/EF079886); S. sp. (cyst type
V) ex Corvus cornix (EU553478/EF079884); S. neurona (U07812/
AF092927); S. sp. (cyst type II) ex Anas platyrhynchos (EU553477/
EF079887); S. sp. (cyst type III) ex A. albifrons (EU502868/
EF079885); S. moulei (L76473/AF012884); S. gigantea (L24384/
U85706); S. tenella (L24383/AF076899); S. capracanis (L76472/
AF012885); S. arieticanis (L24382/AF076904); S. cruzi (AF017120/
AF076903); S. singaporensis (AF434054/AF237617); S. sp. II ex
Atheris rungweensis (AF513490/AF513493); S. muris (M64244/
AF012883). Highlighted area indicates branch of bird-infecting
Sarcocystis spp. Scale bar indicates genetic distance.
Pigeons in groups 1–4 (IDs 3 × 106 to 8 × 104) died
within 12 days after infection. After 8 weeks of infection,
severe and moderate neurologic signs developed in pigeons
of groups 5 (ID 104) and group 6 (ID 103), respectively.
After 9 weeks of infection, pigeons in group 7 (ID 102)
had mild to moderate neurologic signs. Control pigeons
of group 8 remained free of clinical signs throughout the
study.
Histologic examination of livers from pigeons in
groups 1–4 showed multifocal severe necroses with numerous parasitic stages (Figure 2, panel A). Pigeons in groups
5–7 had marked encephalitis, myositis, and Sarcocystis
cysts in skeletal muscles (pectoral, gastrocnemius, and
neck) but not in the brain. Control pigeons had no microscopic lesions in any organs. Neither Salmonella spp. nor a
hemagglutinating agent was cultured from any pigeon.
Electron microscopic examination of livers was performed as previously described (3). Parasitic stages, identified as developmental stages of schizonts, were seen in
livers of pigeons of groups 1–4 (Figure 2, panel B). Simul498
Figure 2. A) Microscopic appearance of liver with tissue necrosis,
lymphohistiocytic inflammation, and Sarcocystis schizonts (arrows)
in a pigeon 8 days after infection with 105 Sarcocystis sporocysts.
Hematoxylin and eosin stain; scale bar = 20 μm. B) Transmission
electron micrograph of a hepatocyte from liver in panel A,
containing a schizont, forming cross-sectioned and longitudinally
sectioned merozoites. N, nucleus; PV, parasitophorous vacuole; M,
merozoite. Scale bar = 20 μm.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Sarcocystis sp. Lethal for Domestic Pigeons
Conclusions
This study identifies the northern goshawk as the probable definitive host of a recently described novel Sarcocystis sp. in domestic pigeons in Germany, indicating a typical
prey–predator transmission cycle (3). The clinical signs
and organ lesions of experimentally infected animals mirror those of naturally infected racing pigeons.
Previous results suggested that this parasite represents
a new Sarcocystis sp. and is genetically distinct from S. falcatula (3). Our further sequence analyses indicated that the
novel Sarcocystis sp. is closely related or even identical to
a Sarcocystis sp. previously detected in a Cooper’s hawk in
the state of Georgia, USA (13). Cooper’s hawks are widespread in North America and in some areas hunt mainly
pigeons (14). Further phylogenetic analyses showed that
this Sarcocystis sp. is closely related but distinct from other
bird-infecting Sarcocystis spp. (Figure 1).
Goshawks are widely distributed in the Northern
Hemisphere, where the domestic pigeon is also common.
Throughout Europe, pigeons are the principal prey for
goshawks (15). Thus, we speculate that this Sarcocystis
sp. may be present in other countries or could easily be introduced and become endemic elsewhere. It remains to be
shown whether other avian species, in addition to pigeons,
may serve as intermediate hosts. This assumption is supported by a close sequence homology between this Sarcocystis sp. and a Sarcocystis sp. previously found in striated
muscles of a white-fronted goose (Figure 1).
Among the experimentally infected pigeons, different
diseases were caused by different infectious doses. Pigeons
infected with high doses died 7–12 days after infection and
had massive parasite-induced liver necroses; those infected
with lower doses had central nervous signs, which did not
develop until 8 weeks after infection. The late occurrence
of brain lesions and the absence of parasitic stages from the
brain suggest an indirect, currently unknown, mechanism
of encephalitis that awaits further clarification.
In conclusion, the emerging Sarcocystis sp. cycles between northern goshawks and domestic pigeons and is highly pathogenic for the pigeons after they ingest low doses of
sporocysts. Pigeon sport and falconry should therefore be
considered as risk factors for further disease transmission.
Dr Olias is a PhD student in the Department of Veterinary
Pathology at the Freie Universität Berlin, Germany. Avian diseases are his primary research interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Odening K. The present state of species-systematics in Sarcocystis Lankester, 1882 (Protista, Sporozoa, Coccidia). Syst Parasitol.
1998;41:209–33. DOI: 10.1023/A:1006090232343
Ecco R, Luppi MM, Malta MC, Araujo MR, Guedes RM, Shivaprasad HL. An outbreak of sarcocystosis in psittacines and a pigeon in
a zoological collection in Brazil. Avian Dis. 2008;52:706–10. DOI:
10.1637/8303-040408-Case.1
Olias P, Gruber AD, Heydorn AO, Kohls A, Mehlhorn H, Hafez
HM, et al. A novel Sarcocystis-associated encephalitis and myositis in racing pigeons. Avian Pathol. 2009;38:121–8. DOI:
10.1080/03079450902737847
Riley WA. Sarcosporidiosis in ducks. Parasitology. 1931;23:282–5.
Wenzel R, Erber M, Boch J, Schellner HP. Sarcocystis infections
in domestic fowl in pheasant and in coots. Berl Munch Tierarztl
Wochenschr. 1982;95:188–93.
Box ED, Smith JH. The intermediate host spectrum in a Sarcocystis species of birds. J Parasitol. 1982;68:668–73. DOI:
10.2307/3280926
Dubey JP, Rosenthal BM, Speer CA. Sarcocystis lindsayi n. sp. (Protozoa: Sarcocystidae) from the South American opossum, Didelphis
albiventris from Brazil. J Eukaryot Microbiol. 2001;48:595–603.
DOI: 10.1111/j.1550-7408.2001.tb00196.x
Mehlhorn H, Heydorn AO. The sarcosporidia (Protozoa, Sporozoa):
life cycle and fine structure. Adv Parasitol. 1978;16:43–91. DOI:
10.1016/S0065-308X(08)60572-2
Medlin L, Elwood HJ, Stickel S, Sogin ML. The characterization of
enzymatically amplified eukaryotic 16S-like rRNA-coding regions.
Gene. 1988;71:491–9. DOI: 10.1016/0378-1119(88)90066-2
Yang ZQ, Zuo YX, Yao YG, Chen XW, Yang GC, Zhang YP. Analysis of the 18S rRNA genes of Sarcocystis species suggests that the
morphologically similar organisms from cattle and water buffalo
should be considered the same species. Mol Biochem Parasitol.
2001;115:283–8. DOI: 10.1016/S0166-6851(01)00283-3
Fischer S, Odening K. Characterization of bovine Sarcocystis species by analysis of their 18S ribosomal DNA sequences. J Parasitol.
1998;84:50–4. DOI: 10.2307/3284529
Butkauskas D, Sruoga A, Kutkiene L, Prakas P. Investigation of the
phylogenetic relationships of Sarcocystis spp. from greylag (Anser
anser) and white-fronted (Anser albifrons) geese to other cyst forming coccidia using 18s and 28s rRNA gene sequences. Acta Zoologica Lituanica. 2007;17:124–8.
Yabsley MJ, Ellis AE, Stallknecht DE, Howerth EW. Characterization of Sarcocystis from four species of hawks from Georgia, USA.
J Parasitol. 2009;95:256–9. DOI: 10.1645/GE-1567.1
Roth TC, Lima SL. Hunting behaviour and diet of Cooper’s hawks:
an urban view of the small-bird-in-winter paradigm. Condor.
2003;105:474–83. DOI: 10.1650/7219
Opdam P, Thissen J, Verschuren P, Mueskens G. Feeding ecology of
a population of goshawk Accipiter gentilis. J Ornithol. 1977;118:35–
51. DOI: 10.1007/BF01647356
Address for correspondence: Philipp Olias, Department of Veterinary
Pathology, Freie Universität Berlin, Robert-von-Ostertag-Str. 15, 14163
Berlin, Germany; email: [email protected]
Search past issues of EID at www.cdc.gov/eid
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
499
DISPATCHES
Candidatus
Bartonella
mayotimonensis
and Endocarditis
Eleanor Y. Lin,1 Constantine Tsigrelis,
Larry M. Baddour, Hubert Lepidi,
Jean-Marc Rolain, Robin Patel, and Didier Raoult
We describe a new Bartonella species for which we
propose the name Candidatus Bartonella mayotimonensis.
It was isolated from native aortic valve tissue of a person
with infective endocarditis. The new species was identified
by using PCR amplification and sequencing of 5 genes (16S
rRNA gene, ftsZ, rpoB, gltA, and internal transcribed spacer
region).
artonella species are small, fastidious, gram-negative,
intracellular bacteria that cause culture-negative infective endocarditis. Six species have been documented to
cause endocarditis in humans: B. quintana (1), B. henselae (2), B. elizabethae (3), B. vinsonii subsp. berkhoffii (4),
B. koehlerae (5), and B. alsatica (6). We report a case of
culture-negative endocarditis caused by a new Bartonella
species, for which we propose the name Candidatus Bartonella mayotimonensis.
B
The Patient
A 59-year-old man was initially hospitalized at Sartori Memorial Hospital (Cedar Falls, IA, USA) from April
14 through 19, 2008, for progressive shortness of breath,
weight loss, fatigue, and altered mental status. He was then
transferred to the Mayo Clinic (Rochester, MN, USA).
Physical examination identified a new diastolic heart murmur. He was afebrile and did not have peripheral stigmata
of endocarditis. Two sets of blood cultures obtained before
antimicrobial drug therapy showed negative results for all
bacteria tested after 5 days of incubation. A transesophageal echocardiogram showed a bicuspid aortic valve, mobile components on the left cusp of the aortic valve suggesting vegetations, and a 5.3-cm ascending aortic aneurysm.
Empiric antimicrobial drug therapy, including vancomycin
and ceftriaxone, was initiated. Subsequently, acute renal
dysfunction, possibly secondary to vancomycin exposure,
developed in the patient.
Author affiliations: Mayo Clinic, Rochester, Minnesota, USA (E. Y.
Lin, C. Tsigrelis, L.M. Baddour, R. Patel); and Université de la Méditerranée, Marseille, France (H. Lepidi, J.M. Rolain, D. Raoult)
DOI: 10.3201/eid1603.081673
500
The patient lived alone on a farm in Iowa, USA, and
had not had recent exposure to animals. However, he had
observed murine fecal droppings in his house and mice on
the farm. He had had a house cat for 18 years until its death
a few years before his hospitalization and had intermittent
contact with cats when he visited his daughter.
Serum immunoglobulin G titers were positive for B.
henselae and B. quintana (>1,024). Oral doxycycline and rifampin were prescribed for treatment of presumed Bartonella endocarditis. Gentamicin was not administered because
of development of the acute renal dysfunction. Two weeks
later, he underwent aortic valve and aortic root replacement.
Results of gram staining, acid-fast staining, fungal staining,
anaerobic bacterial culture, aerobic bacterial culture, mycobacterial culture, and fungal culture on resected aortic valve
tissue were negative for Bartonella species.
PCR performed at the Mayo Clinic on resected aortic valve tissue detected part of the citrate synthase gene
(gltA) of Bartonella species. However, the melting temperature was not characteristic of B. quintana or B. henselae
(7). Oral doxycycline and rifampin were continued for 12
weeks after aortic valve resection. The patient was well and
had no signs of relapsing infection at a follow-up visit 11
months after valve surgery.
Aortic valve tissue and serum were tested at the Unité
des Rickettsies, Marseille, France. B. quintana Oklahoma,
B. henselae Houston (ATCC 49882), B. vinsonii subsp.
berkhoffii (URBVAIE25), B. vinsonii subsp. arupensis
(ATCC 700727), and B. alsatica (CIP 105477 T) strains
were used for immunofluorescent assays and Western blotting (6). Valve tissue was injected into human endothelial
cells in a shell vial assay and onto Columbia 5% sheep
blood agar plates and incubated at 37°C in an atmosphere
of 5% CO2 as described (6).
A Bartonella species was detected in a shell vial by
immunofluorescence after 15 days of culture; identification
was confirmed by PCR. DNA was extracted from valve
specimen and injected cells by using the QIAamp Tissue
Kit (QIAGEN, Hilden, Germany). DNA was used as a template in a genus Bartonella Lightcycler assay with primers
and a Taqman probe specific for the internal transcribed
spacer (ITS) gene (6) and in standard PCR assays specific
for the 16S rRNA, ITS, rpoB, gltA, and ftsZ genes (8). Sequences from both DNA strands were determined twice for
all PCR products. These products were resolved in an ABI
3100 automated sequencer (PerkinElmer, Waltham, MA,
USA). Sterile water was used as a negative control in each
assay. Percentages of similarity among sequences were determined by using MEGA 2.1 software (9). Phylogenetic
relationships among Bartonella strains were inferred from
concatenated sequences by using MEGA 2.1 software (9).
1
Current affiliation: Massachusetts General Hospital, Boston,
Massachusetts, USA
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Candidatus Bartonella mayotimonensis
Surgically resected aortic valve tissues were fixed in
formalin, embedded in paraffin, and sectioned to a thickness
of 5 μm. Sections were stained with periodic acid–Schiff,
Giemsa, Gram, Grocott-Gomori methenamine silver, and
Warthin-Starry stains. Immunohistochemical analysis was
performed by using a procedure described elsewhere (10)
and polyclonal antibody against B. vinsonii at a dilution of
1:1,000.
Serum samples showed immunoglobulin G endpoint
titers of 50 against all Bartonella species tested by immunofluorescent assay. Western blot results were positive and
characteristic of Bartonella infection (Figure 1, panel A).
Results of PCR (Bartonella genus Lightcycler assay and
standard PCR for cardiac valve) and cell culture were positive, and amplification products of the expected size were
obtained. Among known validated species, sequences obtained shared 99.1% (1,438/1,445 bp) homology with B.
tribocorum, B. henselae, and B. vinsonii for the 16S rRNA
gene, 89.5% homology with B. grahamii for the ITS gene,
93.4% homology with B. vinsonii subsp. berkhoffii for
rpoB, 91.7% homology with B. vinsonii subsp. berkhoffii
for ftsZ, and 92.5% homology with B. vinsonii strain Baker
for gltA. The phylogenetic position of Candidatus B. mayotimonensis among members of the genus Bartonella based
on comparisons of concatenated sequences of the 5 genes
is shown in Figure 2. Sequences of gltA, 16S rDNA, ftsZ,
ITS, and rpoB were deposited in GenBank under accession
nos. FJ376732–FJ376736.
Histologic analysis of resected aortic valve showed
infective endocarditis with vegetation containing microorganisms that stained with Warthin-Starry and Giemsa.
Warthin-Starry staining showed darkly stained bacilli consistent with Bartonella species (Figure 1, panel B). Results
of staining with periodic acid–Schiff, Gram, and Grocott-
Figure 1. A) Western blot of serum sample from patient infected with Candidatus Bartonella mayotimonensis. Left lane, Molecular mass
standard; lane 1, Bartonella quintana; lane 2, B. henselae; lane 3, B. elizabethae; lane 4, B. vinsonii subsp. berkhoffii; lane 5, B. alsatica.
Values on the left are in kilobases. B) Numerous darkly stained bacilli consistent with Bartonella species organized in clusters in the
valvular vegetation (Warthin-Starry stain; original magnification ×400). C and D) Bacteria detected by immunohistochemical analysis of
an extracellular location inside the valvular vegetation (polyclonal antibody against B. vinsonii subsp. berkhoffii, Warthin-Starry stain and
hematoxylin counterstain; original magnification ×100 in C and ×400 in D).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
501
DISPATCHES
100
97
B. vinsonii subsp. arupensis
B. vinsonii subsp. vinsonii
85
B. vinsonii subsp. berkhofii
Candidatus Bartonella mayotimonensis
38
B. alsatica
37
71
B. taylorii
B. koehlerae
69
B. henselae
100
100
B. elizabethae
100
68
B. quintana
B. grahamii
66
100
B. tribocorum
B. doshiae
83
B. birtlesii
B. tamiae
B. clarridgeiae
85
B. rochalimae
B. bacilliformis
Figure 2. Phylogenetic tree showing the position of Candidatus
Bartonella mayotimonensis among members of the genus
Bartonella based on comparisons of concatenated sequences
of the 16S rRNA gene, the citrate synthase gene gltA, the RNA
polymerase β-subunit gene rpoB, the cell division gene ftsZ, and
the 16S–23S rRNA internal transcribed spacer region sequences.
The tree was constructed by using the neighbor-joining method
and a maximum-likelihood–based distance algorithm. Numbers on
branches indicate bootstrap values derived from 500 replications.
Gomori methenamine silver were negative. Immunohistochemical analysis detected bacteria in valvular vegetations in a location superimposable with that detected by
Warthin-Starry staining (Figure 1, panels C, D).
Conclusions
We isolated a new Bartonella species and propose
that it be named Candidatus Bartonella mayotimonensis
to recognize the contributing institutions (Mayo Clinic
and Hôpital de la Timone, Marseille, France). This is the
seventh Bartonella species documented to cause infective
endocarditis in humans.
The reservoir of Candidatus B. mayotimonensis has
yet to be determined. Different Bartonella species have
been isolated from a variety of mammals, and each species
is highly adapted to its reservoir host (11,12). The domestic cat is the primary mammalian reservoir for B. henselae
(13). Other Bartonella species have been found in mammalian hosts, including rats (B. elizabethae), dogs and coyotes (B. vinsonii subsp. berkhoffii), cats (B. koehlerae), humans (B. bacilliformis and B. quintana), moles (B. talpae),
voles (B. vinsonii subsp. vinsonii), cows (B. bovis [weissii]), deer (B. schoenbuchensis), and rabbits (B. alsatica)
(3–6,12,14,15). Our patient had direct exposure to mice on
his farm and also had intermittent contact with cats while
visiting his daughter. Additional investigations are needed
to determine the reservoir(s) and vector(s) for this novel
bacterium.
The immunofluorescent assay, the current serologic
method for diagnosis of Bartonella infection, does not
502
distinguish among Bartonella species. Only Western blot
analysis and cross-adsorption enable serologic identification of species. PCR and culture are critical when a Bartonella species is identified for the first time as a human
pathogen. Newly encountered Bartonella strains should be
considered a new species if a 327-bp gltA fragment shares
<96.0% sequence similarity with those of validated species,
and if an 825-bp rpoB fragment shares <95.4% sequence
similarity with those of validated species as reported in the
current case (8).
This case reinforces the hypothesis that any Bartonella
species can cause human infection, including culture-negative endocarditis. Candidatus B. mayotimonensis should
be added to the list of human pathogens that can cause culture-negative endocarditis.
Dr Lin was an internal medicine resident at the Mayo Clinic
in Rochester, Minnesota, when the patient’s condition was investigated. She is currently an endocrinology fellow at Massachusetts
General Hospital in Boston, Massachusetts. Her research interest
is neuroendocrinology.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Drancourt M, Mainardi JL, Brouqui P, Vandenesch F, Carta A, Lehnert F, et al. Bartonella (Rochalimaea) quintana endocarditis in three
homeless men. N Engl J Med. 1995;332:419–23. DOI: 10.1056/
NEJM199502163320702
Holmes AH, Greenough TC, Balady GJ, Regnery RL, Anderson BE,
O’Keane JC, et al. Bartonella henselae endocarditis in an immunocompetent adult. Clin Infect Dis. 1995;21:1004–7.
Daly JS, Worthington MG, Brenner DJ, Moss CW, Hollis DG, Weyant RS, et al. Rochalimaea elizabethae sp. nov. isolated from a patient with endocarditis. J Clin Microbiol. 1993;31:872–81.
Roux V, Eykyn SJ, Wyllie S, Raoult D. Bartonella vinsonii subsp.
berkhoffii as an agent of afebrile blood culture–negative endocarditis
in a human. J Clin Microbiol. 2000;38:1698–700.
Avidor B, Graidy M, Efrat G, Leibowitz C, Shapira G, Schattner A,
et al. Bartonella koehlerae, a new cat-associated agent of culturenegative human endocarditis. J Clin Microbiol. 2004;42:3462–8.
DOI: 10.1128/JCM.42.8.3462-3468.2004
Raoult D, Roblot F, Rolain JM, Besnier JM, Loulergue J, Bastides F,
et al. First isolation of Bartonella alsatica from a valve of a patient
with endocarditis. J Clin Microbiol. 2006;44:278–9. DOI: 10.1128/
JCM.44.1.278-279.2006
Vikram HR, Bacani AK, DeValeria PA, Cunningham SA, Cockerill
FR III. Bivalvular Bartonella henselae prosthetic valve endocarditis.
J Clin Microbiol. 2007;45:4081–4. DOI: 10.1128/JCM.01095-07
La Scola B, Zeaiter Z, Khamis A, Raoult D. Gene-sequence-based
criteria for species definition in bacteriology: the Bartonella paradigm. Trends Microbiol. 2003;11:318–21. DOI: 10.1016/S0966842X(03)00143-4
Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics. 2001;17:1244–5.
DOI: 10.1093/bioinformatics/17.12.1244
Lepidi H, Fournier PE, Raoult D. Quantitative analysis of valvular lesions during Bartonella endocarditis. Am J Clin Pathol.
2000;114:880–9. DOI: 10.1309/R0KQ-823A-BTC7-MUUJ
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Candidatus Bartonella mayotimonensis
11.
La VD, Tran-Hung L, Aboudharam G, Raoult D, Drancourt M. Bartonella quintana in domestic cat. Emerg Infect Dis. 2005;11:1287–9.
12. Rolain JM, Brouqui P, Koehler JE, Maguina C, Dolan MJ, Raoult D.
Recommendations for treatment of human infections caused by Bartonella species. Antimicrob Agents Chemother. 2004;48:1921–33.
DOI: 10.1128/AAC.48.6.1921-1933.2004
13. Eremeeva ME, Gerns HL, Lydy SL, Goo JS, Ryan ET, Mathew SS,
et al. Bacteremia, fever, and splenomegaly caused by a newly recognized Bartonella species. N Engl J Med. 2007;356:2381–7. DOI:
10.1056/NEJMoa065987
14. Breitschwerdt EB, Kordick DL. Bartonella infection in animals:
carriership, reservoir potential, pathogenicity, and zoonotic potential for human infection. Clin Microbiol Rev. 2000;13:428–38. DOI:
10.1128/CMR.13.3.428-438.2000
15.
Chomel BB, Boulouis HJ, Maruyama S, Breitschwerdt EB. Bartonella spp. in pets and effect on human health. Emerg Infect Dis.
2006;12:389–94.
Address for correspondence: Eleanor Y. Lin, Massachusetts General
Hospital, Thier Bldg, Rm 1101, 55 Blossom St, Boston, MA 02114, USA;
email: [email protected]
The opinions expressed by authors contributing to this journal do
not necessarily reflect the opinions of the Centers for Disease Control and Prevention or the institutions with which the authors are
affiliated.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
503
DISPATCHES
Surveillance Lessons
from First-wave
Pandemic (H1N1)
2009, Northern
California, USA
Roger Baxter
After the appearance of pandemic (H1N1) 2009 in April
2009, influenza activity was monitored within the Kaiser Permanente Northern California division by using laboratory,
pharmacy, telephone calls, and utilization (services patients
received) data. A combination of testing and utilization data
showed a pattern of disease activity, but this pattern may
have been affected by public perception of the epidemic.
I
n April 2009, the novel swine-origin H1N1 influenza
virus, now referred to as pandemic (H1N1) 2009 virus,
was identified in the United States in California and in
Mexico. During April, increasing numbers of cases were
identified in Mexico, and sporadic cases were seen in the
United States, mostly in returning travelers (1). Media
coverage was high, and the public and medical communities were alert to the presence of the novel virus (2). Although the World Health Organization raised its influenza
alert level to phase 6 (calling this a true pandemic) on
June 11, by this time media attention in the United States
had waned, and concern was for reemergence in the fall
(3). However, virus activity did not diminish in northern
California; rather, pandemic (H1N1) 2009 influenza remained active at high levels.
Kaiser Permanente (KP) is a medical care organization with 3.2 million members in its Northern California
division (KPNC). Members receive essentially all medical
care from KP providers and in KP facilities. An electronic
medical record system records diagnoses from outpatient
and emergency department visits and hospitalizations, as
well as medications, immunizations, and ancillary services
received by patients. A central laboratory in Berkeley performs all microbiologic and virologic testing. In addition,
all telephone callers to the system are routed to central call
centers, where information is gathered on whether the caller is asking influenza-related questions. This report details
the recent experience of pandemic (H1N1) 2009 in KPNC
and documents KP surveillance efforts.
Author affiliation: Kaiser Permanente Vaccine Study Center, Oakland, California, USA
DOI: 10.3201/eid1603.091285
504
The Study
Influenza testing was performed by using a real-time
PCR for influenza A and B and respiratory syncytial virus on
nasopharyngeal swabs. Similar methods have been shown
to be superior to other tests and sensitive and specific for
detecting pandemic (H1N1) 2009 influenza (4). A weekly
report went to primary care providers, advising on current
viral activity, and gave guidelines for testing and treating.
All specimens positive for influenza A were transported to
the California State Department of Public Health laboratory for H1N1 confirmation testing early in the pandemic,
but testing was later restricted to specimens from hospitalized patients only. Results of testing were provided weekly
with counts from the previous week, Sunday through Saturday. Hospitalization rates were counted weekly by using text strings from admission diagnoses for pneumonia
or influenza. If KPNC members had questions regarding
influenza, when they called for advice or appointments they
were triaged to the “flu queue,” where they could receive
prerecorded messages or one-on-one advice with a nurse or
physician. We plotted the percentage of all calls per week
that were counted as influenza related. Weekly counts of
medical office visits for influenza-like illness (ILI)—fever,
influenza, or upper respiratory infection—were also plotted. The study was reviewed and approved by the Kaiser
Permanente and Institutional Review Boards.
The Figure, panel A, shows that the total number of
respiratory tests rose drastically during late April, when
media coverage was high. This increase was accompanied
by an increase in the total number of respiratory specimens
positive for influenza A. During this initial phase, utilization of resources was high, but there appeared to be little
pandemic (H1N1) 2009 in the community because the percentage of positive specimens ranged from 5% to 7%. The
Figure, panel B, shows outpatient visits for ILI per 1,000
members and percentages of total hospitalizations for pneumonia or influenza during 2009, along with the percentage
of respiratory specimens positive for influenza A. The first
increase correlates with 2008–09 seasonal influenza, which
peaked in February. Then in late April, at the same time
as the increase in volume of influenza testing, there was an
increase in outpatient visits for ILI and hospitalizations for
pneumonia or influenza. In the Figure, panel C, the percentage of influenza-related telephone calls is plotted alongside
the percentage of respiratory specimens that were positive
for influenza A. Similarly to trends in medical appointments
and hospitalizations, calls showed a marked increase during
the pandemic scare period, then decreased and rose again
more gradually with the first wave of the pandemic, along
with the percentage of specimens positive for influenza A.
Media coverage rapidly subsided, and reports from the
Centers for Disease Control and Prevention showed that the
number of cases of pandemic (H1N1) 2009 was diminish-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Surveillance Lessons from Pandemic (H1N1) 2009
ing in Mexico and the United States (1). Testing and treating
diminished and utilization of healthcare services returned
to normal. However, pandemic (H1N1) 2009 continued
to circulate widely, even after schools closed for summer
vacation. By mid-May, the percentage of specimens positive for influenza A was 10% and then rapidly increased
to 49% only 4 weeks later. State subtyping of hospitalized
patients (inside and outside the KP) who were positive for
Figure. A) Influenza A testing in Kaiser Permanente Northern
California division (KPNC), 2009. Shown are total numbers of
specimens sent, number of specimens positive for influenza A, and
percentage of specimens positive for influenza A. B) Outpatient
visits for influenza-like illness (fever, influenza, or upper respiratory
infection) per 1,000 members, percentage of all hospitalizations
with a diagnosis of pneumonia or influenza (P&I), and percentage
of specimens positive for influenza A, KPNC, 2009. C) Influenzarelated telephone calls to KPNC, 2009, and percentage of
specimens positive for influenza A.
influenza A showed that >95% of specimens tested from
those patients were either not subtypeable or were positive
for pandemic (H1N1) 2009 influenza virus (J. Louie, California Department of Public Health, pers. comm.). Hospitalizations for pneumonia and influenza, outpatient visits
for ILI, and influenza-related phone calls all rose in concert
with the percentage of positive specimens.
Conclusions
During the recent outbreak of pandemic (H1N1) 2009
influenza in California, KPNC providers had access to quality, real-time information on the ongoing outbreak. This
accessibility proved useful for guiding testing and treating
algorithms and provided information during a time of great
uncertainty and public fear.
Although the data were useful, it appears that during a
time of intense media attention healthcare utilization may
be susceptible to public perception and media coverage.
During the pandemic scare period, although it appeared
that influenza was circulating widely, test results and utilization data indicate that most activity was not related to
either pandemic or seasonal influenza but that it may have
been generated by demand created by false perceptions. It
is interesting that even hospitalizations increased during
this time because we generally perceive increased hospitalizations to be a marker of virulence and true activity. During the later phase of the pandemic, hospital and outpatient
utilization rose in concert with the percentage of positive
test results, reflecting virus activity. During this time, media coverage was relatively low, and this was reflected by
lower numbers of telephone calls to the system.
The percentage of positive specimens appeared to be
the best indicator of influenza activity because it was sensitive to rapid changes, but was a more specific indicator
than specimens sent, number positive, outpatient or inpatient utilization, or telephone call-ins. The total number of
patients tested is also informative because it can help define
the relationship of testing to public perceptions. However,
extremely high numbers can obscure a higher percent positive if persons seek medical care more from panic than for
actual symptoms. The first-wave pandemic peak of positive
samples was high compared with those from the seasonal
influenza outbreak in February (49% vs. 22%); total numbers were lower. This difference may reflect patterns of
testing by providers and reasons for patients to go to medical centers, but the high percentage of positive samples
may reflect large numbers of cases in the community and
the wide distribution of pandemic (H1N1) 2009 influenza.
The weekly report influenced provider testing with
guidelines that changed as the season progressed. When
the percentage positive was high at all facilities and the
laboratory was overwhelmed with requests, providers were
advised to decrease testing unless needed for a clinical
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
505
DISPATCHES
workup or for any hospitalization. This request may have
produced artifacts in the testing in that total numbers and
the percentage positive may have varied based on the sensitivity and specificity of provider testing.
Surveillance for influenza, both seasonal and pandemic, by using electronic data is informative for medical organizations with a systematic approach to testing for influenza
virus. Monitoring of medical utilization may be helpful in
a pandemic, but fluctuations are susceptible to public impression and media coverage. An integrated approach to
influenza surveillance, combining laboratory testing and
utilization, would be optimal.
Acknowledgments
I thank Lesley Levine for help with call center data, John
Chapman for hospitalization data, Janice Louie and Hugo Guevara for subtyping data, Janelle Lee for outpatient data, and Bruce
Fireman for encouragement.
Dr Baxter is an internist and practicing infectious diseases
specialist with The Kaiser Permanente Medical Group in Oak-
506
land, California, and is co-director of the Kaiser Permanente Vaccine Study Center. His research interests include influenza vaccine effectiveness and vaccine safety.
References
1.
2.
3.
4.
Centers for Disease Control and Prevention. Update: novel influenza
A (H1N1) virus infection—Mexico, March–May, 2009. MMWR
Morb Mortal Wkly Rep. 2009;58:585–9.
Centers for Disease Control and Prevention. Update: novel influenza A (H1N1) virus infections—worldwide, May 6, 2009. MMWR
Morb Mortal Wkly Rep. 2009;58:453–8.
Michaelis M, Doerr HW, Cinatl J Jr. Novel swine-origin influenza
A virus in humans: another pandemic knocking at the door. Med
Microbiol Immunol. 2009;198:175–83.
Ginocchio CC, Zhang F, Manji R, Arora S, Bornfreund M, Falk L, et
al. Evaluation of multiple test methods for the detection of the novel
2009 influenza A (H1N1) during the New York City outbreak. J Clin
Virol. 2009;45:191–5. DOI: 10.1016/j.jcv.2009.06.005
Address for correspondence: Roger Baxter, Kaiser Permanente Vaccine
Study Center, 1 Kaiser Plaza, 16B, Oakland, CA 94612, USA; email:
[email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Experimental
Infection of
Squirrel Monkeys
with Nipah Virus
Philippe Marianneau,1 Vanessa Guillaume,1
K. Thong Wong, Munisamy Badmanathan, Ren
Yih Looi, Séverine Murri, Philippe Loth, Noël
Tordo, T. Fabian Wild, Branka Horvat,
and Hugues Contamin
We infected squirrel monkeys (Saimiri sciureus) with
Nipah virus to determine the monkeys’ suitability for use as
primate models in preclinical testing of preventive and therapeutic treatments. Infection of squirrel monkeys through
intravenous injection was followed by high death rates associated with acute neurologic and respiratory illness and
viral RNA and antigen production.
N
ipah virus (NiV) is a highly pathogenic zoonotic
paramyxovirus that was first identified in Malaysia
and Singapore in 1999 (1). Since the initial outbreak, NiV
has been associated with human illness in Bangladesh and
India (2) and was classified, together with the closely related Hendra virus, in the genus Henipavirus. Reported
human death rates varied from 40%–92% (3), and some
outbreaks were associated with human-to-human transmission (4). Most human infections led to encephalitis with
vasculitis-induced thrombosis in the brain and atypical
pneumonia in certain patients (5,6). Because of the lack of
efficient treatment or a vaccine for Nipah virus and the high
pathogenicity of the virus in humans, the manipulation of
NiV requires BioSafety Level 4 (BSL-4) conditions.
Several species of fruit bats of the genus Pteropus are
considered natural reservoirs of henipaviruses, although
the disease does not develop in them (7). Pigs were responsible for amplifying the NiV infection in Malaysia,
but their death rate was only 10%–15%. Laboratory infection of piglets caused development of neurologic signs in
some animals, and NiV was detected in different tissues
(8). Hamsters in laboratory studies are highly susceptible
to NiV, and infection develops in multiple organs, including the brain (9). Cats infected with NiV in the laboratory
Author affiliations: Institut Pasteur, Lyon, France (P. Marianneau, S.
Murri, P. Loth, N. Tordo, H. Contamin); Institut national de santé et
de la recherché médicale, Lyon (V. Guillaume, T.F. Wild, B. Horvat);
and University of Malaya, Kuala Lumpur, Malaysia (K.T. Wong, M.
Badmanathan, R.Y. Looi)
DOI: 10.3201/eid1603.091346
reproduce the disease observed in naturally infected cats,
including a severe respiratory and systemic disease, 6–13
days after infection (10). However, to our knowledge, a
primate model necessary for preclinical testing of preventive and therapeutic approaches has not been described. We
therefore assessed the squirrel monkey (Saimiri sciureus)
as an experimental model of NiV infection.
The Study
We selected these New World monkeys because of
their availability, reliability as a primate model with which
to study infectious diseases (11), and suitability as experimental animals in BSL-4 conditions. Thirteen 4-year-old
male monkeys (0.8–1.0 kg) were imported from a breeding
colony in French Guiana and housed in the BSL-4 animal
care facility in Lyon. Experimental methods were approved
by the Région Rhône Alpes ethics committee.
Twelve monkeys were infected with NiV isolate UMMC1 (1), GenBank accession no. AY029767, either intravenously or intranasally; for both modes of infection either
103 or 107 PFU was used. Animals were observed daily for
2 months for signs of disease onset; tissues were taken during the infection and at necropsy or at the end of experiment (Table 1). Blood samples were collected at different
time points, serum samples were used for antibody analysis, and peripheral blood cells (PBMC) were used for RNA
isolation. Different organ samples were taken and frozen
at –80°C for RNA isolation or fixed in 4% formalin for
histopathologic studies.
RNA was extracted from different organs and analyzed
by 1-step RT-PCR by using high fidelity PCR enzyme
blend (Roche Applied Science, Mannheim, Germany) for
NiV nucleoprotein expression as described (12). Detection of NiV-specific antibodies in the serum was performed
simultaneously for all samples by ELISA and virus neutralization assays as described (13). Immunohistochemical
analysis was conducted on formalin-fixed, paraffin-embedded tissues as described (6).
Onset of clinical illness was observed between 7 and
19 days postinfection (dpi), with development in the animals of anorexia, weight loss, and depression (characterized by slumped, collapsed body posture and lack of responsiveness to the environmental triggers). These clinical
signs progressed for several hours and were associated with
hyperthermia and an acute respiratory syndrome characterized by dyspnea and hyperventilation. During the course
of the disease, the animals became more obtunded and
had uncoordinated motor movements, ending, in some instances, with a loss of consciousness and coma (Table 1).
Although clinical signs were seen in monkeys infected intranasally and intravenously, the disease lasted longer in
1
These authors contributed equally to this article.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
507
DISPATCHES
Table 1. Clinical course of NiV infection in 12 squirrel monkeys*
Mode of
Dose,
Day of 1st
Duration of
Day of
infection
PFU/mL
symptoms clinical state euthanasia
Monkey
3
–
–
3
IV
10
A†
3
10
3
12†
IV
10
B
C
IV
10
Clinical state at
euthanasia
Well
Moribund
3
19
3
21‡
Moribund
7
–
7
–
2
3
8†
Well
Moribund
D†
E
IV
IV
10
7
10
F
G†
H
I
J†
K
IV
IN
IN
IN
IN
IN
10
3
10
3
10
3
10
7
10
7
10
7
14
–
–
8
–
3
–
–
3
–
52
4
52
56
4
17
Recovered/well
Well
Well
Recovered/well
Well
L
IN
10
7
10
7
56
Recovered/well
Clinical signs
None
Uncoordinated motor movements,
prostration and coma
Uncoordinated motor movements,
prostration, and coma
None
Uncoordinated motor movements,
prostration, and coma
Anorexia, depression
None
None
Anorexia, seizure
None
Septic shock not correlated with
NiV infection
Anorexia, seizure, edema of eyes
*IV, intravenous; IN, intranasal; NiV, Nipah virus.
†Early systematic euthanasia.
‡Death caused by Nipah virus infection.
intranasally infected animals (7 days) than in intravenously
infected monkeys (2–3 days). With the latter, death was observed in 3 of 4 animals in which the disease was allowed
to proceed. Clinical signs of illness for intranasally infected
monkeys were milder and seen only in 2 of 4 animals before recovery after 3–7 days of illness. Clinical signs observed in monkeys appear to be similar to those reported
for human infection, including involvement of neurologic
and respiratory systems. In addition, the incubation period
for the acute human infection in Malaysia was estimated
to be from a few days to 2 weeks, total duration of illness
ranged 2–34 days, and the rate of subclinical infection was
≈25% (6,14). It is possible that the inclusion of more animals in the study would have given higher heterogeneity
in the course of disease, as seen in humans. Intravenous
infection was much more efficient than the intranasal route
in monkeys, probably because of a better delivery of the
virus to different tissues.
NiV-specific RNA was detected in various organs only in
intravenously infected animals (online Appendix Table, www.
cdc.gov/EID/content/16/3/507-appT.htm), demonstrating a
differential virus spread, depending on time after infection
and virus dose. Early detection after infection (3 dpi) was
possible only in animal D, which was infected with a high
Figure. Pathologic signs associated with
Nipah virus infection in squirrel monkeys.
A) Focal inflammation in the lung (monkey
B). Hematoxylin and eosin stains; original
magnification ×10. B) Viral antigens
(brown staining) were immunolocalized
to the alveolar walls (monkey E). C)
brain neuron (monkey B). D) Tubular and
extratubular cells in the kidney (monkey E).
E) Lymphoid cells in the spleen (monkey
D). B–E, immunoperoxidase stains, original
magnification ×20.
508
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Infection of Squirrel Monkeys with Nipah Virus
dose of NiV. Animal F, which recovered from the disease,
although positive for NiV (by RT-PCR) in the PBMC sample 2 dpi, was negative after necropsy on day 52, when virus
was probably eliminated from the monkey. Detection of viral
RNA in different tissues (liver, brain, spleen, kidney, lung,
lymph nodes) early after infection suggests a rapid propagation of NiV and tropism for various tissues. Viral RNA was
found in PBMC taken at different time points after infection,
suggesting the role of these cells in viral propagation in the
monkey. In contrast to what has been observed in hamsters
(9), viral RNA was not detected in any urine samples from
analyzed animals, thus excluding urine as a possible mode of
virus dissemination in this species.
Monkeys showed mild histologic lesions, including
the inflammation most obvious in the lung parenchyma
(Figure, panel A). In contrast to human infection, vasculitis
and brain abnormalities were much less evident. However,
immunohistochemistry showed viral antigens immunolocalized to the brain, lung, spleen, and kidney extravascular
parenchyma, thus confirming viral infection in these organs
(Figure, panels B–E).
NiV-specific immunoglobulin (Ig) M responses were
observed starting from 8 dpi for all monkeys except in
groups H and I (Table 2). This finding suggests that 103 PFU
of NiV delivered intranasally was probably insufficient to
induce infection in monkeys. Although NiV-specific anti-
Table 2. Detection of anti–Nipah virus antibodies in 12 squirrel monkeys by ELISA and seroneutralization assay*
Day postinfection
Mode of
Monkey
infection†
Serology‡
2
3 or 4
8 or 9
12
17
30
3
A§
IV 10
IgM
–
Neg
3
IV 10
IgG
–
Neg
3
IV 10
Neutralization
–
Neg
3
IgM
Neg
–
Neg
0.396
B¶
IV10
3
IV10
IgG
Neg
–
Neg
Neg
3
IV10
Neutralization
Neg
–
Neg
Neg
3
IgM
Neg
–
0.664
–
–
C¶
IV10
3
IV10
IgG
Neg
–
Neg
–
–
3
Neutralization
Neg
–
Neg
–
–
IV10
7
D§
IV 10
IgM
–
Neg
7
IV 10
IgG
–
Neg
7
Neutralization
–
Neg
IV 10
7
E¶
IV 10
IgM
Neg
–
1.343
7
IV 10
IgG
Neg
–
0.562
7
Neutralization
Neg
–
40
IV 10
7
F
IV 10
IgM
Neg
–
1.550
–
–
0.374
7
IV 10
IgG
Neg
–
0.369
–
–
2.867
7
Neutralization
Neg
–
80
–
–
>1,280
IV 10
3
IgM
Neg
Neg
G§
IN 10
3
IN 10
IgG
Neg
Neg
3
Neutralization
Neg
Neg
IN 10
3
IgM
–
–
Neg
–
–
Neg
H
IN 10
3
IN 10
IgG
–
–
Neg
–
–
Neg
3
Neutralization
–
–
Neg
–
–
Neg
IN 10
3
IgM
–
–
Neg
–
–
Neg
I
IN 10
3
IN 10
IgG
–
–
Neg
–
–
Neg
3
IN 10
Neutralization
–
–
Neg
–
–
Neg
7
IgM
–
Neg
J§
IN 10
7
IN 10
IgG
–
Neg
7
IN 10
Neutralization
–
Neg
7
IgM
Neg
–
–
–
0.286
K
IN 10
7
IN 10
IgG
Neg
–
–
–
1.757
7
IN 10
Neutralization
Neg
–
–
–
80
7
IgM
–
–
0.375
0.248
L
IN 10
7
IN 10
IgG
–
–
Neg
2.078
7
Neutralization
–
–
Neg
320
IN 10
37
52 or 56
–
–
–
0.175
3.023
>1,280
–
–
–
Neg
Neg
Neg
Neg
Neg
Neg
Neg
Neg
Neg
Neg
2.308
320
*IV, intravenous; Ig, immunoglobulin; neg, negative; IN, intranasal.
†Mode of infection and delivered viral dose (in PFU).
‡IgG and IgM antibodies were determined by ELISA and results are presented as absorbance readings. Neutralization titers are expressed as reciprocal
values of 2-fold serum dilutions required to completely inhibit cytopathic effect of 25 PFU of NiV on Vero cells.
§Early systemic euthanasia: 3 days postinfection (dpi) (A and D) or 4 dpi (G and J).
¶Death caused by NiV infection: B, 12 dpi; C, 21 dpi; E, 8 dpi.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
509
DISPATCHES
bodies were detected by ELISA in animals dying from the
infection, sufficient titers of neutralizing antibodies did not
develop in these monkeys and they were therefore not protected. These findings suggest the protective role of high
neutralization titers in NiV infection. Our results agree with
other studies of NiV infection that reported most human
patients with fatal NiV infection had IgG and IgM in their
serum and cerebrospinal fluid (6,15); neutralization titers
were not analyzed in those studies.
Our results suggest some similarities of NiV pathogenesis in humans and squirrel monkeys, including development of clinical signs, progression of infection, and
humoral immune response. We conclude that the squirrel
monkey can be used as an animal model for experimental
studies of NiV infection, and these results pave the way for
further study.
4.
5.
6.
7.
8.
9.
10.
Acknowledgments
We thank BioSafety team members from BSL-4 Laboratory
“Jean Mérieux” for their assistance.
The work was supported by Institut Pasteur, Institut national
de santé et de la recherché médicale, ANR 2005 program “Microbologie, infections et immunités” (ANR-05-MIIM-017-02), and
the government of Malaysia (IRPA 06-02-03-0000-PR0060/04).
Dr Marianneau is a senior scientist and project leader for flaviviruses and BSL-4 viruses at Institut Pasteur. His research is
focused on the physiopathology of hemorrhagic fever viruses and
other BSL-4 agents.
11.
12.
13.
14.
References
1.
2.
3.
510
15.
Chan YP, Chua KB, Koh CL, Lim ME, Lam SK. Complete nucleotide sequences of Nipah virus isolates from Malaysia. J Gen Virol.
2001;82:2151–5.
Harcourt BH, Lowe L, Tamin A, Liu X, Bankamp B, Bowden N,
et al. Genetic characterization of Nipah virus, Bangladesh, 2004.
Emerg Infect Dis. 2005;10:1594–7.
Luby SP, Rahman M, Hossain MJ, Blum LS, Husain MM, Gurley
E, et al. Foodborne transmission of Nipah virus, Bangladesh. Emerg
Infect Dis. 2006;12:1888–94.
Gurley ES, Montgomery J, Hossain MJ, Bell M, Azad AK, Islam
MR, et al. Person-to-person transmission of Nipah virus in a Bangladeshi community. Emerg Infect Dis. 2007;13:1031–7.
Chua KB, Goh KJ, Wong KT, Kamarulzaman A, Tan PS, Ksiazek
TG, et al. Fatal encephalitis due to Nipah virus among pig-farmers
in Malaysia. Lancet. 1999;354:1257–9. DOI: 10.1016/S0140-6736(99)04299-3
Wong KT, Shieh WJ, Kumar S, Norain K, Abdullah W, Guarner J, et
al. Nipah virus infection: pathology and pathogenesis of an emerging paramyxoviral zoonosis. Am J Pathol. 2002;161:2153–67.
Chua KB, Koh CL, Hooi PS, Wee KF, Khong JH, Chua BH, et al. Isolation of Nipah virus from Malaysian island flying-foxes. Microbes
Infect. 2002;4:145–51. DOI: 10.1016/S1286-4579(01)01522-2
Weingartl H, Czub S, Copps J, Berhane Y, Middleton D, Marszal P, et
al. Invasion of the central nervous system in a porcine host by Nipah
virus. J Virol. 2005;79:7528–34. DOI: 10.1128/JVI.79.12.75287534.2005
Wong KT, Grosjean I, Brisson C, Blanquier B, Fevre-Montange M,
Bernard A, et al. A golden hamster model for human acute Nipah
virus infection. Am J Pathol. 2003;163:2127–37.
Mungall BA, Middleton D, Crameri G, Bingham J, Halpin K, Russell G, et al. Feline model of acute Nipah virus infection and protection with a soluble glycoprotein-based subunit vaccine. J Virol.
2006;80:12293–302. DOI: 10.1128/JVI.01619-06
Contamin H, Behr C, Mercereau-Puijalon O, Michel J. Plasmodium falciparum in the squirrel monkey (Saimiri sciureus): infection of non-splenectomised animals as a model for exploring clinical
manifestations of malaria. Microbes Infect. 2000;2:945–54. DOI:
10.1016/S1286-4579(00)00401-9
Guillaume V, Contamin H, Loth P, Grosjean I, Courbot MC, Deubel V, et al. Antibody prophylaxis and therapy against Nipah virus infection in hamsters. J Virol. 2006;80:1972–8. DOI: 10.1128/
JVI.80.4.1972-1978.2006
Guillaume V, Wong KT, Looi RY, Georges-Courbot MC, Barrot
L, Buckland R, et al. Acute Hendra virus infection: analysis of the
pathogenesis and passive antibody protection in the hamster model.
Virology. 2009;387:459–65. DOI: 10.1016/j.virol.2009.03.001
Chua KB. Nipah virus outbreak in Malaysia. J Clin Virol.
2003;26:265–75. DOI: 10.1016/S1386-6532(02)00268-8
Chadha MS, Comer JA, Lowe L, Rota PA, Rollin PE, Bellini WJ,
et al. Nipah virus-associated encephalitis outbreak, Siliguri, India.
Emerg Infect Dis. 2006;12:235–40.
Address for correspondence: Branka Horvat, Institut national de santé et
de la recherché médicale, U758, 21 ave T. Garnier, Lyon 69007, France;
email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Q Fever in
Greenland
cats. Sea mammals include seals and walruses. Polar bears
are abundant throughout eastern Greenland; the nearest
sheep, horses, and musk oxen are >1,000 km away. There
are no cows and goats in Greenland.
Anders Koch, Claus Bo Svendsen,
Jens Jørgen Christensen, Henning Bundgaard,
Lars Vindfeld, Claus Bohn Christiansen,
Michael Kemp, and Steen Villumsen
We report a patient with Q fever endocarditis in a settlement in eastern Greenland (Isortoq, Ammassalik area).
Likely animal sources include sled dogs and seals. Q fever
may be underdiagnosed in Arctic areas but may also represent an emerging infection.
Q
fever is a zoonosis caused by the small intracellular
bacterium Coxiella burnetii. Main reservoirs for this
bacterium are cattle, goats, and sheep, although a wide
range of animals may be infected (1,2). C. burnetii can survive in a spore-like form under harsh conditions (2).
In animals, C. burnetii infection is often latent; the
bacteria may be persistently shed into the environment, especially at the time of giving birth (2). In humans, most
acute cases result in asymptomatic or mild influenza-like
disease; severe disease develops in a few patients. Primary
manifestations include pneumonia, hepatitis, and fever of
unknown origin.
Q fever has been described in >59 countries (1) but
not in Arctic areas. We report a patient with Q fever in
Greenland.
The Patient
The patient, a 40-year-old man, who resided in Greenland all his life, lived in Isortoq (population 100), a small
settlement in the Ammassalik area (population 3,000) of
eastern Greenland (Figure). He had worked as a hunter and
a sanitation worker (garbage collector). The Ammassalik
area includes the main town of Tasiilaq and 5 settlements.
Isortoq is located on an island off the coast of Greenland.
Access is by helicopter, boat during the summer, and dog
sleds and snowmobiles during the winter. The main occupation is hunting, especially of seals, which are consumed
locally. All other food is imported though Tasiilaq. All
imported meat is frozen, and only ultra-high-temperature–
pasteurized milk is available. Terrestrial mammals in the
area include sled dogs, polar foxes, and a few domesticated
Author affiliations: University Hospital Rigshospitalet, Copenhagen,
Denmark (A. Koch, H. Bundgaard, C.B. Christiansen); Statens Serum Institut, Copenhagen (A. Koch, C.B. Svendsen, J.J. Christensen, M. Kemp, S. Villumsen); and Tasiilaq Health Center, Tasiilaq,
Greenland (L. Vindfeld)
DOI: 10.3201/eid1603.091220
Figure. A) Ammassalik area (box) in Greenland. B) Main towns
in the Ammassalik area. Red circles show the main town of
Tasiilaq and 5 settlements. Location of the airport is indicated.
Reprinted with permission of the National Survey and Cadastre
[Kort og Matrikelstyrelsen], Danish Ministry of the Environment,
Copenhagen, Denmark.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
511
DISPATCHES
In December 2007, the patient came to Tasiilaq Health
Center with dyspnea, chest pains, and fever that had lasted
2 months. In 2001, because he had had rheumatic fever during childhood, he had biological aortic and mitral valves
implanted. As a result, he was at increased risk for Q fever endocarditis (3). However, he was healthy and had not
taken any medications during the preoperative period.
In January 2008, the patient was transferred to University Hospital Rigshospitalet in Copenhagen, Denmark.
Clinical findings included low-grade fever, cardiac insufficiency with peripheral edema, hepatosplenomegaly, and
20% half-moon nephritis; a transesophageal echocardiograph did not show signs of endocarditis. Repeated blood
cultures were negative for bacteria.
In May 2008, an echocardiograph showed aorta and
mitral valve vegetations and stenoses. Subsequent surgery
showed massive endocarditis. His biological valves were
replaced with mechanical valves. Recovery was uneventful, signs of heart failure disappeared, and laboratory test
results and cardiac function gradually returned to reference
levels.
A sample from his resected cardiac valves was subjected to routine partial 16S rRNA PCR and DNA sequencing (4). A BLAST search in the National Center for Biotechnology Information (Bethesda, MD, USA) database
showed 502 of 502 bp to be identical with those of C. burnetii. Identification was confirmed by PCR specific for the
C. burnetii transposase (IS1111a) gene by using primers
CoxiellaF1x (5′-GTA TCG GAC GTT TAT GGG GAT
GGG TAT CC-3′) and CoxiellaR1 (5′-CAC CAC GCG
CCA TCG TGA GTC-3′). PCR conditions were 10 cycles
at 95°C for 30 s and 75°C–65°C for 60 s and 40 cycles at
95°C for 30 s and 65°C for 60 s.
Subsequent culture in Vero cells was positive after
incubation for 30 days, and results were confirmed by indirect immunofluorescent assay with C. burnetii phase
II–specific antibodies (Australian Rickettsial Reference
Laboratory, Geelong, Victoria, Australia). A nearly fulllength sequence of the 16S rRNA gene was obtained by
DNA sequencing of culture material and yielded 1,321- of
1,321-bp sequence homology with C. burnetii, including
the original sequence obtained directly from the valve. This
DNA sequence has been submitted to GenBank (accession
no. 1188993 FJ787329) as the Ammassalik strain.
Blood obtained 27 days before surgery was positive by
C. burnetii–specific PCR. A sample contained high levels
of C. burnetii–specific antibodies by immunofluorescent
assay (Focus Diagnostics, Cypress, CA, USA): immunoglobulin (Ig) M titer phase I, 16,000; IgM phase II, 16,000;
IgG phase I, 512,000; and IgG phase II, 1,024,000.
In April 2004, the patient had participated in a population-based screening in the Ammassalik area for antibodies
against Trichinella spp. and Anisachis spp. (5). His serum
512
was stored at –80°C at Statens Serum Institut and tested for
antibodies against C. burnetii after illness was reported in
2008; results for IgM and IgG were negative. Except for
his cardiac surgery in 2001 in Copenhagen, the patient had
never been outside the Ammassalik area.
Conclusions
The patient was likely infected in the Ammassalik
area in 2007, rather than during or before 2004. His stored
serum sample was negative for C. burnetii in 2004. The
lack of domesticated ruminants may be the reason why Q
fever has not been described in Arctic areas. Although C.
burnetii has not been isolated from Arctic animals, some
musk oxen in northern Quebec and reindeer in Arctic Russia (Nenet region) have been found to be positive for IgG
against C. burnetii (6,7). Likewise, <0.6% of Inuits from
Nunavik, 15% of trappers, and 18% of Cree hunters from
interior regions of southern Quebec have been found to be
positive for IgG against C. burnetii (8–10).
In the absence of raw milk products, animals represent
the most likely source of infection in eastern Greenland.
C. burnetii has been found in dogs, cats, birds (2), seals
(11), and bears (12,13) in other regions. For our patient,
we cannot rule out the possibility that infection may have
been caused by a domestic cat that may have traveled with
its owner to a region endemic for Q fever or by migratory
birds. However, because endocarditis is a rare manifestation of Q fever and affects <0.5% of all case-patients (2), C.
burnetii may be endemic to the Arctic area. The most likely
animal reservoirs would be sled dogs or seals because a
herd of a certain size is necessary to sustain infection in an
animal population. Sled dogs are mostly kept chained in
groups, and bacteria may spread from infected placentas to
other dogs and humans in the vicinity. Seals are abundant
in the Ammassalik area and represent a major human food
source. Harbor and hooded seals form colonies at time of
giving birth, when infection is most likely to spread (11).
Polar foxes and bears are less likely reservoirs because
their populations are less dense (2).
Whether Q fever is an underdiagnosed or emerging
disease in the Arctic area is unknown. Because many cases
are asymptomatic and laboratory facilities in Greenland are
few, this disease, although rare, may be underdiagnosed in
this country. However, Q fever may also be an emerging
infection, possibly related to climate changes, as seen elsewhere in the Arctic area (14).
Serologic studies of persons in the Arctic region, including Greenland, may shed light on these issues. Possible
animal reservoirs may be identified by serologic studies of
wildlife. In addition, health authorities in the Arctic area
need to be aware of C. burnetii as a possible infectious
agent.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Q Fever in Greenland
Acknowledgments
We thank the patient for permission to publish his medical
history; staff members at the hospitals to which the patient had
been referred, particularly Hans Christian Florian Sørensen, Karin
Ladefoged, Søren Thybo, Jørgen Kurtzhals, and Karen A. Krogfelt, for assistance; Lone Nukaaraq Møller for permission to use
the stored serum sample from 2004; Kathrine Friholm Villumsen for information about behavior of Arctic animals; and Benoit
Levesque for information about Q fever in the Arctic region of
Canada.
S.V. is a member of MedVetNet, Centre of Excellence,
which was supported by grant FP7.
Dr Koch is a senior researcher in the Department of Epidemiology Research, Statens Serum Institut, and physician in
the Department of Infectious Diseases, University Hospital Rigshospitalet, Copenhagen, Denmark. His main research interests
include infectious disease epidemiology, host response, and susceptibility to infections.
2.
3.
4.
5.
7.
8.
9.
10.
11.
12.
13.
References
1.
6.
Norlander L. Q fever epidemiology and pathogenesis. Microbes Infect. 2000;2:417–24. DOI: 10.1016/S1286-4579(00)00325-7
Maurin M, Raoult D. Q fever. Clin Microbiol Rev. 1999;12:518–
53.
Fenollar F, Fournier PE, Carrieri MP, Habib G, Messana T, Raoult D.
Risks factors and prevention of Q fever endocarditis. Clin Infect Dis.
2001;33:312–6. DOI: 10.1086/321889
Gleesen AS, Grarup C, Dargis R, Andresen K, Christensen JJ, Kemp
M. PCR and DNA sequencing in establishing the aetiology of bacterial infections in children. APMIS. 2008;116:811–5. DOI: 10.1111/
j.1600-0463.2008.00793.x
Møller LN. Epidemiology of trichinella in Greenland: occurrence in
animals and man [doctoral thesis]. Copenhagen: The Royal Veter-
14.
nary and Agricultural University; 2006.
Seguin G, Lair S, Dallaire AD. Muskoxen (Ovibos moschatus) of
Nunavik: state of health and food safety. Wildlife Health Centre
Newsletter. 2008;13:6–7.
Timofeeva SS. Data on the incidence of Q fever in the Arctic region
(preliminary report) [in Russian]. Tr Leningr Inst Epidemiol Mikrobiol. 1963;25:70–4.
Messier V, Levesque B, Proulx JF, Ward BJ, Libman M, Couillard
M, et al. Zoonotic diseases, drinking water and gastroenteritis in
Nunavik: a brief portrait. Kuujjuaq (Quebec, Canada): Nunavik Regional Board of Health and Social Services; 2007.
Levesque B, De SG, Higgins R, D’Halewyn MA, Artsob H, Grondin
J, et al. Seroepidemiologic study of three zoonoses (leptospirosis, Q
fever, and tularemia) among trappers in Quebec, Canada. Clin Diagn
Lab Immunol. 1995;2:496–8.
Levesque B, Messier V, Bonnier-Viger Y, Couillard M, Cote S, Ward
BJ, et al. Seroprevalence of zoonoses in a Cree community (Canada). Diagn Microbiol Infect Dis. 2007;59:283–6. DOI: 10.1016/j.
diagmicrobio.2007.06.002
Lapointe JM, Gulland FM, Haines DM, Barr BC, Duignan PJ. Placentitis due to Coxiella burnetii in a Pacific harbor seal (Phoca vitulina richardsi). J Vet Diagn Invest. 1999;11:541–3.
Madic J, Huber D, Lugovic B. Serologic survey for selected viral
and rickettsial agents of brown bears (Ursus arctos) in Croatia. J
Wildl Dis. 1993;29:572–6.
Dunbar MR, Cunningham MW, Roof JC. Seroprevalence of selected
disease agents from free-ranging black bears in Florida. J Wildl Dis.
1998;34:612–9.
McLaughlin JB, DePaola A, Bopp CA, Martinek KA, Napolilli NP,
Allison CG, et al. Outbreak of Vibrio parahaemolyticus gastroenteritis associated with Alaskan oysters. N Engl J Med. 2005;353:1463–
70. DOI: 10.1056/NEJMoa051594
Address for correspondence: Anders Koch, Department of Epidemiology
Research, Statens Serum Institut, Artillerivej 5, DK-2300 Copenhagen S,
Denmark; email: [email protected]
Use of trade names is for identification only and does not imply
endorsement by the Public Health Service or by the U.S.
Department of Health and Human Services.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
513
DISPATCHES
Banna Virus,
China, 1987–2007
Hong Liu, Ming-Hua Li, You-Gang Zhai,
Wei-Shan Meng, Xiao-Hong Sun, Yu-Xi Cao,
Shi-Hong Fu, Huan-Yu Wang, Li-Hong Xu,
Qing Tang, and Guo-Dong Liang
Banna viruses (BAVs) have been isolated from pigs,
cattle, ticks, mosquitoes, and human encephalitis patients.
We isolated and analyzed 20 BAVs newly isolated in China;
this finding extends the distribution of BAVs from tropical
zone to north temperate climates and demonstrate regional
variations in BAV phylogeny and mosquito species possibly
involved in BAV transmission.
B
anna virus (BAV), the prototype species of genus Seadornavirus within the family Reoviridae, has a genome composed of 12 segments of double-stranded RNA
(1). BAV was initially isolated from persons with encephalitis and fever in Xishuangbanna, Yunnan Province,
People’s Republic of China, in 1987 (2). Since then, BAV
isolates have been obtained from pigs, cattle, and ticks in
China (3,4) and from mosquitoes in Indonesia, China, and
Vietnam. (5–7). BAV is a BioSafety Level 3 arboviral agent
that is pathogenic to humans and may well be an emerging
pathogen or undiagnosed cause of human viral encephalitis
in some areas (1). Our objective was to describe new BAV
isolates from China and to define the geographic distribution and the phylogenetic relationships of these isolates
with reference to the previously described isolates.
The Study
In this study, 20 new BAV isolates were obtained from
mosquitoes collected from July through September during
2006 to 2007 at sites in Gansu Province (latitude 32°–35°N,
104°–107°E), Liaoning Province (39°–41°N, 123°–125°E),
Shanxi Province (37°–38°N, 111°–113°E), and Inner Mongolia Province (41°–43°N, 121°–123°E) (Table, Figure 1).
Mosquito samples were collected by using 12 V, 200 mA
mosquito-trapping lamps (Wuhan Lucky Star Environmental Protection Tech Co., Ltd., Hubei, China) and by collecting mosquitoes from 8:00 PM to 11:00 PM at nearby cow
barns, a piggery, and fish pond sites where human activity
was frequent. Mosquitoes were put into a –20°C freezer for
30 min and then were rapidly sorted into pools of 50 to 100
Author affiliations: Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing,
People’s Republic of China
DOI: 10.3201/eid1603.091160
514
specimens according to species. The pools were put into
labeled tubes and stored in liquid nitrogen.
Viruses were isolated and BAV isolates were identified
using described procedures (8). Trizol reagent category no.
10296-028 (Invitrogen, Carlsbad, CA, USA) was used to
extract total RNA. cDNA was prepared by using Ready-toGo You-Prime First-Strand Beads Kit (Amersham Pharmacia Biotech, Piscatawy, NJ, USA) according to the manufacturer’s protocol. An 850-bp gene fragment from the
12th segment, which codes for the double-stranded RNA
binding protein, was amplified from the cDNA of the BAV
isolates by using previously published primers (9). PCR
products were recovered by using purification kits (QIAGEN, Valencia, CA, USA), and then were inserted into
pGEM-T easy vector (Promega, Madison, WI, USA). The
insert sequence was determined by using M13 universal
primers and an ABI Prism 3730 sequence analyzer (ABI,
Shirley, NY, USA).
The genomic sequences of the 12th segment for the
20 new BAV strains were determined (GenBank accession nos. GQ331954–GQ331973). Phylogenetic trees were
constructed from the amplified region of the 12th segment
sequence by using the molecular evolutionary genetics
analysis (MEGA) version 4 software (www.megasoftware.
net) from aligned nucleotide sequences. We used neighborjoining algorithms with 1,000 replicates for bootstrap support of tree groupings.
In this study, 38 BAV strains isolated during 1987–
2007 were analyzed, which included 30 strains isolated
in China (including 20 new BAV isolates first reported
in this study and 10 previously described isolates from
China (8,10–12), 3 strains from Indonesia, and 5 strains
from Vietnam) (Table). Initial BAVs were isolated from
Indonesia and Yunnan Province of China, which belong
to tropical and subtropical zones (2,5).The new BAV isolates in our study were observed in Gansu, Shanxi, Liaoning, and Inner Mongolia provinces of China (northern
China), which belong to the northern temperate zone.
These strains represent a geographic distribution ranging
from near the equator to latitude 45°N, extending from
the tropical zone to the northern temperate zone (Figure
1). These data show that the distribution of BAVs is not
limited to Southeast Asia but that it extends into northeast
Asia as well.
Before our study, BAV had been isolated from 7 mosquito species in 2 genera (Culex tritaeniorhynchus, Cx.
pipiens pallens, Cx. annulus, Cx. pseudovishnui, Cx. modestus, Anopheles sinensis, and Aedes vagus). To this list we
now add 3 species in the genus Aedes (Ae. albopictus, Ae.
vexans, and Ae. dorsalis (Table), which are widely distributed in China and elsewhere.
Phylogenetic analysis based on the complete coding
sequence (624 nt) of the 12th segment of the BAV genome
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Banna Virus, China
indicated that the BAV isolates evaluated in this study
could be divided into 2 phylogenetically different groups
(Figure 2). Isolates from China and Vietnam are included
in group A, and the strains from Indonesia are in group
B. Group A could be further divided into 2 subgroups,
A1 and A2. Subgroup A1 includes 4 independent clades
that group according to the location of collection and represent viruses from northern China (Gansu, Shanxi, and
Liaoning Provinces) as well as the Vietnam isolates. Subgroup A2 includes isolates mainly from southern China
(Yunnan Province) and Vietnam, which is contiguous
with Yunnan Province of China, as well as 2 isolates from
northern China (BJ95-75/Beijing, and NM0706/Inner
Mongolia) (Figure 1).
Conclusions
Our results demonstrate that BAV strains are distributed from the tropics of Southeast Asia to the northern
temperate regions of China. These observations suggest
that the distribution of BAV is wider than previously recognized and may be increasing. Consistent with previous
observations (9), we report that BAV isolates from China
cluster in group A and separate into subgroups mainly according to the geographic origin of the isolate; subgroup
A1 is found in the north and subgroup A2 in the south.
However, 2 isolates from northern China grouped in subgroup A2 (south), and 3 isolates from Vietnam grouped in
subgroup A1 (north).
Considering that group A isolates are geographically
located across the monsoon climate zone, where south-to-
Table. Distribution of Banna viruses in regions and vectors, China
Region
Temperate
zone
Country
China
Province
Gansu
Shanxi
Inner
Mongolia
Liaoning
Subtropical
zone
China
Vietnam
Beijing
Yunnan
Quang
Binh
Ha Tay
Tropical
zone
Indonesia
Java
Strain
GS07-KD12
GS07-KD15
GS07-KD16
GS07-KD18
GS07-KD27
GS07-KD29
GS07-KD30
GS07-KD32
GS07-KD38
GS-KD42-2
SX0765
SX0766
SX0767
SX0771
SX0789
SX0790
SX0793
SX0794
SX0795
SX0796
NM0706
Origin
Cow barn
Cow barn
Cow barn
Cow barn
Piggery
Piggery
Piggery
Piggery
Piggery
Piggery
Piggery
Piggery
Piggery
Piggery
Piggery
Piggery
Piggery
Piggery
Piggery
Piggery
Fishpond
Date of
collection
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2006 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
2007 Aug
Vector
Anopheles sinensis
Culex tritaeniorhynchus
Cx. pipiens pallens
An. sinensis
Cx. tritaeniorhychus
Aedes albopictus
Cx. pipiens pallens
Cx. pipiens pallens
Cx. pipiens pallens
Cx. tritaeniorhychus
Cx. pipiens pallens
Cx. pipiens pallens
Ae. vexans
Cx. pipiens pallens
Ae. dorsalis
Ae. vexans
Cx. pipiens pallens
Ae. dorsalis
Cx. pipiens pallens
Cx. pipiens pallens
Cx. modestus
Accession
no.
GQ331954
GQ331955
GQ331956
GQ331957
GQ331958
GQ331959
GQ331960
GQ331961
GQ331962
FJ160414
GQ331963
GQ331964
GQ331965
GQ331966
GQ331967
GQ331968
GQ331969
GQ331970
GQ331971
GQ331972
GQ331973
Reference
This study
This study
This study
This study
This study
This study
This study
This study
This study
(8)
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
LN0684
LN0688
Piggery
Piggery
2006 Aug
2006 Aug
An. sinensis
An. sinensis
FJ217989
FJ217990
(11)
(11)
LN0689
BJ95-75
YN-6
YN0556
YN0558
YN0659
02VN180b
Piggery
Unknown
Unknown
Unknown
Unknown
Unknown
Unknown
2006 Aug
1995
2001
2005 Jul
2005 Jul
2005 Jul
2002 Aug
An. sinensis
Unidentified mosquito
Unidentified mosquito
Cx. tritaeniorhychus
Cx. tritaeniorhychus
An. sinensis
Cx. tritaeniorhychus
FJ217991
AY568289
AY568290
FJ161966
FJ161964
FJ161965
EU265727
(11)
(12)
(12)
(10)
(10)
(10)
(7)
02VN178b
02VN018b
02VN009b
02VN078b
JKT-6423
JKT-6969
JKT-7043
Unknown
Unknown
Unknown
Unknown
Unknown
Unknown
Unknown
2002 Aug
2002 Mar
2002 Jan
2002 May
1980
1981
1981
Cx. tritaeniorhychus
Cx. annulus
Cx. annulus
Cx. tritaeniorhychus
Cx. pseudovishnui
Ae. vagus
Cx. pipiens pallens
EU265715
EU265694
EU265682
EU265705
NC004198
AF052008
AF052024
(7)
(7)
(7)
(7)
(5)
(5)
(5)
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
515
DISPATCHES
Figure 1. Location of new Banna viruses (BAVs)
isolated in China (red triangles) and previously
reported BAV isolation sites (black triangles).
Countries reporting isolation of BAV are shaded.
The names of the countries that are contiguous
with BAV isolation sites are labeled. BAV
distribution sites in Indonesia, Vietnam, and part
of China are located in tropical zones, which lie
predominantly between the Tropic of Cancer and
the equator. Most BAV distribution sites in China
in the area from the Tropic of Cancer to latitude
45°N belong to the northern temperate zone.
45r
Mongolia
Liaoning
Inner Mongolia
North Korea
Beijing
Shanxi
Gansu
30r
China
Tropic of Cancer
Yunnan
Burma
Laos
15r
Vietnam
0r
Indonesia
north winds are common during summer (13), BAV could
be transferred in infected mosquitoes during this period by
the prevailing winds that move from Southeast Asia to east
Asia. In addition, bird migration, has been associated with
the movement of other pathogens, and migration of infected
birds through the east Asia–Australasia flyway (13), which
traverses the region, may also account for this association.
However, the transmission dynamics of BAVs are not well
known. Further study is required to determine if winds and
birds are involved in dispersal of the virus.
Our observations suggest that the public health impact
of BAV may be underestimated. BAV appears to be ac-
GS07KD30/Gansu China/2007/Culex pipiens pallens
GS07KD32/Gansu China/2007/Cx. pipiens pallens
GS07KD27/Gansu China/2007/Cx. tritaeniorhynchus
GS07KD29/Gansu China/2007/Aedes albopictus
98
Gansu
clade
GS07KD15/Gansu China/2007/Cx. tritaeniorhynchus
GS07KD38/Gansu China/2007/Cx. pipiens pallens
GS07KD16/Gansu China/2007/Cx. pipiens pallens
98
GS07KD18/Gansu China/2007/Anopheles sinensis
64
GS07KD12/Gansu China/2007/An. sinensis
02VN078b/HaTay Vietnam/2002/Cx. tritaeniorhynchus
02VN180b/Quang Binh Vietnam/2002/Cx. tritaeniorhynchus
75
99
Vietnam
clade
02VN009b/HaTay Vietnam/2002/Cx. annulus
GS42-2/Gansu China/2006/Cx. tritaeniorhynchus
72 SX0789 /Shanxi China/2007/Ae. dorsalis
SX0790/Shanxi China/2007/Ae. vexans
95
A1
SX0793/Shanxi China/2007/Cx. pipiens pallens
52
SX0794/Shanxi China/2007/Ae. dorsalis
67 SX0765/Shanxi China/2007/Cx. pipiens pallens
99
44 SX0766/Shanxi China/2007/Cx. pipiens pallens
99
SX0771/Shanxi China/2007/Cx. pipiens pallens
ShanXi
clade
A
Figure 2. Phylogenetic analysis based on the
complete coding sequence of the 12th segment
of Banna viruses (BAVs) currently isolated.
Phylogenetic analyses were performed by the
neighbor-joining method using MEGA version
4 software (www.megasoftware.net). Bootstrap
probabilities of each node were calculated with
1,000 replicates. The tree was rooted by using
Kadipiro virus and Liaoning virus as the outgroup
viruses. Scale bars indicate a genetic distance of
0.1-nt substitutions per site. Isolates obtained in
China are in boldface. Viruses were identified by
using the nomenclature of virus strain/country/
year of isolation/origin.
SX0796/Shanxi China/2007/Cx. pipiens pallens
54
SX0795/Shanxi China/2007/Cx. pipiens pallens
69
SX0767/Shanxi China/2007/Ae. vexans
83
LN0689/Liaoning China/2006/An. sinensis
LN0688/Liaoning China/2006/An. sinensis
100
LiaoNingi
clade
LN0684/Liaoning China/2006/An. sinensis
YN0659/Yunnan China/2006/An. sinensis
94
100
02VN018b/Quang Binh Vietnam/2002/Cx. annulus
44
02VN178b/Quang Binh Vietnam/2002/Cx. tritaeniorhynchus
100
YN0558/Yunnan China/2005/Cx. tritaeniorhynchus
A2
NM0706/Inner Mongolia China/2007/Cx. modestus
97
YN0556/Yunnan China/2005/Cx. tritaeniorhynchus
55
YN6/Yunnan China/2001/unidentified mosquito
47
BANNAch/Yunnan China/1987/patient
67
95
BJ9575/Beijing China/1995/unidentified mosquito
JKT6969/Java Indonesia/1981/An. vagus
JKT6423/Java Indonesia/1980/Cx. pseudovishnui
100
97
B
JKT7043/Java Indonesia/1981/Cx. pipiens pallens
KDVJKT 7075/Java Indonesia/1981/Cx. fuscocephalus
100
KDVYN0557/Yunnan China/2005/mosquito
LNVNE9731/LiaoNing China/1997/Ae. dorsalis
100
0.1
516
48
LNVNE9712/LiaoNing China/1997/Ae. dorsalis
LNV0507JS60/Xing Jiang China/2005/Culex sp.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Banna Virus, China
tively circulating in areas where Japanese encephalitis virus (JEV) is endemic (14) and where C. tritaeniorhynchus,
which is the main vector of JEV, is active. This mosquito
also appears to be a common vector of BAV. The clinical
symptoms of disease caused by the 2 viruses is similar, and
BAV cases may be undetected during a JE outbreak. It has
been reported that ≈14% of clinically diagnosed JE cases
are BAV immunoglobulin (Ig) M positive (15), indicating
that BAV epidemics may have occurred but have been clinically misdiagnosed as Japanese encephalitis. The apparent
active transmission of BAV over a large geographic area,
genetic variation between geographic regions, and the potential to cause severe disease underscore the need for additional surveillance, further characterization, and improved
diagnostic systems worldwide.
2.
3.
4.
5.
6.
7.
8.
9.
Acknowledgments
We thank Roger S. Nasci for consultation and assistance in
the preparation and writing of this manuscript.
This work was supported by grants from the Ministry of Science and Technology, China (2003BA712A08-01; 2008ZX10004008); Chinese CDC–US Centers for Disease Control and Prevention Cooperative Agreement U19-GH000004; Development
Grant of State Key Laboratory for Infectious Disease Prevention
and Control (2008SKLID105); and Programme of Research Advance, China-France, B-06-04.
Ms Liu is a PhD candidate at the State Key Laboratory for
Infectious Disease Prevention and Control, Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control
and Prevention. She specializes in medical microbiology, and her
current research interests include the detection and investigation
of arboviruses and associated disease.
References
1.
Attoui H, Mohd Jaafar F, Micco P, Lamballerie X. Coltiviruses and
seadornaviruses in North America, Europe, and Asia. Emerg Infect
Dis. 2005;11:1673–9.
10.
11.
12.
13.
14.
15.
Xu P, Wang Y, Zuo J, Lin J, Xu PM. New orbiviruses isolated from
patients with unknown fever and encephalitis in Yunnan province [in
Chinese]. Chin J Virol. 1990;6:27–33.
Xu P, Wang Y, Zuo J, Lin J. Recovery of the same type of virus as
human new orbivirus [in Chinese]. Chin J Virol. 1990;6:328–32.
Li QP, Xe XC. First isolation of new orbivirus (Banna) from ticks
and infected cattle sera in Xingjiang [in Chinese]. Endemic Dis Bull.
1992;7:64–9.
Brown SE, Gorman M, Tesh B, Knudson L. Coltiviruses isolated
from mosquitoes collected in Indonesia. Virology. 1993;196:363–7.
Chen B, Tao SJ. Arboviruses survey in China in recent ten years.
Chin Med J (Engl). 1996;109:13–5.
Nabeshima T, Thi Nga P, Guillermo P, Parquet MC, Yu F, Thanh TN,
et al. Isolation and molecular characterization of Banna virus from
mosquitoes, Vietnam. Emerg Infect Dis. 2008;14:1276–9. DOI:
10.3201/eid1408.080100
Zhai YG, Wang HQ, Xu HK, Meng WS, Chao YX, Fu SH, et al.
Investigation on arboviruses in Tianshui and Longnan regions of
Gansu Province [in Chinese]. Chin J Zoonoses. 2008;24:59–63.
Billoir F, Attoui H, Simon S, Gallian P, Micco P, Lamballerie X. Molecular diagnosis of group B coltiviruses infections. J Virol Methods.
1999;81:39–45. DOI: 10.1016/S0166-0934(99)00055-5
Sun X, Fu S, Gong Z, Ge J, Meng W, Feng Y, et al. Distribution
of arboviruses and mosquitoes in northwestern Yunnan Province,
China. Vector Borne Zoonotic Dis. 2009; 10.1089/vbz.2008.0145.
Meng WS, Zhang JB, Sun XH, Liu QN, Chen Z, Zhai YG, et al. Isolation and identification of arboviruses from mosquito pools in some
regions of Liaoning Province, China [in Chinese]. Chin J Epidemiol.
2009;30:50–4.
Xu LH, Tao SJ, Cao YX. Genotyping of the Chinese isolation of
coltivirus [in Chinese]. Chin J Virol. 2003;17:346–9.
Nga PT, del Carmen Parquet M, Cuong D, Ma P, Hasebe F, Inoue S,
et al. Shift in Japanese encephalitis virus (JEV) genotype circulating
in northern Vietnam: implications for frequent introduction of JEV
from Southeast Asia to East Asia. J Gen Virol. 2004;85:1625–31.
DOI: 10.1099/vir.0.79797-0
Erlanger TE, Weiss S, Keiser J, Utzinger J, Wiedenmayer K. Past,
present, and future of Japanese encephalitis. Emerg Infect Dis.
2009;15:1–7. DOI: 10.3201/eid1501.080311
Tao SJ, Chen BQ. Studies of coltivirus in China. Chin Med J (Engl).
2005;118:581–6.
Address for correspondence: Guo-Dong Liang, State Key Laboratory
for Infectious Disease Prevention and Control, Institute for Viral
Disease Control and Prevention, Chinese Center for Disease Control and
Prevention, 100 Yingxin St., Xuanwu District, Beijing 100052, People’s
Republic of China; email: [email protected]
The Public Health Image Library (PHIL)
The Public Health Image Library (PHIL), Centers for Disease Control and
Prevention, contains thousands of public health-related images, including
high-resolution (print quality) photographs, illustrations, and videos.
PHIL collections illustrate current events and articles, supply visual content
for health promotion brochures, document the effects of disease, and
enhance instructional media.
PHIL Images, accessible to PC and Macintosh users, are in the public
domain and available without charge.
Visit PHIL at http://phil.cdc.gov/phil.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
517
DISPATCHES
Bluetongue Virus
Serotypes 1 and 4
in Red Deer, Spain
Belén Rodríguez-Sánchez, Christian Gortázar,
Francisco Ruiz-Fons,
and José M. Sánchez-Vizcaíno
We studied the potential of red deer as bluetongue
maintenance hosts and sentinels. Deer maintained detectable bluetongue virus (BTV) serotype 4 RNA for 1 year after
the virus was cleared from livestock. However, the virus was
not transmitted to yearlings. BTV serotype 1 RNA was detected in red deer immediately after its first detection in cattle.
B
luetongue (BT) is a vector-borne disease caused by a
virus belonging to the genus Orbivirus, with 24 known
serotypes (1). Since 2000, four of these seroptypes have
been found in Spain on 5 occasions: 1) Bluetongue virus
serotype 2 (BTV-2) was detected in 2000 in the Balearic
Islands, 2) BTV-4 was detected in 2003 in the Balearic Islands, 3) a different BTV-4 strain was detected in 2004 in
southern Spain, 4) BTV-1 was detected for the first time
in 2007 in Spain, and 5) BTV-8 was detected in 2008 in
Spain after it entered through the border with France. In
livestock, BTV-4 was detected for the last time in November 2006, and the country was declared free of BTV-4 in
March 2009 by the European Union Standing Committee
on the Food Chain and Animal Health (http://rasve.mapa.
es/Publica/Noticias/Ficheros/Informe libre serotipo 4 final.
pdf). Currently, all of Spain is considered a restriction zone
for BTV-1 and -8.
Sheep are considered the most vulnerable species for
BT, but other ruminants are known to play a major role in
BT epidemiology. The role of wild ruminants in the spreading and persistence of the virus has only begun to be elucidated. Several studies have reported the presence of either
BTV antibodies (2,3) or the virus (4) in red deer (Cervus
elaphus), roe deer (Capreolus capreolus), mouflons (Ovis
aries), and several other wild bovids and cervids (2,5). The
presence of BTV and BTV-specific antibodies in wild species underscores the role of these species, because, except
for mouflons (4), European wild ruminants generally are
asymptomatic hosts. The highest peak of stress occurs dur-
Author affiliations: Universidad Complutense de Madrid, Madrid,
Spain (B. Rodríguez-Sánchez, J.M. Sánchez-Vizcaíno); Instituto
de Investigación en Recursos Cinegéticos IREC, Ciudad Real,
Spain (C. Gortázar); and Department of Animal Health, Berreaga,
Derio, Bizkaia, Spain (F. Ruiz-Fons)
DOI: 10.3201/eid1603.090626
518
ing the mating period (August–September in Spain), which
is also the period of maximal activity for Culicoides imicola
mosquitoes. Therefore, all of these facts, together with the
capability of wild ruminants to overcome BT infection and
their free-range life, make deer suitable for BTV maintenance. We hypothesize that 1) BTV RNA would be detectable in red deer even after its control in livestock by vaccination, and 2) the virus or specific antibodies would be
detected in red deer early after its detection in livestock.
The Study
The study site was a deer farm with ≈900 hinds, including 550 adult hinds and 350 yearling hinds. This farm
is located in the Los Alcornocales Natural Park in the Cádiz
Province (Andalucía, southern Spain; 36°17′N, 5°47′W), an
area near the sea that is <500 m above sea level. Abundant
wild red deer and moderate densities of roe deer (Capreolus capreolus) are present in the area.
Blood samples were collected by cervical puncture
from 510 living farmed red deer, placed in sterile tubes containing EDTA, and frozen at –20°C. Samples from adult
deer hinds (n = 160) were obtained on July 12 and 13, 2007;
yearling stags (n = 350) were sampled on August 28, 2007.
We tested 200 serum samples by using a competitive
viral protein 7 (VP7) ELISA (Institute Pourquier, Montpellier, France). The samples were analyzed in duplicate
according to the manufacturer’s instructions.
After RNA extraction from 510 red deer blood samples, RNA was analyzed by using 4 reverse transcription–
PCRs (RT-PCRs): 1) a group-specific RT-PCR detecting
a conserved region within the BTV nonstructural protein
(NS) 1 segment (6); 2) a BTV-1 serotype-specific RTPCR (7); 3) a BTV-4 serotype-specific assay (8); and 4) a
group-specific RT-PCR that detects epizootic hemorrhagic
disease (EHD) (9). BTV-4 PCR was performed as a 1-step
real-time RT-PCR, and BTV-1, EHD, and the group-specific assays were conducted as gel-based, 1-step RT-PCRs.
Prevalence of BT antibodies and BTV-1 and BTV-4 RNA
and confidence intervals for prevalence (binomial exact,
Clopper-Pearson) were calculated by using Quatitative
Parasitology 3.0 software (10).
Of the analyzed serum samples, 57.60% showed positive results in the ELISA. The prevalence of BTV antibodies
was high; 92.45% of the adults were positive. All yearling
deer were ELISA negative except for 3 doubtful samples;
all of them had negative results in the BTV, BTV-1 and
BTV-4 RT-PCR assays (Figure 1).
Of the adult deer, 25% showed positive results in the
BTV group-specific PCR. Positive samples were sequenced
to confirm the presence of BTV nucleic acid and further
analyzed for the identification of the serotype. Six RNA
samples from adult deer were positive for the BTV-4–specific RT-PCR, and their sequences were confirmed by using
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Bluetongue Virus in Red Deer
Figure 1. Results of ELISA to detect bluetongue virus (BTV) viral
protein 7 in 200 serum samples collected from red deer, Spain.
Results from yearlings were negative; results from adults showed
an age-increasing trend of contact with BTV. Bars represent 95%
confidence intervals for prevalence (binomial exact, ClopperPearson).
BLAST software (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
None of the samples from adult deer were positive either
for BTV-1-specific or EHD-specific RT-PCRs. Yearlings,
however, showed a different pattern of results: 16.33% animals showed positive results in the group-specific and the
BTV-1–specific RT-PCRs. No yearling samples were positive by the BTV-4 specific RT-PCR.
No visible clinical signs were noticed, and no deaths
occurred. This result suggests that, although adult deer
maintained circulation of BTV-4 RNA, this serotype did
not infect the yearlings despite the presence of the vector
and the optimal conditions for infection in the study area.
Surprisingly, several animals were positive to the EHDspecific assay. However, when the PCR products were
purified and sequenced, none of the obtained sequences
showed homology with published EHD sequences. These
results support those found by Agüero et al. (11), in which
BTV-1–positive samples cross-reacted with the available
EHD primers. The amplified PCR product obtained had approximately the same size as the PCR product expected for
EHD, thus giving a false-positive result.
Conclusions
Our results agree with what was found in livestock
during surveillance programs: adult animals had probably
been in contact with BTV-4 during the outbreak that started
in southern Spain in 2004. In contrast to the vaccinated domestic ruminants, deer were able to maintain BTV-4 RNA,
thus confirming our initial hypothesis. However, detection
of BTV RNA without concurrent virus isolation does not
mean that deer are a long term reservoir host of BTV (12).
Simultaneous evaluation of adjacent cohorts of domestic
and wild ruminants by using the same virus detection assays will be required to unambiguously define the precise
role of wildlife in the epidemiology of BTV infection.
Yearling deer were apparently infected with BTV-1,
which has been present in Spain since 2007. When epidemiologic information about the study area was compared
with the information for the deer samples analyzed, evidence was found supporting our results: adult deer were
sampled on July 12, 2007, and yearlings were sampled August 20, 2007, i.e., 26 days after BTV-1 presence was confirmed at 60 km distance from the deer farm (www.oie.int/
wahis/reports/en_imm_0000005799_20070726_123322.
pdf) (Figure 2).
Thus, adult deer had been sampled when BTV-1 was
not present in the country yet. In contrast, yearlings were
already positive to BTV-1 only 26 days after this serotype
was first reported in livestock in the same area. There are 2
explanations for this finding: 1) BTV-1 is a highly pathogenic serotype (13), causing high death rates in sheep, that
may also cause high death rates in deer; and 2) deer and
other wild ruminants may be highly susceptible to BTV
infection, thus, making them good sentinels for this disease. However, BTV-1 was detected earlier among sentinel
cattle than among deer.
Regarding EHD, despite the negative results obtained,
lack of robust molecular tools for its detection is noteworthy. All available RT-PCRs are based on the sequences of
EHD strains that have never been detected in the Mediterranean area.
Ƈ
Û
Figure 2. Epidemiologic situation for bluetongue virus (BTV) in
Spain, July–August 2007. The first BTV-1 case in Spain was
reported in Tarifa (purple circle), only 60 km west from a deer farm
where the samples were collected (blue diamond). Map source:
Google Maps.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
519
DISPATCHES
Acknowledgments
We thank José Antonio Ortiz (field veterinarian) and the
laboratory technicians from the Animal Health Department Belén
Rivera and Rocío Sánchez for involvement in and dedication to
this study.
This study was funded by the Spanish Ministry of Natural, Rural and Marine Environment (RASVE 274/2007, and an
agreement between Organismo Autónomo de Parques Nacionales
(OAPN), Dirección General de Recursos Agricolas y Ganaderos
(DGRAG), and Consejo Superior de Investigaciones Cientificas
(CSIC). F.R.-F. is supported by a postdoctoral contract of the Instituto de Salud Carlos III of the Spanish government.
Dr Rodríguez-Sánchez is a molecular biologist at the Animal
Health Department–Veterinary Faculty, Madrid. Her research interests are the detection and characterization of animal viruses,
especially the epidemiology of bluetongue virus and the transmission of this disease between livestock and wildlife.
References
1.
2.
3.
4.
5.
520
Taylor WP. The epidemiology of bluetongue. Revue Scientifique et
Technique de l’Office international des Epizooties. 1986; 5:351–6
Ruiz-Fons F, Reyes-García AR, Alcaide V, Gortázar C. Spatial and
temporal evolution of bluetongue virus in wild ruminants, Spain.
Emerg Infect Dis. 2008;14:951–3. DOI: 10.3201/eid1406.071586
Linden A, Mousset B, Grégoire F, Hanrez D, Vandenbussche F, Vandemeulebroucke E, et al. Bluetongue virus antibodies in wild red
deer in southern Belgium. Vet Rec. 2008;162:459.
Fernández-Pacheco P, Fernández-Pinero J, Agüero M, Jiménez-Clavero MA. Bluetongue virus serotype 1 in wild mouflons in Spain.
Vet Rec. 2008;162:659–60.
García I, Napp S, Casal J, Perea A, Allepuz A, Alba A, et al. Bluetongue epidemiology in wild ruminants from southern Spain. Eur J
Wildl Res. 2009;55:173–8. DOI: 10.1007/s10344-008-0231-6
6.
Agüero M, Arias M, Romero LJ, Zamora MJ, Sánchez-Vizcaíno
JM. Molecular differentiation between NS1 gene of a field strain
bluetongue virus serotype 2 (BTV-2) and NS1 gene of an attenuated BTV-2 vaccine. Vet Microbiol. 2002;86:337–41. DOI: 10.1016/
S0378-1135(02)00011-1
7. Mertens PP, Maan NS, Prasad G, Samuel AR, Shaw AE, Potgieter
AC, et al. Design of primers and use of RT-PCR assays for typing European bluetongue virus isolates: differentiation of field and vaccine
strains. J Gen Virol. 2007;88:2811–23. DOI: 10.1099/vir.0.83023-0
8. Rodríguez-Sánchez B, Iglesias-Martín I, Martínez-Avilés M, Sánchez-Vizcaíno JM. Orbiviruses in the Mediterranean basin: updated
epidemiological situation of bluetongue and new methods for the detection of BTV serotype 4. Transbound Emerg Dis. 2008;55:205–14.
DOI: 10.1111/j.1865-1682.2008.01029.x
9. Ohashi S, Yoshida K, Yanase T, Kato T, Tsuda T. Simultaneous
detection of bovine arboviruses using single-tube multiplex reverse transcription–polymerase chain reaction. J Virol Methods.
2004;120:79–85. DOI: 10.1016/j.jviromet.2004.04.006
10. Rozsa L, Reiczigel J, Majoros G. Quantifying parasites in samples
of hosts. J Parasitol. 2000;86:228–32.
11. Agüero M, Buitrago D, Gómez-Tejedor C. False-positive results obtained when bluetongue virus serotype 1 Algeria 2006 was analyzed
with a reverse transcription-PCR protocol for detection of epizootic
hemorrhagic disease virus. J Clin Microbiol. 2008;46:3173–4. DOI:
10.1128/JCM.00353-08
12. MacLachlan NJ, Nunamaker RA, Katz JB, Sawyer MM, Akita GY,
Osburn BI, et al. Detection of bluetongue virus in the blood of inoculated calves: comparison of virus isolation, PCR assay, and in vitro
feeding of Culicoides variipennis. Arch Virol. 1994;136:1–8. DOI:
10.1007/BF01538812
13. Saegerman C, Berkvens D, Mellor PS. Bluetongue epidemiology
in the European Union. Emerg Infect Dis. 2008;14:539–44. DOI:
10.3201/eid1404.071441
Address for correspondence: Belén Rodríguez-Sánchez, Departamento
de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense
de Madrid, Avenida Puerta de Hierro s/n, 28040 Madrid, Spain; email:
[email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Novel Spotted
Fever Group
Rickettsiosis,
Brazil
Mariana G. Spolidorio, Marcelo B. Labruna,
Elenice Mantovani, Paulo E. Brandão,
Leonardo J. Richtzenhain,
and Natalino H. Yoshinari
We report a clinical case of spotted fever group rickettsiosis acquired in São Paulo, Brazil. Definitive diagnosis
was supported by seroconversion between acute-phase
and convalescent-phase serum samples. Molecular analysis of skin samples indicated the agent was a novel spotted
fever group strain closely related to Rickettsia africae, R.
parkeri, and R. sibirica.
ickettsia rickettsii is the etiologic agent of Rocky
Mountain spotted fever (RMSF). During the past 2
decades, a clear reemergence of RMSF has been seen in
southeastern Brazil, where ≈350 laboratory-confirmed cases (case-fatality rate ≈30%) have been reported (1). Most of
these cases were confirmed solely by serologic-based techniques; specific identification of the Rickettsia species was
not achieved. However, because these cases were clinically
and epidemiologically compatible with RMSF, the agent
was presumed to be R. rickettsii (1).
The occurrence of R. parkeri in Brazil has been restricted to ticks; human clinical infection has been reported
in the United States, and possibly in Uruguay (1). Additionally, a few clinical cases caused by R. felis or R. typhi
have been reported in southeastern Brazil during the 21st
century (2,3). We report a clinical case of SFG rickettsiosis
in a patient from southeastern Brazil. Molecular analysis of
clinical samples showed that the patient was infected by a
novel SFG strain.
R
Case Report
On May 2, 2009, a 66-year-old man was bitten by a
tick on his lumbar region while walking on his ranch within
an Atlantic rainforest area. Although his primary residence
was in the urban area of Santo André within the São Paulo
Metropolitan region (where he reported never having been
bitten by ticks), he often visited his ranch in Barra do Una,
a village within the Peruíbe Municipality, southern coastal
region of the state of São Paulo (where he reported havAuthor affiliations: University of São Paulo, São Paulo, Brazil
DOI: 10.3201/eid1603.091338
ing been bitten by ticks several times). The area is within
a large Atlantic rainforest reserve and is <50 m above sea
level. The patient reported no travel to additional locations
during the previous 3 months. Ten days after the tick bite
(May 12, 2009), the patient reported the first episode of fever (≈39°C) and took acetaminophen. On May 15, 2009, he
visited a doctor, who prescribed oral cephalexin (500 mg,
6×/6 h). On the next day, a macular rash appeared on his
arms and legs, associated with muscle and joint pain. Fever
was still present (39.5°C). On May 19, 2009, the patient
had continuing fever (39.5°C), a macular rash (without
itch) on his arms and legs, arthralgia, and myalgia on lower
regions of the arms and legs and hands. The patient had an
eschar on the lumbar region (Figure 1), exactly where he
had removed an attached tick on May 2, 2009. He admitted
that the tick remained attached to his skin for at least 20
hours until being removed and discarded.
Based on suspicion of rickettsial disease, blood samples were collected the same day, and doxycycline (100
mg, 12×/12 h) was prescribed for 10 days. Three days later (May 22, 2009), the patient returned to the laboratory
where a new blood sample was collected, and a skin biopsy
of the eschar was aseptically performed. The patient had
not had a fever since May 20, 2009 (1 day after initiation of
doxycycline therapy), but still had macular rash and joint
and muscle pain. A third blood sample was collected 13
days later (June 4, 2009), and no clinical abnormalities
were found.
Blood serum was tested by using an immunofluorescent antibody assay with antigens from 6 Rickettsia species
that are present in Brazil: R. rickettsii, R. parkeri, R. felis,
R. amblyommii, R. rhipicephali, and R. bellii (4,5). Serum
samples were tested with a goat antihuman immunoglobulin
(Ig) G or a goat antihuman IgM fluorescein isothiocyanate
conjugate (Sigma Diagnostics, St. Louis, MO, USA). Patient showed seroconversion with a minimum 8× increase
in titers of antibodies against Rickettsia spp. between the
first samples (collected during the febrile period) and the
third blood sample (collected 16 days later) (Table).
DNA was extracted from the skin biopsy specimen by
using the DNeasy Blood and Tissue Kit (QIAGEN, Hilden,
Germany) according to the manufacturer’s instructions
and tested by a battery of PCRs to amplify fragments of
the rickettsial genes citrate synthase (gltA) (primers CS78, CS-323, CS-239, CS-1069), outer membrane protein
(ompB) (primers 120-M59, 120–807), and ompA (primers
Rr190.70p, Rr190.602n), as described (6). PCR products
were purified and sequenced (4). Partial sequences were
subjected to BLAST analysis (7) to determine similarities
to other Rickettsia species. Partial gltA sequence (1,078
bp) showed 100% similarity to R. sibirica (RSU59734),
99.9% to R. parkeri (EF102236), and 99.8% to R. africae strain S (RSU59735). Partial ompB sequence (740 bp)
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
521
DISPATCHES
Table. Rickettsia spp. serologic titers by immunofluorescent antibody assay for a Brazilian patient in the state of São Paulo, Brazil,
2009*
Titers
May 19
May 22
Jun 4
Antigen
IgM
IgG
IgM
IgG
IgM
IgG
64
64
128
256
512
512
Rickettsia rickettsii
<64
<64
256
256
1,024
512
R. parkeri
<64
<64
<64
128
<64
128
R. felis
<64
<64
128
<64
512
512
R. amblyommii
<64
64
128
256
512
512
R. rhipicephali
64
<64
256
128
512
512
R. bellii
*Ig, immunoglobulin.
showed 99.2% similarity to R. africae (AF123706) and R.
parkeri strain NOD (EU567179), and 98.6% to R. parkeri (AF123717) and R. sibirica (AF123726). Partial ompA
sequence (463 bp) showed 99.8% similarity to R. africae
strain S (RSU43805), 99.6% to R. africae (EU622980),
99.1% to R. sibirica (AF179365), and 98.3% to R. parkeri
(RPU43802).
For each rickettsial gene, partial sequences were
aligned with the corresponding sequences of other Rickettsia species available in GenBank, and rooted phylogenetic
trees were built with PAUP 4.0b10 (8) by using the maximum likelihood method with an heuristic algorithm and the
transition model + the Γ, transversion model + Γ, and the
general time reversible + Γ + proportion invariant model
for gltA, ompB, and ompA, respectively, as determined by
Model Test (9). Tree stability was assessed by bootstrapping >1,000 replicates. In all trees, the sequence from the
Brazilian patient, designated as Rickettsia sp. Atlantic rainforest, grouped in a cluster composed by different strains of
Figure 1. Inoculation eschar on the lumbar region of the back of a
patient infected with a Rickettsia sp. from the Atlantic rainforest in
the state of São Paulo, southeastern Brazil.
522
R. africae, R. parkeri, and R. sibirica. This cluster was supported by high bootstrap value for ompB tree, but low for
the ompA tree (Figure 2). Little divergence was observed
between SFG species in the gltA tree; clusters were generally supported by low bootstrap values (data not shown).
Partial sequences (gltA, ompB, ompA) from Rickettsia sp.
strain Atlantic rainforest generated in this study were deposited into GenBank and assigned nucleotide accession
nos. GQ855235–GQ855237, respectively.
Conclusions
We report a clinical case of SFG rickettsiosis acquired
in an Atlantic rainforest area of the state of São Paulo,
Brazil. Definitive diagnosis is supported by demonstrating a minimum 8× increase in titers between acute-phase
and convalescent-phase serum samples, and by identification of rickettsiae in an acute-phase tissue sample (eschar),
which was confirmed as a novel SFG strain and designated
as Rickettsia sp. strain Atlantic rainforest. Genetic analyses
indicated that this new strain was similar to R. africae, R.
parkeri, and R. sibirica. The clinical profile of the Brazilian
patient was similar to the disease caused by these 3 rickettsial species in the United States (R. parkeri) and in the Old
World (continents of Asia, Europe, and Africa [R. africae
or R. sibirica]), that is, mild fever, muscle and joint pain,
eschar, rash, and no deaths (10–12). We did not observe
regional lymphadenopathy, a clinical sign usually associated with R. parkeri, R. africae, and R. sibirica (10–12)
infection, possibly because the inoculation eschar was on
the lumbar region of the back.
It was recently proposed that a new Rickettsia species
should not show >99.9%, 99.2%, and 98.8% similarity for
the gltA, ompB, and ompA genes, respectively, with the
most homologous validated species (13). The strain detected in the Brazilian patient showed similarity values equal
to or greater than the above threshold values for >2 genes
of either R. africae or R. parkeri or R. sibirica. Thus, we
cannot identify the species for Rickettsia sp. strain Atlantic
rainforest. Notably, it has been proposed that closely related species, such as R. parkeri and R. africae, should be
considered strains of 1 species (12).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Spotted Fever Group Rickettsiosis, Brazil
at the Faculty of Veterinary Medicine of the University of São
Paulo, São Paulo, Brazil.
Ms Spolidorio is a doctoral student in the Faculty of Medicine of the University of São Paulo, Brazil. Her research interests
focus on the epidemiology of tick-borne diseases.
References
1.
2.
3.
4.
5.
6.
7.
8.
Figure 2. Molecular phylogenetic analysis of Rickettsia sp. strain
Atlantic rainforest detected in a patient from the State of São Paulo,
Brazil. A) A total of 740 unambiguously aligned nucleotide sites of
the rickettsial outer membrane protein (ompB) gene were subjected
to analysis. B) A total of 463 unambiguously aligned nucleotide sites
of the rickettsial ompA gene were subjected to analysis. Bootstrap
values >50% are shown at the nodes. Numbers in brackets are
GenBank accession numbers. The strain isolated in this study is
indicated in boldface. Scale bars indicate nucleotide substitutions
per site.
9.
10.
11.
12.
13.
Acknowledgments
We thank Sheila Oliveira de Souza for technical assistance
in DNA sequencing.
This work was supported by Fundação de Amparo a Pesquisa do Estado de São Paulo, Conselho Nacional de Desenvolvimento Científico e Tecnológico, and the Ministry of Health of
Brazil. This work was performed in the Faculty of Medicine, and
Labruna MB. Ecology of Rickettsia in South America. Ann N Y Acad
Sci. 2009;1166:156–66. DOI: 10.1111/j.1749-6632.2009.04516.x
Raoult D, La Scola B, Enea M, Fournier PE, Roux V, Fenollar F, et
al. A flea-associated Rickettsia pathogenic for humans. Emerg Infect
Dis. 2001;7:73–81. DOI: 10.3201/eid0701.010112
Silva LJ, Papaiordanou PMO. Tifo murino (endêmico) no Brasil: relato de caso e revisão. Rev Inst Med Trop Sao Paulo. 2004;46:283–5.
DOI: 10.1590/S0036-46652004000500010
Horta MC, Labruna MB, Pinter A, Linardi PM, Schumaker TTS.
Rickettsia infection in five areas of the state of São Paulo. Mem
Inst Oswaldo Cruz. 2007;102:793–801. DOI: 10.1590/S007402762007000700003
Labruna MB, Horta MC, Aguiar DM, Cavalcante GT, Pinter A, Gennari SM, et al. Prevalence of Rickettsia infection in dogs from the urban and rural areas of Monte Negro Municipality, western Amazon,
Brazil. Vector Borne Zoonotic Dis. 2007;7:249–55. DOI: 10.1089/
vbz.2006.0621
Guedes E, Leite RC, Prata MCA, Pacheco RC, Walker DH, Labruna
MB. Detection of Rickettsia rickettsii in the tick Amblyomma cajennense in a new Brazilian spotted fever–endemic area in the state
of Minas Gerais. Mem Inst Oswaldo Cruz. 2005;100:841–5. DOI:
10.1590/S0074-02762005000800004
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local
alignment search tool. J Mol Biol. 1990;215:403–10.
Swofford DL. PAUP*. Phylogenetic analysis using parsimony (*and
Other Methods). Version 4. Sunderland (MA): Sinauer Associates;
2000.
Posada D, Crandall KA. Modeltest: testing the model of DNA
substitution. Bioinformatics. 1998;14:817–8. DOI: 10.1093/
bioinformatics/14.9.817
Parola P, Paddock CD, Raoult D. Tick-borne rickettsioses around the
world: emerging diseases challenging old concepts. Clin Microbiol
Rev. 2005;18:719–56. DOI: 10.1128/CMR.18.4.719-756.2005
Paddock CD, Finley RW, Wright CS, Robinson HN, Schrodt BJ,
Lane CC, et al. Rickettsia parkeri rickettsiosis and its clinical
distinction from Rocky Mountain spotted fever. Clin Infect Dis.
2008;47:1188–96. DOI: 10.1086/592254
Walker DH, Ismail N. Emerging and re-emerging rickettsioses: endothelial cell infection and early disease events. Nat Rev Microbiol.
2008;6:375–86. DOI: 10.1038/nrmicro1866
Fournier PE, Raoult D. Current knowledge on phylogeny and taxonomy of Rickettsia spp. Ann N Y Acad Sci. 2009;1166:1–11. DOI:
10.1111/j.1749-6632.2009.04528.x
Address for correspondence: Marcelo B. Labruna, Departamento de
Medicina Veterinária Preventivae Saúde Animal, Faculdade de Medicina
Veterinária e Zootecnia, Universidade de São Paulo, São Paulo, SP 05508270, Brazil; email: [email protected]
Search past issues of EID at www.cdc.gov/eid
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
523
DISPATCHES
Climate Warming
and Tick-borne
Encephalitis,
Slovakia
Martin Lukan, Eva Bullova, and Branislav Petko
Increased tick-borne encephalitis (TBE) cases have
been reported in central Europe. To investigate temporal
trends in the altitude at which TBE cases occur in Slovakia,
we analyzed the number of TBE cases during 1961–2004.
Since 1980, TBE cases moved from lowlands to submountainous areas, most likely because of rising temperature.
T
he recent increase in incidence of tick-borne encephalitis (TBE) in central and eastern Europe, especially
since 1990, has been attributed to climate warming (1–5)
or various socioeconomic factors (6,7). Climate warming in
Europe during the past decades has been shown to influence the distribution of Ixodes ricinus ticks, the main TBE
vector, in several European countries (4,5,8). In central Europe, a sharp increase of TBE has been reported (9,10). Zeman and Beneš showed that global warming affected the
geographic and temporal distribution of TBE cases in the
Czech Republic (2). Similar development of TBE vertical
distribution could be expected in neighboring Slovakia. To
investigate temporal trends in the altitude at which TBE cases occur (altitude for TBE) in Slovakia and TBE response
to climate warming, we analyzed the total number of TBE
cases recorded for persons in Slovakia during 1961–2004.
The Study
Since the 1952 outbreak of TBE in Rožňava, Slovakia,
all registered cases of TBE have been required to be reported to the National Health Institute. We analyzed 1,786
TBE cases registered in Slovakia by the Regional Institute
of Health during 1961–2004.
Location where infection occurred was tracked to the
level of cadastral unit. We calculated the average altitude
of cadastral units corresponding to the reported TBE cases
by using an altitudinal model of the country and ArcGIS
9.2 software (www.ESRI.com). A TBE focus was defined
as a location at which TBE infection occurred at least 1
time in a given year. The yearly average altitude for TBE
Author affiliations: University of Žilina, Tatranská Javorina, Slovakia (M. Lukan); Slovak Academy of Sciences, Košice, Slovakia (M.
Lukan, E. Bullova, B. Petko); and Catholic University Ružomberok
Faculty of Health, Ružomberok, Slovakia (B. Petko)
DOI: 10.3201/eid1603.081364
524
was plotted against time, and temporal trends were identified by linear regression analysis. Frequency distribution
of TBE foci in relation to altitude was plotted, and 5-year
periods were aggregated. To eliminate locations with single, possibly accidental, cases of the disease, we considered
established TBE foci where TBE had occurred in at least
2 of 5 years .The series of yearly mean altitudes of TBE
foci was tested against the null hypothesis of random elevation by using the Spearman rank correlation (2-tailed
test; null hypothesis = temporal and altitudinal rankings are
uncorrelated) and the test for stationarity of Kwiatkowski et al. (11) (null hypothesis = time series in question is
stationary; i.e., no change over time). A series of yearly
mean altitudes for TBE was analyzed for correlations with
mean yearly temperature and precipitation derived from 12
meteorologic stations throughout Slovakia. Climate data
were kindly provided by the Slovak Hydrometeorological
Institute (www.shmu.sk). Statistical tests were performed
by using SPSS 14.0 for Windows (Chicago, IL, USA) and
Gretl 1.8.5 (12).
During 1961–1979, the mean altitude for TBE varied
between 180 m and 340 m above sea level. Time series
of mean altitudes for TBE showed random elevation, and
statistical analysis showed no temporal trend. During this
period, no temporal trend in the average annual air temperature was noted. However, during the following period,
1980–2004, the mean altitudes for TBE showed nonrandom variation over time. The gradual increase is shown
in Table 1. An analysis of trends (linear least-square fit)
showed a mean ± SD annual ascension rate of 5.32 ± 0.63
m; R2 = 0.76, p<0.001 (Figure 1). The relationship can be
expressed as the following equation: Annual rise in the
mean altitude of TBE incidents (meters above sea level) =
(222.80 + 5.32) × (year from 1980 inclusive) ± 0.63.
The observed rise in mean altitude for TBE corresponds with a mean ± SD rate of TBE ceiling (uppermost
limit) rise of ≈5.4 ± 1.7 m yearly during the past 3 decades
in the neighboring Czech Republic (2). During the same
frame, the mean annual temperature showed a gradual rise
(Table 1). An analysis of trends (linear least-square fit)
showed an annual increase of 0.067°C ± 0.019°C (R2 =
0.36, p = 0.002).
Table 1. Nonparametric test and test of stationarity for mean
altitude and mean annual air temperature with regard to TBE,
Slovakia, 1980–2004*
Test values
Data
RS
p value†
KPSS p value†
Mean annual air
0.55
0.01
0.56
<0.05
temperature
Mean TBE altitude
0.87
<0.001
0.86
<0.01
*TBE, tick-borne encephalitis; Rs, Spearman rank correlation test, a
nonparametric test; KPSS, Kwiatkowski-Phillips-Schmidt-Shin test, a test
of stationarity (no change with time).
†Probability of adopting the null hypothesis of randomness (Spearman RS)
and stationarity (KPSS).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Tick-borne Encephalitis, Slovakia
The total number of lowland TBE foci at <200 m decreased
from 36 during 1980–1984 to 29 during 2000–2004.
In contrast, the total number of TBE foci at >400 m
was only 2 during 1980–1984 and increased to 35 during 2000–2004. The altitudinal distribution of TBE foci
during 1980–1984 differed significantly from that during
2000–2004 (log-likelihood ratio 31.302, df = 7, p<0.001).
The number of lowland TBE foci became significantly
lower than in the beginning, a finding that corresponds
with the predictions of Randolph and Rogers about the
gradual disappearance of TBE from the lowlands of central Europe (7). The dramatic rise in the number of TBE
foci at >400 m between 1980–1984 (2 foci) and 2000–
2004 (35 foci) is too great to be explained by only socioeconomic factors, such as particular changes in land use,
which could increase the range of habitats suitable for tick
survival at higher altitudes.
The mean altitude for TBE in this period was significantly correlated with mean annual air temperature (Table
2). No significant correlation between the mean altitude
for TBE and precipitation could be found. The closest correlation was detected between the mean altitude for TBE
and mean annual air temperature of the 3 preceding years.
This correlation indicates that the mean altitude for TBE
positively responds to climate warming, with a lag of several years. A similar phenomenon was described by Zeman
and Beneš (2). At the beginning of the observed period
of change, 1980–1984, 48.6% of TBE foci were found at
<200 m (Figure 2), 21.6% were found at >300 m, and the
highest with repeated reports of TBE was 550 m. During
2000–2004 only 23.0% of locations with repeated reports
of TBE were found at <200 m, 27.8% of all locations were
found at >400 m, and 5.6% of all TBE foci were found at
>600 m (Figure 2). During this period, the highest location
with TBE occurrence repeated for several years was 832 m.
Table 2. Relationship between mean annual air temperature and
mean altitude of tick-borne encephalitis cases, Slovakia, 1980–
2004*
Temperature lag, y
Correlation coefficient
p value
Mean (1–3)
0.689†
0.000
0
0.30‡
0.032
–1
0.466‡
0.019
–2
0.433‡
0.031
–3
0.438‡
0.028
*Nonparametric testing (Spearman rank correlation test).
†Correlation is significant at p<0.01 (2-tailed).
‡Correlation is significant at p<0.05 (2-tailed).
Acknowledgments
We dedicate this work to Milan Labuda, who devoted a great
part of his life to the study of TBE in Slovakia and unfortunately
passed away before this work was finished. We also thank the
45
40
No. locations with repeated TBE occurrence
Figure 1. Mean altitude of reported cases of tick-borne encephalitis
(TBE), Slovakia, 1980–2004. Black line, mean altitude; red line,
linear least-square fit; gray lines, 95% confidence intervals; asl,
above sea level.
Conclusions
If the observed trend continues, the number of TBE
foci in the mountain areas >500 m will probably increase in
future decades. Whether this would affect the total number
of TBE cases is a matter for discussion. Higher areas are
less densely inhabited by local residents but often visited
for leisure activities and recreation. The possibility of TBE
emergence should be therefore considered by the management of recreation facilities and tourist resorts in areas with
habitats suitable for TBE vectors.
35
30
25
20
15
10
5
0
100–199
200–299
300–399
400–499
500–599
600–699
700–799
800–899
Altitude, m asl
Figure 2. Comparison between altitudinal distribution of tick-borne
encephalitis (TBE) foci during 2 time periods, 1980–1984 (gray
bars) and 2000–2004 (white bars), Slovakia. asl, above sea level.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
525
DISPATCHES
Regional Institute of Public Health in Banská Bystrica for support
with reports on TBE.
This research work was supported by grant no. 2/6163/26
from VEGA (research grant agency of the Slovak Ministry of
Education and Slovak Academy of Sciences).
Dr Lukan is a researcher at the Institute of High Mountain
Biology. As a part of his PhD program, he is studying the distribution of I. ricinus ticks and tick-borne diseases in Slovakia in
response to climate change.
References
1.
2.
3.
4.
5.
526
Danielova V, Kliegrova S, Daniel M, Benes C. Influence of climate
warming on tickborne encephalitis expansion to higher altitudes
over the last decade (1997–2006) in the Highland Region (Czech
Republic). Cent Eur J Public Health. 2008;16:4–11.
Zeman P, Beneš C. A tick-borne encephalitis ceiling in central Europe has moved upwards during the last 30 years: possible impact
of global warming? International Journal of Medical Microbiology Supplements. 2004;293:48–54. DOI: 10.1016/S1433-1128(04)80008-1
Lindgren E. Climate and tickborne encephalitis. Conservation Ecology. 1998;2:5 [cited 2008 Sep 24]. http://www.consecol.org/vol2/
iss1/art5
Lindgren E, Gustafson R. Tick-borne encephalitis in Sweden and
climate change. Lancet. 2001;358:16–8. DOI: 10.1016/S0140-6736(00)05250-8
Lindgren E, Tälleklint L, Polfeldt T. Impact of climatic change on
the northern latitude limit and population density of the diseasetransmitting European tick Ixodes ricinus. Environ Health Perspect.
2000;108:119–23. DOI: 10.2307/3454509
6.
Randolph SE. Tick-borne encephalitis incidence in central and eastern Europe: consequences of political transition. Microbes Infect.
2008;10:209–16. DOI: 10.1016/j.micinf.2007.12.005
7. Randolph SE, Rogers DJ. Fragile transmission cycles of tick-borne
encephalitis virus may be disrupted by predicted climate change.
Proc Biol Sci. 2000;267:1741– 4.
8. Tälleklint L, Jaenson TG. Increasing geographical distribution and
density of Ixodes ricinus (Acari: Ixodidae) in central and northern
Sweden? J Med Entomol. 1998;35:521–6.
9. Daniel M, Danielová V, Kříž B, Kott I. An attempt to elucidate
the increased incidence of tick-borne encephalitis and its spread
to higher altitudes in the Czech Republic. Int J Med Microbiol.
2004;293(Suppl 37):55–62.
10. Danielová V, Rudenko N, Daniel M, Holubová J, Materna J,
Golovchenko M, et al. Extension of Ixodes ricinus ticks and
agents of tick-borne diseases to mountain areas in the Czech Republic. Int J Med Microbiol. 2006;296:48–53. DOI: 10.1016/j.
ijmm.2006.02.007
11. Kwiatkowski D, Phillips P, Schmidt P, Shin Y. Testing the null hypothesis of stationarity against the alternative of a unit root. Journal of Econometrics. 1992;54:159–78. DOI: 10.1016/0304-4076(92)90104-Y
12. Baiocchi G, Distaso W. GRETL: econometric software for the GNU
generation. Journal of Applied Economics. 2003;18:105–10. DOI:
10.1002/jae.704
Address for correspondence: Martin Lukan, Institute of High
Mountain Biology, University of Žilina, Tatranská Javorina, 7 Tatranská
Javorina 05955, Slovakia; email: [email protected]
The opinions expressed by authors contributing to this journal do
not necessarily reflect the opinions of the Centers for Disease Control and Prevention or the institutions with which the authors are
affiliated.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Terrestrial Rabies
and Human
Postexposure
Prophylaxis,
New York, USA
Millicent Eidson and Anissa K. Bingman
During 1993–2002, cats accounted for 2.7% of rabid
terrestrial animals in New York but for one third of human
exposure incidents and treatments. Nonbite exposures
and animals of undetermined rabies status accounted for
54% and 56%, respectively, of persons receiving rabies
treatments.
R
abies has an almost 100% case-fatality rate and requires considerable resources for control (1). In the
United States, canine rabies is controlled with vaccination
and control of dogs (2). Infection occurs primarily from
bite wounds. In US cases diagnosed before death, patients
died 6–43 days after clinical onset (3). Although <10 human cases have been diagnosed annually since 1990 (2) in
the United States, potential exposure incidents and rabies
postexposure prophylaxis (PEP) of humans are not rare.
PEP is the treatment regimen for 1 person, with 2–5 vaccine injections and immune globulin, depending on prior
vaccination history. PEP is unnecessary if an animal is not
rabid at exposure.
A rabies outbreak in raccoons in the mid-Atlantic
states in 1977 (4) reached New York state, which has many
areas with land types favored by raccoons (5,6), in 1990. In
this study, we identified terrestrial rabies trends statewide
in New York, with an aim toward prioritizing control. Previous analyses have focused on only part of the state (7) or
on a shorter time period (8).
The Study
In New York, need for PEP is determined by outcome
of 10-day confinement (of all domestic animals) or laboratory testing (all species). Healthcare providers report suspected rabies exposures to local health departments, which
absorb authorized PEP costs beyond those borne by thirdparty payers and partial reimbursement by the New York
State Department of Health (9).
Author affiliations: University at Albany School of Public Health,
Rensselaer, New York, USA (M. Eidson, A. Bingman); and New York
State Department of Health, Albany, New York, USA (M. Eidson)
DOI: 10.3201/eid1603.090298
We analyzed exposure data collected electronically
during 1993–2002. Exposures to bats and humans, animals
submitted only for surveillance, and data from New York
City (not part of the reporting system) were excluded. Rabies was diagnosed by direct fluorescent antibody staining.
We analyzed data with SAS version 9.2 (SAS Institute,
Cary, NC, USA) using US census data for rates (www.factfinder.census.gov). Because of skewed distributions, we
used Spearman rank correlation coefficients for measures
of association.
The number of terrestrial animals submitted declined
56% from 10,552 in 1993 to 4,631 in 2002. The number and
proportion of rabid animals, which decreased from 2,637
(25.0%) in 1993 to 608 (13.1%) in 2002, were strongly associated with the number of submitted animals (Spearman
r = 0.99, p<0.0001).
For 70.4% of the 13,004 exposure incidents during
1993–2002, an animal was not submitted for testing (Table
1). These incidents accounted for 10,097 (55.6%) of the
18,154 persons receiving PEP. Untestable and positive animals accounted for 2.6% and 23.4% of PEP, respectively.
For 3.6% of exposure incidents, PEP began before rabies
was ruled out.
Exposure incidents declined 45%, from 1,815 in 1993
to 1,006 in 2001 (Figure 1). PEP decreased from 2,755
(25.3 PEPs/100,000 persons) in 1993 to 1,327 in 2000 (12.1
PEP/100,000 persons). Each year, the number of persons receiving PEP correlated with the number of submitted animals
(Spearman r = 0.94, p<0.0001) and rabid animals (Spearman
r = 0.95, p<0.0001). Although fewer cats (303) than raccoons
(8,318) were rabid, cats accounted for the most exposure incidents (4,266 [32.8%]) and PEP (5,777 [31.8%]) (Table 2).
Dogs accounted for 3,052 (23.5%) exposure incidents and
3,435 (18.9%) PEP. In New York, dogs and cats accounted
for a high proportion of PEP from animals without rabies determination (85.3% and 67.6%, respectively). Raccoons accounted for 3,298 (25.4%) exposure incidents and for 5,210
(28.7%) PEP. From 1993 to 2002, the proportion of PEP attributed to raccoons changed from 48% to 22%; cats, from
21% to 35%; and dogs, from 11% to 22%.
In 43 New York counties with populations <200,000, the
PEP rate averaged 33.7/100,000 (range 8.4–81.3/100,000).
Table 1. Terrestrial rabies–associated exposure incidents and
rabies PEP use, by animal test result, New York, USA, 1993–
2002*
Animal test result
No. (%) incidents
No. (%) PEP uses
Positive
3,047 (23.4)
7,032 (38.7)
Negative
469 (3.6)
551 (3.0)
Untestable
340 (2.6)
474 (2.6)
Not tested
9,148 (70.3)
10,097 (55.6)
Total
13,004 (100.0)
18,154 (100.0)
*Each rabies exposure situation in which >1 persons underwent PEP was
defined as an incident. Excludes New York, NY. PEP, postexposure
prophylaxis.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
527
DISPATCHES
3,000
No. exposure incidents and PEPs
PEPs
Exposure incidents
2,500
2,000
1,500
1,000
500
0
1993
1994
1995
1996
1997
1998
1999
2000
2001
2002
Figure 1. Terrestrial rabies–associated exposure incidents and
postexposure prophylaxis (PEP) use, by year, New York (excluding
New York City), USA, 1993–2002.
The 14 larger counties (populations >200,000) had significantly lower PEP rates (9.8/100,000, range 0.5–21.8/
100,000; p<0.0001) and PEP per exposure incident
(p<0.0001) but accounted for 42.6% of PEP.
During 1998–2002 when sex and age of exposed persons were reported, data were missing for 211 of 7,221
PEP reports. Persons who received PEP did not differ by
sex (3,625 male, 3,569 female). PEP rates were highest for
children 10–14 years of age (Figure 2). For male patients,
PEP rates were lower in older age groups; for female patients, rates were highest in the 40–44-year group. Female
patients received PEP significantly more often because
of cat exposures than did male patients (1,736 vs. 1,053;
p<0.0001). Male patients received PEP significantly more
often from dog (984 vs. 583; p = 0.0005) and raccoon (767
vs. 595; p = 0.05) exposures than did female patients. For
each age group, except the >85-year age group, female
patients received PEP more often from cat exposures and
male patients more often from dog exposures.
The 8,405 bites accounted for 46.3% of PEP. A total
of 1,114 (6.1%) of PEP occurrences were associated with
scratch exposures and 3,707 (20.4%) with saliva/nervous
tissue exposures. For indirect or unknown types of contact,
4,298 (27.2%) PEP occurred. PEP for direct contact significantly exceeded that for indirect or unknown contact for the
study period (p<0.0001) and for each year except 1993. Bites
accounted for significantly more PEP because of dog and cat
exposures (86.4% vs. 63.3%; p<0.0001) than did scratches
or saliva/nervous tissue exposures. Raccoon exposures more
frequently resulted from saliva/nervous tissue exposure than
from bites (22.4% vs. 13.0%; p<0.0001). Most PEP resulting
from indirect exposures (64.5%) was from raccoons.
Of 7,221 PEP occurrences during 1998–2002 when
local health department authorization was reported, 6,846
(94.8%) were reported as authorized. PEP start date was
reported for 6,786 (94.0%). Of 6,264 persons not reported
as previously vaccinated, 5,574 (89.0%) received 5 vaccine doses and 5,563 (88.8%) received human rabies immune globulin. Of 522 persons previously vaccinated, 507
(97.1%) received 2 vaccine doses.
PEP completion was not reported (no report received)
for 716 (11%) persons; 701 had no prior treatment history.
Most (79%) incomplete PEP in New York was associated
with animals not captured for rabies determination. Of 119
PEP associated with rabies-negative animals, 108 (91%)
were not completed. PEP were not started for 17 (1%) and
were not completed for 34 (2%) of the 2,217 PEP associated
with rabid animals. Completion rates did not differ by patient sex. Most (697 [97%]) incomplete PEP was from direct
contact exposures, primarily bites (87%). A total of 33 (9%)
of 376 persons with adverse reactions did not complete treatment. Incomplete PEP was associated more often with exposures to dogs (42%) and cats (42%) than to other species.
The rate in New York was lower than that in Massachusetts when its epizootic was well established in 1995 (10),
Table 2. Terrestrial rabies–associated exposure incidents, number of rabid animals, and PEP use, by type of animal, New York, USA,
1993–2002*
PEP use
No. exposure
Total no. rabid
No. related to
No. related to
Total no.
Animal
incidents
animals
untested animals
nonbite incidents†
uses
Wild
Raccoon
3,298
8,318
5,210
1,488
4,534
Fox
398
390
620
187
318
Skunk
637
1,894
987
302
839
Other
544
152
655
453
328
Domestic
Dog
3,052
28
3,435
2,930
467
Cat
4,266
303
5,777
3,907
2,119
Other
187
143
668
63
625
Other/unknown
622
7
802
767
519
Total
13,004
11,235
18,154
10,097
9,749
*Each rabies exposure situation in which >1 persons underwent PEP was defined as an incident. Excludes New York, NY. PEP, postexposure
prophylaxis.
†Scratches, saliva/nervous system tissue exposure, mucous membrane exposure, indirect exposure, or unknown.
528
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Rabies and Postexposure Prophylaxis
25
Men
Women
PEPs/100,000 persons/year
20
15
10
Ms Bingman completed this study as her thesis for a master of science degree from the University at Albany School of
Public Health. Her research interests include the epidemiology of
zoonoses and tuberculosis.
5
0
0–4
Dr Eidson is director of the Applied Epidemiology Partnership of the New York State Department of Health Office of Science and associate professor at the University at Albany School
of Public Health’s Department of Epidemiology and Biostatistics.
Her research interests are zoonotic diseases and geographic information systems.
5–9 10–14 15–19 20–24 25–29 30–34 35–39 40–44 45–49 50–54 55–59 60–64 65–69 70–74 75–79 80–84 >85
Age group, y
Figure 2. Rate of postexposure prophylaxis (PEP) use per 100,000
persons per year, by sex and 5-year age groups, New York
(excluding New York City), 1998–2002.
References
1.
2.
perhaps because New York requires treating physicians to
consult with local public health authorities. Similar to rates
in New York, PEP rates in Ontario, Canada, decreased as fox
rabies became enzootic and were weakly but significantly
associated with animal rabies (11). This association may be
due to epizootic-related reductions in animal populations,
resulting in fewer rabid animals and human contacts. Unlike
New York, in Kentucky PEP occurred more frequently after
exposures to dogs than cats (12). In Kentucky, the proportion of incomplete PEP was the same as in New York (Michael Auslander, pers. comm., 2008). Treatment completion
rates for New York and Kentucky were higher than those
in a study of 11 US emergency departments (65%) (13). In
Florida, 22% of PEP were inappropriate according to a state
algorithm (14); in New York, local health departments report
few unauthorized PEP administrations.
Conclusions
In New York, over time and with education, PEP associated with indirect exposures apparently can be reduced.
Of most concern is the 55.6% of PEP associated with animals of undetermined rabies status. More efforts are needed to capture exposing animals to rule out both rabies and
the need for PEP. Capturing exposing animals should be a
major component of animal control efforts that along with
vaccination have been successful at reducing rabies risks.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Acknowledgments
We thank the New York State Department of Health Wadsworth Center’s Rabies Laboratory and its staff, under the direction of Charles Trimarchi (former director) and Robert Rudd (current director), for collecting the rabies laboratory data. We also
thank local health departments for collecting and reporting the
exposure and PEP data and the New York State Department of
Health Zoonoses Program staff for managing the data.
14.
Rupprecht CE, Hanlon CA, Hemachuda T. Rabies re-examined.
Lancet Infect Dis. 2002;2:327–43. DOI: 10.1016/S1473-3099(02)00287-6
Krebs JW, Noll HR, Rupprecht CE, Childs JE. Rabies surveillance in the United States during 2001. J Am Vet Med Assoc.
2002;221:1690–701. DOI: 10.2460/javma.2002.221.1690
Soun VV, Eidson M, Trimarchi CV, Drabkin PD, Leach R, Wallace
BJ, et al. Antemortem diagnosis of New York human rabies case and
review of U.S. cases. Int J Biomed Sci. 2006;2:433–4.
Brown CI, Szakacs JG. Rabies in New Hampshire and Vermont: an
update. Ann Clin Lab Sci. 1997;27:216–23.
Recuenco S, Eidson M, Cherry B, Kulldorff M, Johnson G. Factors
associated with endemic raccoon (Procyon lotor) rabies in terrestrial
mammals in New York State, USA. Prev Vet Med. 2008;86:30–42.
DOI: 10.1016/j.prevetmed.2008.03.001
Recuenco S, Eidson M, Kulldorff M, Johnson G, Cherry B. Spatial
and temporal patterns of enzootic raccoon rabies adjusted for multiple covariates. Int J Health Geogr. 2007;6:14. DOI: 10.1186/1476072X-6-14
Blanton JD, Bowden NY, Eidson M, Wyatt JD, Hanlon CA. Rabies
postexposure prophylaxis, New York, 1995–2000. Emerg Infect Dis.
2005;11:1921–7.
Chang HG, Eidson M, Noonan-Toly C, Trimarchi CV, Rudd R, Wallace BJ, et al. Public health impact of reemergence of rabies, New
York. Emerg Infect Dis. 2002;8:909–13.
Recuenco S, Cherry B, Eidson M. Potential cost savings with
terrestrial rabies control. BMC Public Health. 2007;7:47. DOI:
10.1186/1471-2458-7-47
Kreindel SM, McGuill M, Meltzer M, Rupprecht C, DeMaria A Jr.
The cost of rabies postexposure prophylaxis: one state’s experience.
Public Health Rep. 1998;113:247–51.
Nunan CP, Tinline RR, Honig JM, Ball DGA, Hauschildt P, LeBer
CA. Postexposure treatment and animal rabies, Ontario, 1958–2000.
Emerg Infect Dis. 2002;8:214–7. DOI: 10.3201/eid0802.010177
Auslander M, Kaelin C. Rabies postexposure prophylaxis survey—
Kentucky, 1994. Emerg Infect Dis. 1997;3:199–202. DOI: 10.3201/
eid0302.970216
Moran GJ, Talan DA, Mower W, Newdow M, Ong S, Nakase JY,
et al. Appropriateness of rabies postexposure prophylaxis treatment
for animal exposures. JAMA. 2000;284:1001–7. DOI: 10.1001/
jama.284.8.1001
Conti L, Wiersma S, Hopkins R. Evaluation of state-provided
postexposure prophylaxis against rabies in Florida. South Med J.
2002;95:225–30.
Address for correspondence: Millicent Eidson, Office of Science, New
York State Department of Health, 2040 Corning Tower, Empire State
Plaza, Albany, NY 12237, USA; email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
529
DISPATCHES
Increasing Skin
Infections and
Staphylococcus
aureus
Complications
in Children,
England, 1997–2006
Sonia Saxena, Paula Thompson, Ruthie Birger,
Alex Bottle, Nikos Spyridis, Ian Wong, Alan
P. Johnson, Ruth Gilbert, and Mike Sharland,
on behalf of improving Children’s Antibiotic
Prescribing Group
During 1997–2006, general practitioner consultations
for skin conditions for children <18 years of age in England
increased 19%, from 128.5 to 152.9/1,000 child-years, and
antistaphylococcal drug prescription rates increased 64%,
from 17.8 to 29.1/1,000 child-years. During the same time
period, hospital admissions for Staphylococcus aureus infections rose 49% from 53.4 to 79.3/100,000 child-years.
taphylococcus aureus infection is a leading cause of
staphylococcal bacteremia in adults (1) and children
(2) in hospitals in the United Kingdom, and recent reports
suggest invasive staphylococci are emerging from the community (3). Flucloxacillin is the antimicrobial drug recommended for treating S. aureus skin infection in UK primary
care centers (4). Therefore, its use provides a proxy marker
of S. aureus skin infection in children. Flucloxacillin prescribing in children has increased over the past 15 years
(5), despite well-documented reductions in prescribing
rates for other commonly prescribed antibacterial drugs
during 1995–2000 (6), which suggests that S. aureus skin
infections in the community may be increasing.
We examined the incidence of local complications of
S. aureus disease in children over a 10-year period using nationally representative data from primary care clinicians in
England. Ethics approval for this study was obtained from
the Independent Scientific and Ethical Advisory Commit-
S
Author affiliations: Imperial College London, London, UK (S. Saxena, R. Birger, A. Bottle); School of Pharmacy, London (P. Thompson, I. Wong); St. George’s Hospital National Health Service Trust,
London (N. Spyridis); Health Protection Agency, London (A.P.
Johnson, M. Sharland); and University College London Institute of
Child Health, London (R. Gilbert)
DOI: 10.3201/eid1603.090809
530
tee, application no. 2006/ISEAC/012.
The Study
The MediPlus UK database contains anonymized longitudinal data from >500 UK general practitioners who
contribute clinical data on >1 million patients (7) that have
been used widely for research (8). Consultations are coded
by using the International Classification of Diseases, Tenth
Revision (ICD-10), and antimicrobial drug prescriptions
are coded by using the British National Formulary for children, Chapters 5.1.1–5.1.3 (9). Using Mediplus UK, we
extracted data on all skin conditions (ICD-10 code) and
atopic dermatitis (ICD-10 code L20) as an index condition
in children <18 years of age who saw general practitioners
in England from January 1, 1997, through December 31,
2006. We counted prescriptions for all oral and topical antibacterial drugs prescribed for skin infections, and used all
oral preparations containing flucloxacillin prescribed for
skin conditions as a proxy measure of unresolved S. aureus skin infection. We calculated age–sex adjusted annual
consulting and prescribing rates by totaling the number of
consultations or prescriptions and dividing by the number
of person–years contributed by each child in the registered
population for each calendar year. We then directly standardized these rates by using the age–sex distribution for
the reference year 2000.
The Hospital Episode Statistics (HES) database has
recorded all inpatient hospital activity in National Health
Service hospitals across England since 1989 and is used
widely to monitor disease trends in England (www.hesonline.nhs.uk) (10). The main reason for admission, i.e., primary diagnosis, is recorded by using ICD-10 codes. We
used HES data to calculate age–sex adjusted admission
rates per 100,000 resident population for children <18 years
of age for each calendar year from January 1, 1997, through
December 31, 2006, for conditions commonly caused by S.
aureus, including septic arthritis (ICD-10 codes M00.0 for
staphylococcal arthritis and M00.9 for pyogenic arthritis),
osteomyelitis (M86), and locally invasive skin infections
(L02, cutaneous abscesses and boils; L03, cellulitis). Rates
were calculated as the total number of admissions per year
divided by the mid-year estimate of the number of children
residing in England (using the 2000 population in England
as the reference population) (11). Confidence intervals
(CIs) were generated with a Poisson approximation. We
used linear regression to test for linear trends in age–sex
adjusted admission rates across the period. We used Stata
version 9 software (Stata Corp., College Park, TX, USA)
for all statistical analysis.
The Mediplus database contained 2,821,372 childyears of follow-up during 1997–2006. General practitioner
consultation rates for all skin conditions in children rose
from 128.5 (95% CI 127.2– 129.8) per 1,000 child-years
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
S. aureus Complications in Children, England
Conclusions
The increasing incidence of childhood skin infections
and prescribing of the major antistaphylococcal drug flucloxacillin seen in UK primary care, coupled with concurrent increases in childhood hospital admissions for skin
bone and joint infections caused by S. aureus in hospitals
in England, suggests an increase in community-onset S. aureus disease in England over the past 10 years. The time
frame, a large nationally representative population, use of
prospectively collected data, and consistency of patterns
make it unlikely our findings arose by chance. Because HES
data records primary diagnosis when patients are admitted,
most infections will be community-, not hospital-, acquired.
Flucloxacillin has remained the treatment of choice for S.
aureus skin infections in UK primary care for decades (9),
and its increased use is not explained by treatment drift from
other groups of antibacterial drugs used to treat skin infections or by increasing antibacterial drug treatment of atopic
eczema colonized with staphylococci. Total unplanned admission rates in children <19 years of age have increased by
13% during 1997–2006 (12), but these increases are modest
compared with the 49% increase in S. aureus complications
seen over the same time frame in our study.
Limitations of our study include the use of clinically
coded proxy measures for S. aureus infections that are subject to recording bias. Because of the lack of microbiologic
Figure 1. General practitioner consultation and prescribing rates
for all skin conditions in children <18 years of age, England, 1997–
2006.
surveillance, we could not differentiate whether increases
in S. aureus disease were caused by methicillin-sensitive
S. aureus or methicillin-resistant S. aureus. Antimicrobial
drugs for skin infections are available only by prescription in the UK but not exclusively from GPs. Thus, our
prescribing data excluded prescriptions issued from other
healthcare settings. Our findings that admission rates for
osteomyelitis, boils, and cellulitis increased but septic arthritis rates were stable might be because septic arthritis is
also caused by pneumococci, β-hemolytic streptococci, and
gram negative organisms (13).
A growing body of evidence supports our findings of
increases in community-onset S. aureus disease in children.
Hospitalizations for S. aureus disease in all age groups are
35
No. prescriptions/1,000 child-years
to 152.9 (95% CI 151.4–154.5) per 1,000 child years (p =
0.011). Atopic eczema consultation rates decreased during
this time (Figure 1).
In parallel with the rising number of skin consultations was a 64% increase in prescribing rates for antistaphylococcal drugs (flucloxacillin), from 17.8 (95% CI
17.3–18.3) to 29.1 (95% CI 28.5–29.8) prescriptions per
1,000 child-years (p<0.001) (Figure 2). Prescribing of
all other antibacterial drugs for children for any reason
decreased from 541.4 (95% CI 538.8–544.1) per 1,000
child-years to 484.3 (95% CI 481.6–487.0) per 1,000
child-years (Table 1). Flucloxacillin was the most commonly prescribed antibacterial drug for all skin conditions
(37%). Prescribing rates for other classes of anti-bacterial
drugs used for skin infections, notably, combined preparations of amoxicillin and clavulanic acid 2% and fusidic
acid (<2%), were stable over the time period (Figure 2).
During 1997–2006, unplanned hospital admission rates
for skin, bone, and joint infections in all children increased
by 49% from 53.4 (95% CI 52.1–54.7) to 79.3 (95% CI
77.7–80.9) per 100,000 child-years (p<0.001) including cellulitis (67.8% increase; p<0.001), skin abscesses (36.7% increase; p <0.001), and osteomyelitis (46.1% increase; p =
0.004) (Table 2). This trend was consistent across all age
groups. Admission rates for septic arthritis increased but the
result of the test for trend was not significant (p = 0.128).
30
25
20
15
10
5
0
1997
1998
1999
2000
2001
2002
2003
2004
2005
Flucloxacillin
Tetracyclines
Macrolides
Amoxicillins/other
2006
Figure 2. Prescribing rates for antibacterial drugs for children <18
years of age, England, 1997–2006.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
531
DISPATCHES
Table 1. Age- and sex-adjusted skin condition consultation and antibacterial drug prescribing rates for children <18 years of age,
England, 1997–2006 *
Rate/1,000 child-years† (95% CI)
GP consultations for
Antibacterial drugs for
Flucloxacillin for skin
Year
skin conditions
skin conditions
conditions
All flucloxacillin
All antibacterial drugs
1997
128.52
59.53
17.76
35.04
541.42
(127.21–129.83)
(58.63–60.43)
(17.28–18.25)
(34.36–35.72)
(538.75–544.09)
1998
128.17
60.44
19.33
37.35
498.64
(126.87–129.47)
(59.54–61.34)
(18.83–19.84)
(36.65–38.05)
(496.09–501.20)
1999
135.91
65.68
24.39
44.03
438.24
(134.57–137.24)
(64.74–66.61)
(23.83–24.96)
(43.27–44.79)
(435.84–440.63)
2000
142.80
70.17
27.46
48.89
431.80
(141.44–144.17)
(69.21–71.13)
(26.86–28.06)
(48.09–49.69)
(429.42–434.18)
2001
146.75
73.43
30.65
52.76
460.68
(145.36–148.14)
(72.45–74.41)
(30.01–31.28)
(51.93–53.60)
(458.21–463.14)
2002
145.56
71.64
28.70
51.39
443.77
(144.17–146.94)
(70.68–72.61)
(28.09–29.32)
(50.56–52.21)
(441.34–446.19)
2003
154.81
75.69
31.39
56.00
459.94
(153.37–156.24)
(74.69–76.68)
(30.74–32.04)
(55.13–56.87)
(457.45–462.43)
2004
157.56
77.51
30.75
56.22
458.60
(156.07–159.05)
(76.47–78.55)
(30.09–31.42)
(55.32–57.12)
(456.04–461.16)
2005
156.05
75.98
27.32
53.58
489.24
(154.54–157.57)
(74.93–77.04)
(26.68–27.96)
(52.68–54.47)
(486.55–491.93)
2006
152.94
77.62
29.13
56.07
484.30
(151.44–154.45)
(76.54–78.69)
(28.47–29.80)
(55.15–56.99)
(481.61–486.98)
0.011
0.005
0.001
0.001
0.005
p value‡
*Data from International Marketing Systems Health. CI, confidence interval; GP, general practitioner.
†Directly age-sex adjusted to 2000 sample population.
‡p value test for linear trend across years.
increasing; in several countries severe skin infections, particularly among children, are rising, caused by strains of S.
aureus producing the Panton-Valentine leukocidin (14,15).
Although currently no formal surveillance of this strain in
the UK is available, referrals of isolates of S. aureus positive for Panton-Valentine leukocidin to the national Staphylococcal Reference Unit increased each year from 224 in
2005 to 1,361 2007. What is not known is whether S. aureus community-acquired infections in children have added
to the recently reported increases of S. aureus infection and
bacteremias acquired in hospital settings (4). Further work
is required to monitor S. aureus disease and antimicrobial
drug resistance and to identify community risk factors for
S. aureus disease in children.
Acknowledgments
We thank International Marketing Systems Health for providing access to the Mediplus UK data and all the members of the
improving Children’s Antibiotic Prescribing group.
Table 2 Age- and sex-adjusted hospital admission rates for skin, bone, and joint infections in children <18 years of age, England,
1997–2006*
Rate/100,000 child-years (95% CI)
Cutaneous abscesses
All skin, bone, and joint
Year
infections
Cellulitis
Osteomyelitis
Septic arthritis
and boils
1997
53.38 (52.07–54.70)
25.19 (24.29–26.10)
19.81 (19.01–20.61)
4.81 (4.42–5.21)
3.57 (3.23–3.91)
1998
57.99 (56.62–59.36)
27.37 (26.43–28.32)
22.24 (21.39–23.09)
4.82 (4.43–5.22)
3.55 (3.21–3.89)
1999
61.34 (59.93–62.75)
28.86 (27.89–29.82)
23.63 (22.75–24.50)
5.24 (4.82–5.65)
3.62 (3.28–3.96)
2000
64.95 (63.49–66.41)
28.94 (27.97–29.91)
26.48 (25.55–27.41)
5.70 (5.27–6.14)
3.83 (3.47–4.18)
2001
61.99 (60.56–63.41)
28.02 (27.06–28.98)
25.25 (24.34–26.16)
5.55 (5.12–5.97)
3.17 (2.85–3.50)
2002
63.65 (62.20–65.09)
29.65 (28.66–30.64)
25.01 (24.11–25.92)
5.45 (5.02–5.87)
3.54 (3.19–3.88)
2003
71.15 (69.62–72.68)
32.71 (31.68–33.75)
29.26 (28.27–30.24)
5.39 (4.97–5.81)
3.79 (3.43–4.14)
2004
73.66 (72.11–75.22)
32.98 (31.94–34.02)
30.63 (29.63–31.64)
6.11 (5.66–6.56)
3.94 (3.58–4.30)
2005
76.26 (74.67–77.84)
35.17 (34.10–36.25)
32.03 (31.00–33.05)
5.63 (5.20–6.07)
3.43 (3.09–3.76)
2006
79.28 (77.66–80.89)
34.43 (33.37–35.49)
33.23 (32.18–34.28)
7.04 (6.55–7.52)
4.58 (4.19–4.97)
p value†
<0.001
<0.001
<0.001
0.004
0.128
*Data from Hospital Episode Statistics. Rates directly adjusted to mid-year 2000 resident population for England. International Classification of Diseases,
Tenth Revision, codes for primary diagnosis at admission: cutaneous abscesses and boils, L02; cellulitis, L03; osteomyelitis, M86; septic arthritis
(staphylococcal arthritis, M00.0, or pyogenic arthritis, M00.9). All of these codes were included in the category “all skin, bone, and joint infections.” CI,
confidence interval.
†p value for test for linear trend across years.
532
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
S. aureus Complications in Children, England
S.S. has a postdoctoral award from the National Institute
for Health Research (NIHR). I.W.’s post was funded by a Department of Health Public Health Career Scientist Award. N.S.’s
post is funded by the European Society for Pediatric Infectious
Diseases. We are grateful for support from the NIHR Biomedical
Research Centre funding scheme.
Dr Saxena is a National Health Service general practitioner
in London and senior clinical lecturer in the Department of Primary Care and Social Medicine at Imperial College London. Her
research interests are epidemiology and treatment of childhood
illness in primary care.
References
1.
2.
3.
4.
5.
Hayward AB, Knott F, Petersen I, Livermore DM, Duckworth G,
Islam A, et al. Increasing hospitalizations and general practice prescriptions for community-onset staphylococcal disease, England.
Emerg Infect Dis. 2008;14:720–6. DOI: 10.3201/eid1505.070153
Sharland M; SACAR Paediatric Subgroup. The use of antibacterials
in children: a report of the Specialist Advisory Committee on Antimicrobial Resistance (SACAR) Paediatric Subgroup. J Antimicrob
Chemother. 2007;60:i15–26.
Robinson DA, Kearns AM, Holmes A, Morrison D, Grundmann H,
Edwards G, et al. Re-emergence of early pandemic Staphylococcus
aureus as a community-acquired methicillin-resistant clone. Lancet.
2005;365:1256–8.
Rayner C, Munckhof WJ. Antibiotics currently used in the treatment of infections caused by Staphylococcus aureus. Intern Med J.
2005;35(Suppl 2):S3–16.
Thompson PL, Spyridis N, Sharland M et al. Changes in clinical
indications for community antibiotic prescribing for children in the
UK from 1996–2006: will the new NICE prescribing guidance on
upper respiratory tract infections be ignored? Arch Dis Child. Epub
2008 Dec 9.
6.
Ashworth M, Cox K, Latinovic R, Charlton J, Gulliford M, Rowlands G. Why has antibiotic prescribing for respiratory illness
declined in primary care? A longitudinal study using the General
Practice Research Database. J Public Health (Oxf). 2004;26:268–74.
DOI: 10.1093/pubmed/fdh160
7. World Health Organization. International Classification of Diseases
and Related Health Problems; Tenth revision. 2[2]. 2007. Geneva:
The Organization. 2007.
8. Wong IC, Murray ML. The potential of UK clinical databases in
enhancing paediatric medication research. Br J Clin Pharmacol.
2005;59:750–5.
9. Royal College of Paediatrics and Child Health (RCPCH), Neonatal and Paediatric Pharmacists Group (NPPG), British Medical Association (BMA), Royal Pharmaceutical Society of Great Britain
(RPSGB). BNF for Children, 3rd ed. London: Pharmaceutical Press;
2009.
10. Department of Health. Hospital Episode Statistics: The Book. London: Office for National Statistics; 1998.
11. Census Office for National Statistics. 2001. London: Her Majesty’s
Stationery Office; 2001.
12. Chief Nursing Officer’s Directorate. Children Families and Maternity Analysis. Trends in children and young people’s care: Emergency
admission statistics, 1996/97–2006/07, England. London: The Stationery Office; 2008.
13. Gutierrez AM. Infectious and inflammatory arthritis. In: Principles
and practice of paediatric infectious diseases. Philadelphia: Churchill
Livingstone; 2003. p. 480–5.
14. McCaskill ML, Mason EO Jr, Kaplan SL, Hammerman W, Lamberth
LB, Hulten KG. Increase of the USA300 clone among communityacquired methicillin-susceptible Staphylococcus aureus causing invasive infections. Pediatr Infect Dis J. 2007;26:1122–7.
15. Chung HJ, Jeon HS, Sung H, Kim MN, Hong SJ. Epidemiological
characteristics of methicillin-resistant Staphylococcus aureus isolates from children with eczematous atopic dermatitis lesions. J Clin
Microbiol. 2008;46:991–5.
Address for correspondence: Sonia Saxena, Rm 332 Reynolds Bldg,
Imperial College London, Charing Cross Campus, St Dunstan’s Rd,
London W6 8RF, UK; email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
533
DISPATCHES
Influenza A
Pandemic (H1N1)
2009 Virus Infection
in Domestic Cat
Brett A. Sponseller, Erin Strait, Albert Jergens,
Jessie Trujillo, Karen Harmon, Leo Koster,
Melinda Jenkins-Moore, Mary Killian,
Sabrina Swenson, Holly Bender, Ken Waller,
Kristina Miles, Tracy Pearce, Kyoung-Jin Yoon,
and Peter Nara
Influenza A pandemic (H1N1) 2009 virus continues to
rapidly spread worldwide. In 2009, pandemic (H1N1) 2009
infection in a domestic cat from Iowa was diagnosed by a
novel PCR assay that distinguishes between Eurasian and
North American pandemic (H1N1) 2009 virus matrix genes.
Human-to-cat transmission is presumed.
Influenza viruses are typically host specific; aquatic
birds are considered the primary reservoir. However, interspecies transmission does occur (1–9) and occasionally
leads to novel host-adapted strains. Interspecies transmission of influenza virus has been a public health concern
because of the possibility that, through reassortment, a
novel strain with zoonotic potential could emerge. The recent infection of dogs with equine influenza virus (H3N8)
(2) and of swine with human influenza virus (H1N2) (4)
are particularly intriguing because the former resulted in
influenza becoming endemic in dogs and the latter resulted
in a documented reassortment event between human and
swine influenza viruses. Such concern has escalated with
the recent emergence of the novel quadruple-reassorted influenza virus (H1N1) [pandemic (H1N1) 2009] in humans
(10). Although infection and transmission of the virus have
occurred primarily among humans, occasional transmission
from infected persons to susceptible animals (e.g., swine,
turkeys, ferrets) has been documented (11). The likelihood of pandemic (H1N1) 2009 infection of domestic pets
has been considered less likely (www.cdc.gov/h1n1flu/
qa.htm, www.avma.org/public_health/influenza/new_virus/default.asp, www.usda.gov/wps/portal/?navid=USDA_
H1N1); however, we report a confirmed case of pandemic
Author affiliations: Iowa State University, Ames, Iowa, USA (B. A.
Sponseller, E. Strait, A. Jergens, J. Trujillo, K. Harmon, H. Bender,
K. Waller, K. Miles, T. Pearce, K.-Y. Yoon, P. Nara); and US Department of Agriculture National Veterinary Services Laboratories,
Ames (L. Koster, M. Jenkins-Moore, M. Killian, S. Swenson)
DOI: 10.3201/eid1603.091737
534
(H1N1) 2009 virus infection in a domestic cat that had been
in contact with persons who had recently experienced influenza-like illness.
The Case
A 13-year-old, castrated male, domestic cat that lived
indoors in a single-cat household was brought to the Iowa
State University Lloyd Veterinary Medical Center because of depression, inappetance, and respiratory signs of
4 days’ duration. The cat was gregarious and interacted
closely with family members in the household. The family members noted that the cat was reluctant to lie in lateral recumbency and instead rested in sternal recumbency
with neck extended, which was indicative of dyspnea. The
cat’s vaccination status was up to date. Before the onset of
clinical signs in the cat, 2 of the 3 family members had experienced an undiagnosed influenza-like illness—an upper
respiratory tract infection characterized by fever, coughing,
and myalgia—that lasted 3 days. Onset of the cat’s clinical
signs was noted 6 and 4 days after onset of illness for the
first and second family members, respectively.
At the time of examination, the cat had bilateral adventitial lung sounds (wheezes), was afebrile, and was
clinically dehydrated. Radiographs of the thorax showed
a bilateral caudodorsal alveolar pattern (Figure). Cytologic
and microbiologic examination of bronchoalveolar lavage
(BAL) fluid showed foamy macrophages (65%), nondegenerate neutrophils (25%), and small lymphocytes (10%).
Clinicopathologic findings suggested a moderate, predominantly macrophagic, mixed inflammatory process. Standard microbial culture of BAL aliquots yielded no substantial growth of aerobic or anaerobic bacteria. Radiographic
and cytologic findings were inconsistent with bacterial or
parasitic pneumonia and not supportive of allergic airway
disease. A viral cause was considered most likely; however, the cat was given amoxicillin with clavulanate (125
mg orally 2×/day) to reduce the possibility of secondary
bacterial pneumonia. Notable findings from laboratory testing (complete blood count, serum biochemistry, urinalysis,
and total thyroxine measurement) were moderate leukopenia characterized by a moderate lymphopenia, modest
hemoconcentration, and a slightly elevated thyroxine level.
Lymphopenia was consistent with acute viral infection.
PCR testing (Feline URD Panel; Idexx Laboratories,
Westbrook, ME, USA) of a BAL sample showed negative
results for Chlamydophila felis, feline calicivirus, feline
herpesvirus-1, Bordetella bronchiseptica, and Mycoplasma
felis. Results of feline immunodeficiency virus (antibody)
and feline leukopenia virus (antigen) testing (Idexx SNAP
FIV/FeLV Combo Test; Idexx Laboratories) were also
negative, ruling out the potential that viral-induced immunosuppression was a concurrent factor. For the following
reasons we included pandemic (H1N1) 2009 on our list of
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Pandemic (H1N1) 2009 Virus in Domestic Cat
differential diagnoses: recent history of respiratory disease
in household family members, known widespread community prevalence of pandemic (H1N1) 2009 influenza
in humans, paucity of common viral infections causing
infectious caudodorsal alveolar pneumonia in adult cats,
and documented susceptibility of felids to avian influenza
Figure. Radiographs of the thorax of a cat with confirmed influenza
A pandemic (H1N1) 2009 virus infection. A) Right lateral view; B)
dorsoventral view. Asymmetric soft tissue opacities are evident in the
right and left caudal lung lobes. An alveolar pattern, composed of air
bronchograms with border-effaced (indistinct) adjacent pulmonary
vessels, is most pronounced in the left caudal lobe. A small gas
lucency in the pleural space appears in the right caudal and dorsal
thoracic cavity. An endotracheal tube is visible at the thoracic inlet
on the lateral view in this moderately obese cat. L, left.
(H5N1) (12,13). We therefore submitted a BAL sample to
the Iowa State University Veterinary Diagnostic Laboratory for molecular screening and typing for influenza A and
the pandemic (H1N1) 2009 virus.
RNA was obtained from the BAL fluid by using the
MagMAX Viral RNA Isolation Kit (Applied Biosystems,
Austin, TX, USA) and a semiautomated magnetic particle processor (Kingfisher 96; Thermo Electron Corp.,
Woodstock, GA, USA) according to manufacturer’s recommendations. Molecular testing used a real-time reverse
transcription–PCR (rRT-PCR) influenza A screening assay specific for the nucleoprotein gene. Preliminary differentiation of pandemic (H1N1) 2009 virus from other
H1 or H3 types of influenza A was performed by using an
in-house rRT-PCR assay that distinguishes between pandemic (H1N1) 2009 [Eurasian matrix (10)] and endemic
(to North America) swine H1N1 influenza viruses (North
American matrix). Sequences of primers and probes are
summarized in Table 1. PCRs were conducted by using
the AgPath-ID Multiplex One-Step RT-PCR Kit (Ambion/Applied Biosystems) according to manufacturer’s
recommendations; 10 units of Multiscribe Reverse Transcriptase (Applied Biosystems) were added per reaction.
Thermocycling was performed by using the Applied Biosystems 7500 Fast Real-Time PCR System according to
manufacturer’s recommendations.
PCR testing showed the BAL sample to be positive for
influenza A virus (nucleoprotein gene), and the virus was
determined to contain the matrix (M) gene of the pandemic
(H1N1) 2009 virus strain. A BAL sample was submitted to
the US Department of Agriculture National Veterinary Services Laboratories (Ames, IA, USA) for confirmatory testing. rRT-PCR confirmed that the BAL sample was positive
for the M gene of influenza A virus and the neuraminidase
(N) gene of pandemic (H1N1) 2009 virus. Sequences of
primers and probes are summarized in Table 2. A cytolytic
virus was isolated by using MDCK cells (8) and was designated as A/feline/IA/NVSL026991/2009. PCR testing
of the isolate for influenza A virus (M gene) and N1 gene
of pandemic (H1N1) 2009 showed positive results. Sequence analyses for hemagglutinin (HA), N, and M genes
confirmed that the virus was pandemic (H1N1) 2009 virus
(GenBank accession nos. GU332630 (for HA), GU332632
(for NA), and GU332631 (for M). Nucleotide homologies
with the first US human pandemic (H1N1) 2009 isolate (A/
CA/04/2009) were 99.4%, 99.4%, and 99.8% for the HA,
NA, and M genes, respectively.
The cat was discharged from the medical center after
diagnostic testing and correction of dehydration. A veterinarian (B.A.S.) visited the home to monitor the cat’s clinical status and administer subcutaneous fluids (120–160 mL)
until the cat’s appetite improved; adventitial lung sounds
resolved within 3 days. Reassessment 1 week later showed
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
535
DISPATCHES
Table 1. Oligonucleotide sequences for primers and probes and dye labels used in novel molecular testing for pandemic (H1N1) 2009
virus, Iowa State University Veterinary Diagnostic Laboratory, Ames, Iowa, USA, 2009*
Name
Sequence (5ƍ ĺ 3ƍ)
Description
Influenza A NP screening assay
SIVRTF
CGGACGAAAAGGCAACGA
NP forward primer
SIVRTR
CTGCATTGTCTCCGAAGAAATAAG
NP reverse primer
SIVRTP
CCGATCGTGCCYTC
NP probe, MGB FAM
Pandemic influenza M differentiation assay
M_F
TCAGGCCCCCTCAAAGC
M forward primer
M_R1
CATTCCATGAGAGCCTCAAGATC
M reverse primer 1
M_R1a
CACTCCATGAGAGCCTCAAGATC
M reverse primer 2
M_R1b
CATTCCATGAGTGCCTCAAGATC
M reverse primer 3
M_EUPr
CAGAGACTGGAAAGTGT
EU M MGB, VIC
M_NAPr
CAGAGACTYGAAGAYGT
NA M MGB, FAM
*Primers and MGB probes were obtained from Integrated DNA Technologies (Coralville, IA, USA) and Applied Biosystems Inc. (Foster City, CA, USA),
respectively. SIV, swine influenza virus; NP, nucleoprotein; M, matrix.
marked improvement of clinical signs but only modest improvement of the lymphopenia and radiographic findings.
Conclusions
Because the cat was from a single-animal household and remained indoors, he was presumably infected
through contact with the family members. Attempts to retrospectively confirm pandemic (H1N1) 2009 infection in
the family members have been unsuccessful, but additional testing of archived biologic samples is being conducted. Although more surveillance and studies are needed
to determine susceptibility of companion animals to the
pandemic (H1N1) 2009 virus, possible reverse zoonotic
transmission (humans to animals) remains a concern. Indeed, cases in a domestic dog and other felids have been
confirmed (11) (www.cdc.gov/h1n1flu/qa.htm, www.
avma.org/public_health/influenza/new_virus/default.asp,
www.usda.gov/wps/portal/?navid=USDA_H1N1). Implications of pandemic (H1N1) 2009 virus infection in companion animals are 1) apparent human-to-animal transmission; 2) broader host range for the virus; 3) potential
endemic establishment of influenza in companion animals; 4) possible transmission of influenza from compan-
ion animals to other species, including humans; and 5) the
need to reevaluate companion animals as potential reservoirs or intermediate hosts for reassortment of influenza
virus. This case emphasizes the need for close monitoring for interspecies transmission of influenza virus and
reinforces the need for collaboration among many disciplines, a cornerstone of the One Health Initiative (www.
onehealthinitiative.com).
Acknowledgments
We thank the family members in the cat’s household for
their cooperation and Sarah Abate, Wendy Stensland, and Leslie
Bower for technical assistance.
This study was supported by the Iowa State University Office of the Vice President for Research and Economic Development, the Iowa Healthy Livestock Initiative Research Grant, and
the Center for Advanced Host Defenses, Immunobiotics and
Translational Comparative Medicine.
Dr Sponseller is an assistant professor in the Departments
of Veterinary Clinical Sciences and Veterinary Microbiology and
Preventive Medicine, College of Veterinary Medicine, Iowa State
University. His research focuses on viral pathogens of domestic
animals and acquisition of pulmonary immunocompetency.
Table 2. Oligonucleotide sequences for primers and probes and dye labels used in confirmatory molecular testing for pandemic
(H1N1) 2009 virus, National Veterinary Services Laboratories, Ames, Iowa, USA, 2009*
Name
Sequence (5ƍ ĺ 3ƍ)
Description
Influenza A M screening assay
M+25
AGATGAGTCTTCTAACCGAGGTCG
AI M forward primer
M-124
TGCAAAAACATCTTCAAGTCTCTG
AI M reverse primer
M-124siv
TGCAAAGACACTTTCCAGTCTCTG
H1N1 M reverse primer
M+64
TCAGGCCCCCTCAAAGCCGA
M probe, BHQ, FAM
Pandemic influenza N1 differentiation assay
N1 220F
CAACACCAACTTTGCTGC
N1 forward primer
N1 330R
GGAACCGATTCTTACACTGTTGTC
N1 reverse primer
N1 232
CAGTCAGTGGTTTCCGTGAAATTAGC
N1 BHQ, FAM
*Primers and probes were obtained from Integrated DNA Technologies (Coralville, IA, USA) and Biosearch Technologies, Inc. (Novato, CA, USA),
respectively. M, matrix; AI, avian influenza; N, neuraminidase.
536
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Pandemic (H1N1) 2009 Virus in Domestic Cat
9.
References
1.
2.
3.
4.
5.
6.
7.
8.
Choi YK, Lee JH, Erickson G, Goyal SM, Joo HS, Webster RG, et
al. H3N2 influenza virus transmission from swine to turkeys, United
States. Emerg Infect Dis. 2004;10:2156–60.
Crawford PC, Dubovi EJ, Castleman WL, Stephenson I, Gibbs EP,
Chen L, et al. Transmission of equine influenza virus to dogs. Science. 2005;310:482–5. DOI: 10.1126/science.1117950
Gagnon CA, Spearman G, Hamel A, Godson DL, Fortin A, Fontaine
G, et al. Characterization of a Canadian mink H3N2 influenza A virus isolate genetically related to triple reassortant swine influenza
virus. J Clin Microbiol. 2009;47:796–9. DOI: 10.1128/JCM.0122808
Karasin AI, Carman S, Olsen CW. Identification of human H1N2
and human–swine reassortant H1N2 and H1N1 influenza A viruses
among pigs in Ontario, Canada (2003 to 2005). J Clin Microbiol.
2006;44:1123–6. DOI: 10.1128/JCM.44.3.1123-1126.2006
Patterson AR, Cooper VL, Yoon KJ, Janke BH, Gauger PC. Naturally occurring influenza virus infection in a ferret (Mustela putorius
furo) colony. J Vet Diagn Invest. 2009;21:527–30.
Song D, Kang B, Lee C, Jung K, Ha G, Kang D, et al. Transmission of avian influenza virus (H3N2) to dogs. Emerg Infect Dis.
2008;14:741–6. DOI: 10.3201/eid1405.071471
Songserm T, Amonsin A, Jam-on R, Sae-Heng N, Meemak N, Pariyothorn N, et al. Avian influenza H5N1 in naturally infected domestic cat. Emerg Infect Dis. 2006;12:681–3.
Vincent AL, Swenson SL, Lager KM, Gauger PC, Loiacono C,
Zhang Y. Characterization of an influenza A virus isolated from pigs
during an outbreak of respiratory disease in swine and people during
a county fair in the United States. Vet Microbiol. 2009;137:51–9.
DOI: 10.1016/j.vetmic.2009.01.003
Zhou NN, Senne DA, Landgraf JS, Swenson SL, Erickson G, Rossow K, et al. Genetic reassortment of avian, swine, and human influenza A viruses in American pigs. J Virol. 1999;73:8851–6.
10. Garten RJ, Davis CT, Russell CA, Shu B, Lindstrom S, Balish A, et al. Antigenic and genetic characteristics of swine-origin
2009 A(H1N1) influenza viruses circulating in humans. Science.
2009;325:197–201. DOI: 10.1126/science.1176225
11. United States Department of Agriculture. 2009 Pandemic H1N1
influenza presumptive and confirmed results [cited 2009 Dec 23].
http://www.usda.gov/documents/FINAL_RESULTS_2009_PANDEMIC_H1N1_INFLUENZA_CHT.pdf
12. Kuiken T, Rimmelzwaan G, van Riel D, van Amerongen G, Baars
M, Fouchier R, et al. Avian H5N1 influenza in cats. Science.
2004;306:241. DOI: 10.1126/science.1102287
13. Rimmelzwaan GF, van Riel D, Baars M, Bestebroer TM, van
Amerongen G, Fouchier RA, et al. Influenza A virus (H5N1) infection in cats causes systemic disease with potential novel routes
of virus spread within and between hosts. [quiz 364]. Am J Pathol.
2006;168:176–83. DOI: 10.2353/ajpath.2006.050466
Address for correspondence: Brett A. Sponseller, 2134 College of
Veterinary Medicine, Iowa State University, 1600 S 16th St, Ames, IA
50011-1248, USA; email: [email protected]
All material published in Emerging Infectious Diseases is in the
public domain and may be used and reprinted without special
permission; proper citation, however, is required.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
537
DISPATCHES
School Closure
and Mitigation of
Pandemic (H1N1)
2009, Hong Kong
Joseph T. Wu, Benjamin J. Cowling,
Eric H.Y. Lau, Dennis K.M. Ip, Lai-Ming Ho,
Thomas Tsang, Shuk-Kwan Chuang,
Pak-Yin Leung, Su-Vui Lo, Shao-Haei Liu,
and Steven Riley
In Hong Kong, kindergartens and primary schools were
closed when local transmission of pandemic (H1N1) 2009
was identified. Secondary schools closed for summer vacation shortly afterwards. By fitting a model of reporting and
transmission to case data, we estimated that transmission
was reduced ≈25% when secondary schools closed.
T
he emergence and subsequent global spread of pandemic (H1N1) 2009 presents several challenges to
health policy makers. Although some countries have substantial antiviral drug stockpiles available for treatment and
chemoprophylaxis and vaccines became available toward
the end of 2009, nonpharmaceutical interventions remain
the primary resource available to most populations to mitigate the impact of pandemic (H1N1) 2009 (1). One such
nonpharmaceutical intervention is school closure, either
reactively following outbreaks or proactively at district
or regional levels (2,3). A recent review has highlighted
the lack of consensus over the potential benefits of school
closures and the potential economic and social costs (4).
Although the current pandemic (H1N1) 2009 virus is of
moderate severity, data from 2009 provide an ideal opportunity to estimate the effectiveness of interventions against
pandemic influenza.
In Hong Kong Special Administrative Region, People’s Republic of China, there was a considerable delay
between the first reported imported case on May 1, 2009,
and the first reported local case (i.e., not otherwise epidemiologically linked with outside travel, contact with an imported case-patient, or contact with an infected person who
had contact with an imported case-patient) was laboratory-
Author affiliations: The University of Hong Kong School of Public
Health, Hong Kong Special Administrative Region, People’s Republic of China (J.T. Wu, B.J. Cowling, E.H.Y. Lau, D.K.M. Ip, L.-M.
Ho, S. Riley); Centre for Health Protection, Hong Kong (T. Tsang,
S.-K. Chuang); Hospital Authority, Hong Kong (P.-Y. Leung, S.-V.
Lo, S.-H Liu); and Food and Health Bureau, Hong Kong (S.-V. Lo)
DOI: 10.3201/eid1603.091216
538
confirmed and reported to the government on June 10. During the initial stages of the epidemic, the local government
operated under containment phase protocols, in which all
confirmed cases were isolated in hospital and their contacts
were traced, quarantined in hotels, hospitals, and holiday
camps, and provided with antiviral drug prophylaxis. When
the first nonimported case was confirmed, the government
entered the mitigation phase and announced immediate closure of all primary schools, kindergartens, childcare centers and special schools, initially for 14 days. Closures were
subsequently continued until the summer vacation began
July 10. Secondary schools generally remained open, while
those with >1 confirmed case were immediately closed for
14 days. Some containment-phase policies, including isolation of cases and prophylaxis of contacts, were maintained
until June 27. During our study period, patients seeking
treatment for suspected influenza at designated fever clinics and public hospital emergency departments were routinely tested, and pandemic (H1N1) 2009 virus infection
was a reportable infectious disease.
The Study
We analyzed epidemiologic data on laboratory-confirmed pandemic (H1N1) 2009 infections collected by the
Hong Kong Hospital Authority and Centre for Health Protection (the e-flu database). The epidemic curve of laboratory-confirmed pandemic (H1N1) 2009 cases showed a
biphasic pattern, with a small initial peak in reported cases
at the end of June followed by a nadir at the beginning of
July and rising incidence after that (Figure, panel A).
We specified an age-structured susceptible-infectious-recovered transmission model to explain the early
pandemic (H1N1) 2009 dynamics in Hong Kong (online
Technical Appendix, www.cdc.gov/EID/content/16/3/538Techapp.pdf). We estimated change points in the proportion of symptomatic infections identified and age-specific
rates of seeding of infectious cases from overseas. A simple
3-period model for changes in reporting rates provided a
parsimonious fit to the data (Figure, panel B). Reporting
rates were defined relative to the initial reporting rate. The
comparison between the observed and estimated incidence
is shown in the Figure, panel C.
We estimated that the relative rate of reporting declined
to ≈5.2% of its initial value from June 29 onward (Table).
Persons <19 years of age were estimated to be 2.6× more
susceptible than the rest of the population. The estimated effective reproductive number was 1.7 before educational institutions for children <13 years of age were closed on June
11, 1.5 between June 11 and July 10 when summer vacation
began, and 1.1 for the rest of the summer. The drop in reproductive number was driven by an estimated 70% reduction
in intra–age-group transmission concurrent with school closures. The fitted model implies that ≈182,000 persons (2.5%
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
School Closure and Pandemic (H1N1) 2009, Hong Kong
of the population) had experienced illness associated with
pandemic (H1N1) 2009 infection by August 27.
Figure, panel D shows that in the period from the first
confirmed local case to the start of summer vacation on July
10, there were a substantial number of cases among older
children (whose schools remained open) but few among
younger children (whose schools were closed during this
period). Only 10% of Hong Kong residents are young children <12 years of age, 8% are older children 13–18 years
of age, and 82% are adults.
Figure. Epidemiologic characteristics of pandemic (H1N1) 2009 in Hong Kong Special Administrative Region, People’s Republic of
China, during May through August 2009. A) Time series of laboratory-confirmed pandemic (H1N1) 2009 cases classified as imported or
nonimported (by age group) by date of illness onset. B) Estimates of the proportion of cases with illness onset on each day that would
subsequently be identified and laboratory confirmed (reporting rates). C) Time series of nonimported pandemic (H1N1) 2009 cases
by date of illness onset and the estimates of the underlying true epidemic curve (dashed line) and the fitted observed epidemic curve
allowing for changes in reporting rates (solid line). Dots indicate cases reported on a given day. Number of cases plotted logarithmically. D)
Distribution of ages of laboratory-confirmed pandemic (H1N1) 2009 cases over time plotted as 3-day rolling averages. Error bars indicate
95% confidence intervals.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
539
DISPATCHES
Table. Summary statistics of posterior distributions obtained by using Markov Chain Monte Carlo in modeling the effects of school
closures on mitigating a pandemic (H1N1) 2009 outbreak, Hong Kong, 2009*
Parameter†
Posterior mean (SD)
95% CI
Mi, daily number of effective seeds in age class i, I = 1,2,3
<13 y: 0.1 (0.1)
0–0.04
13–19 y: 0.4 (0.1)
0.2–0.6
>19 y: 0.2 (0.2)
0–0.6
Basic reproductive number
Before Jun 11: 1.71 (0.04)
1.63–1.78
Relative susceptibility of persons <20 y of age
2.64 (0.08)
2.48–2.78
Percentage reduction in intra-age-group transmission given by school closures
70% (3%)
64%–75%
Jun 18 (1.2 d)
Jun 17–Jun 21
t1, the date at which reporting rates began to decline
Jun 29 (0.3 d)
Jun 29–Jun 30
t2, the date at which reporting rates stopped declining
5.2% (1.1%)
3.5%–7.7%
r2, the reporting rate after t2
*CI, confidence interval.
†Model assumes a linear decline in reporting rates from 100% to r2 between times t1 and t2.
Conclusions
In Hong Kong, kindergartens and primary schools were
closed when local transmission of pandemic influenza was
identified. By using a parsimonious transmission model to
interpret age-specific reporting data, we concluded that the
subsequent closure of secondary schools for the summer
vacation was associated with substantially lower transmission across age groups. We estimated that reporting of
cases declined to 5.2% of its initial rate through the second
half of June; this is plausible given the gradual change from
containment phase to mitigation phase over that period.
It is challenging to infer the precise impact of school
closures in Hong Kong, given that they were implemented
immediately and sustained until summer vacation and so
we have little data on local transmissibility in the absence
of school closures. In previous pandemics attack rates have
generally been highest in younger children (4,5), and this
has been noted for pandemic (H1N1) 2009 in Mexico (6)
and Chicago (7). This observation, in combination with our
finding that children <12 years of age were relatively unaffected in Hong Kong during the school closure period
(Figure, panel D), intuitively implies that closures were effective in preventing infections in this age group. Furthermore, assuming that children are responsible for up to half
of all community transmission (8), it is likely that protection of younger children had substantial indirect benefits.
Previous studies have suggested that sustained school closures during a pandemic could reduce peak attack rates and
prevent 13%–17% of total cases in France (8) or <20% of
total cases in the United Kingdom (3). Our finding that the
reproductive number declined from 1.5 during the kindergarten and primary school closures to 1.1 during summer
vacation suggests that a much more substantial drop in attack rates would result from sustained school closures.
By including a model of reporting, we have also been
able to estimate case numbers. We estimated a cumulative
illness attack rate of ≈182,000 cases (2.5% of the population) by August 27. Between June 29 and August 27, a
total of 1,522/9,846 confirmed pandemic (H1N1) 2009
case-patients were hospitalized for medical reasons, among
540
whom 13 died. These numbers are more consistent with a
substantially lower case-fatality ratio than suggested by initial estimates of the severity of the pandemic (H1N1) 2009
strain (9,10). These estimates are dependent on the initial
rate of reporting being close to 100%.
We assumed that transmission varied by age and time.
If reporting rates varied in a way not accounted for by our
model, this would affect the accuracy of our estimates of
growth rate and cumulative attack rates. Although we attributed changes in transmissibility between June and August to school closures and summer vacations, it is possible
that other secular changes or external factors such as seasonality also contributed. However, it is unlikely that seasonal factors would have reduced transmission of influenza
at this time of year, on the basis of symptomatic and laboratory confirmed incidence of influenza from previous years
(11). Reference data on age-specific population attack rates
from serologic surveys or population-based surveillance
systems would enable us to calibrate our estimates of reporting rates and growth rates and provide external validation of our model estimates.
Acknowledgments
We acknowledge the Hospital Authority Strategy and Planning Division, Hospital Authority Information Technology Division, and the Centre for Health Protection for the collation of the
e-flu database. We thank Max Lau for assistance in drawing the
Figure. We thank Kwok Kin On and Danny Yao for helpful discussions.
This research received financial support from the Research
Fund for the Control of Infectious Disease, Food and Health Bureau, Government of the Hong Kong Special Administrative Region (grant no. HK-09-04-01); the Harvard Center for Communicable Disease Dynamics from the US National Institutes of Health
Models of Infectious Disease Agent Study program (grant no. 1
U54 GM088558); the Area of Excellence Scheme of the Hong
Kong University Grants Committee (grant no. AoE/M-12/06);
from Fogarty International Center (grant no. 3R01TW00824601S1); and the Research and Policy for Infectious Disease Dynam-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
School Closure and Pandemic (H1N1) 2009, Hong Kong
ics program from Fogarty International Center and the Science &
Technology Directorate, Department of Homeland Security.
Dr Wu is assistant professor at the University of Hong Kong
School of Public Health. His research interests include using
mathematical models to devise effective strategies for the control
and mitigation of infectious diseases.
6.
7.
8.
References
1.
Bell DM; World Health Organization Writing Group. Nonpharmaceutical interventions for pandemic influenza, national and community measures. Emerg Infect Dis. 2006;12:88–94.
2. Markel H, Lipman HB, Navarro JA, Sloan A, Michalsen JR,
Stern AM, et al. Nonpharmaceutical interventions implemented
by US cities during the 1918–1919 influenza pandemic. JAMA.
2007;298:644–54. DOI: 10.1001/jama.298.6.644
3. Vynnycky E, Edmunds WJ. Analyses of the 1957 (Asian) influenza
pandemic in the United Kingdom and the impact of school closures.
Epidemiol Infect. 2008;136:166–79.
4. Cauchemez S, Ferguson NM, Wachtel C, Tegnell A, Saour G, Duncan B, et al. Closure of schools during an influenza pandemic. Lancet
Infect Dis. 2009;9:473–81. DOI: 10.1016/S1473-3099(09)70176-8
5. Glezen WP. Emerging infections: pandemic influenza. Epidemiol
Rev. 1996;18:64–76.
9.
10.
11.
Chowell G, Bertozzi SM, Colchero MA, Lopez-Gatell H, Alpuche-Aranda C, Hernandez M, et al. Severe respiratory disease
concurrent with the circulation of H1N1 influenza. N Engl J Med.
2009;13;361:674-9.
Centers for Disease Control and Prevention. 2009 pandemic influenza A (H1N1) virus infections—Chicago, Illinois, April–July 2009.
MMWR Morb Mortal Wkly Rep. 2009;58:913–8.
Cauchemez S, Valleron AJ, Boelle PY, Flahault A, Ferguson NM.
Estimating the impact of school closure on influenza transmission
from sentinel data. Nature. 2008;452:750–4. DOI: 10.1038/nature06732
Fraser C, Donnelly CA, Cauchemez S, Hanage WP, Van Kerkhove
MD, Hollingsworth TD, et al. Pandemic potential of a strain of influenza A (H1N1): early findings. Science. 2009;324:1557–61. DOI:
10.1126/science.1176062
Wilson N, Baker MG. The emerging influenza pandemic: estimating
the case fatality ratio. Euro Surveill. 2009;14:1–4.
Cowling BJ, Wong IO, Ho LM, Riley S, Leung GM. Methods for monitoring influenza surveillance data. Int J Epidemiol.
2006;35:1314–21. DOI: 10.1093/ije/dyl162
Address for correspondence: Benjamin J. Cowling, School of Public
Health, The University of Hong Kong, Units 624-7, Cyberport 3,
Pokfulam, Hong Kong Special Administrative Region, People’s Republic
of China; email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
541
DISPATCHES
Global Origin of
Mycobacterium
tuberculosis in
the Midlands, UK
Jason T. Evans, Sarah Gardiner, E. Grace Smith,
Richard Webber, and Peter M. Hawkey
DNA fingerprinting data for 4,207 Mycobacterium tuberculosis isolates were combined with data from a computer program (Origins). Largest population groups were
from England (n = 1,031) and India (n = 912), and most
prevalent strains were the Euro-American (45%) and East
African–Indian (34%) lineages. Combining geographic and
molecular data can enhance cluster investigation.
K
nowledge and understanding of transmission dynamics
of Mycobacterium tuberculosis have been improved
by development of rapid molecular techniques that are being more extensively applied (1–3). Globally, application
of molecular techniques has identified major M. tuberculosis lineages associated with geographic origin (4–7). Previous studies on transmission dynamics of M. tuberculosis
have usually analyzed patient-declared population groups
to identify associations (1,7).
We describe a novel software (Origins; Experian,
Nottingham, UK) that assigns cultural, ethnic, and linguistic (CEL) groups on the basis of given and family
names. Records from 12 countries containing 1,600,000
family and 600,000 given names were analyzed to construct >200 origin types based on CEL factors associated with given and family names. This approach is applicable worldwide and is more accurate and has better
coverage than other software (8). The first use of Origins
in healthcare was identification of how a European CEL
group came to emergency departments in the United
Kingdom (9).
The aim of this study was to combine mycobacterial
fingerprinting data and patient origin as assigned by Origins to relate the occurrence of major global M. tuberculosis lineages in populations originating from around the
world. Combining data obtained from universal typing
and associated cultural and social links identified by Origins provides the potential for a deeper understanding of
the causes for distribution of prevalent strains in specific
population groups.
The Study
Nonduplicate initial M. tuberculosis complex isolates
(n = 4,207) were referred from the Midlands region of
the United Kingdom (population 9.5 million) to our center during January 2004–December 2007. These isolates
were incubated, identified, and analyzed by mycobacterial
interspersed repetitive units containing variable numbers
of tandem repeats (MIRU-VNTR) typing (10). MIRUVNTR typing analyzes the number of repetitive DNA sequences at multiple independent genetic loci. These data
were compared with those in an online database (MIRUVNTRplus), which was developed by Allix-Beguec et
al. (11). This database was used to assign M. tuberculosis strains to 1 of 6 lineages: East African–Indian, East
Asian, Euro-American, Indo-Oceanic, West African-1, or
West African-2.
The given and family names of 4,207 patients were
entered into Origins to obtain a CEL group for each, which
was then assigned a continent on the basis of the United
Nations Standard Country and Area Codes Classification
Scheme (12). Origins can assign a CEL group when the
given and family names are present in a dataset.
Within the study population are predominant CEL
groups that originate from each continent: 1,031 (25%)
from England in Europe, 912 (22%) from India in Asia, and
130 (3%) from Somalia in Africa (Table 1). The 18 isolates
from the Americas represented 3 CEL groups. Origins as-
Author affiliations: Health Protection Agency West Midlands Laboratory, Birmingham, UK (J.T. Evans, S. Gardiner, E.G. Smith, P.M.
Hawkey); King’s College London, London, UK (R. Webber); and
University of Birmingham, Birmingham (P.M. Hawkey)
Table 1. Mycobacterium tuberculosis isolates from CEL groups,
the Midlands, UK*
Continent and CEL group
No. (%) isolates
Africa
263 (6)
Somalia
130 (3)
Other, n = 18 groups
133 (3)
North and South America
CEL group, n = 3 groups
18 (0)
Asia
2,421 (58)
India
912 (22)
Pakistan
777 (18)
Pakistan–Kashmir
212 (5)
Bangladesh
199 (5)
Northern India
95 (2)
Other, n = 22 groups
226 (5)
Europe
1,473 (35)
England
1,031 (25)
Ireland
123 (3)
Scotland
99 (2)
Wales
98 (2)
Other, n = 23 groups
122 (3)
Unclassified
32 (0)
Total
4,207 (100)
DOI: 10.3201/eid1603.090813
*CEL, cultural, ethnic, and linguistic. CEL groups representing <1% (42
isolates) of the total are not shown.
542
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Global Origin of M. tuberculosis, UK
signed 4,175 (99%) of 4,207 patients to 77 CEL groups; 32
patients were unclassified.
Using the 15 MIRU-VNTR loci, we matched 4,117
(98%) of 4,207 typed strains to strains in the MIRU-VNTRplus database. The 90 strains that did not match with 1
of the 6 major global lineages were M. bovis (24 strains) or
could not be definitively assigned (66 strains) to 1 of the
6 global lineages. Continental and regional origins of patients as assigned by Origins and global lineage were then
combined to identify the distribution of global M. tuberculosis lineages within each population (Table 2).
The Euro-American lineage was the most prevalent lineage in our study. It contained 1,894 (45%) strains and was
present in each continental human population group. The
Euro-American strain was the most prevalent lineage in patients originating from Africa (125), the Americas (11), and
Europe (1,072) and was the second most prevalent lineage
in patients originating from Asia (663). The most prevalent
M. tuberculosis lineage in patients originating from Asia
was the East African–Indian lineage (1,150).
Combining geographic data assigned by Origins and
DNA fingerprinting data could affect public health efforts
to control tuberculosis because this approach can identify
strains in CEL groups in which specific global M. tuberculosis lineages are not present. The MIRU-VNTR profile
424352332515333 (East Asian lineage) was identified in
23 patients from the Midlands. Of these 23 patients, 20
resided within a 5-mile radius of each other. Within this
geographically restricted cluster, 12 (60%) of these patients
were assigned to the Europe CEL group and 8 patients to
part of the Asia CEL group. The first strain was identified
in 2004, and subsequent strains were identified in each year
of this study.
The MIRU-VNTR profile 422352542517333 was identified in 102 patients during 2004–2007. This profile was
matched with the East African–Indian lineage; 98 (96%)
patients originated from Asia and 4 (4%) from Europe. This
strain was identified in various locations in the Midlands
within an ≈40-mile radius that included all patients.
Conclusions
We studied >4,000 M. tuberculosis isolates typed in
the United Kingdom. Our study demonstrated that the combination of molecular and population group data provided
by novel software can provide information about the molecular epidemiology of M. tuberculosis.
Table 2. Distribution of Mycobacterium tuberculosis isolates according to lineage and continent of patient origin on the basis of CEL
group, the Midlands, UK*
No. (%) isolates in each M. tuberculosis lineage
Total no. (%)
East African–
EuroIndoWest
West
Continent and region
isolates
Indian
East Asian
American
Oceanic
African-1
African-2
Africa
Eastern
56 (4)
9 (4)
62 (3)
39 (7)
0
0
166 (4)
Central
0
0
4 (0)
1 (0)
0
0
5 (0)
Northern
2 (0)
0
3 (0)
1 (0)
0
0
6 (0)
Southern
2 (0)
1 (0)
29 (2)
3 (1)
0
0
35 (1)
Western
5 (0)
3 (1)
21 (1)
5 (1)
4 (24)
1 (14)
39 (1)
Unknown
0
1 (0)
6 (0)
1 (0)
0
0
8 (0)
Region total
65 (5)
14 (6)
125 (7)
50 (9)
4 (24)
1 (14)
259 (6)
Americas
Caribbean region
2 (0)
0
5 (0)
0
0
0
7 (0)
North America
2 (0)
0
4 (0)
1
0
0
7 (0)
South America
2 (0)
0
2 (0)
0
0
0
4 (0)
Region total
6 (0)
0
11 (1)
1 (0)
0
0
18 (0)
Asia
Eastern
4 (0)
25 (11)
10 (1)
5 (1)
0
0
44 (1)
Southeastern
1 (0)
2 (1)
3 (0)
5 (1)
0
0
11 (0)
Southern
1,117 (79)
100 (46)
614 (32)
403 (72)
4 (24)
2 (29)
2,240 (55)
Western
5 (0)
0
13 (1)
1 (0)
0
0
19 (0)
Unknown
23 (2)
1 (0)
23 (1)
5 (1)
0
0
52 (1)
Region total
1,150 (81)
128 (59)
663 (35)
419 (75)
4 (24)
2 (29)
2,366 (58)
Europe
Eastern
1 (0)
1 (0)
17 (1)
2 (0)
0
0
21 (1)
Northern
186 (13)
69 (32)
994 (52)
74 (13)
7 (41)
4 (57)
1,334 (33)
Southern
9 (1)
6 (3)
40 (2)
6 (1)
1 (6)
0
62 (2)
Western
0
0
14 (1)
0
1 (6)
0
15 (0)
Unknown
1 (0)
0
7 (0)
2 (0)
0
0
10 (0)
Region total
197 (14)
76 (35)
1,072 (57)
84 (15)
9 (53)
4 (57)
1,442 (35)
Unclassified
7 (0)
0
23 (1)
2 (0)
0
0
32 (1)
Total
1,425 (100)
218 (100)
1,894 (100)
556 (100)
17 (100)
7 (100)
4,117 (100)
*CEL, cultural, ethnic, and linguistic. Unknown indicates that the continent was identified but without a specific region. The United Kingdom (Great Britain
and Northern Ireland) is located in northern Europe and India, Pakistan, and Bangladesh are located in southern Asia. A total of 90 (2%) of 4,207 strains
were not assigned to 1 of the 6 major lineages.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
543
DISPATCHES
The 2 example MIRU-VNTR profiles show that molecular and social data identified an East Asian strain in
an unsuspected CEL group (Europe) and limited transmission of an East African–Indian strain between CEL
groups. Geographic restriction of the 424352332515333
East Asian strain in the European CEL group identified
possible recent transmission within this population group.
The 422352542517333 East African–Indian strain infected
a large number of patients (102) and showed wide geographic spread with limited transmission into the European
CEL group (4/102 patients). This finding indicates that this
strain is widely distributed in southern Asia and has not
been transmitted between CEL groups. Its wide distribution in the United Kingdom reflects areas of residence for
this CEL group.
Data from our study support previous findings and extend the dataset for Europe. Our results also include a large
number of strains from southern Asia, which were underrepresented in other studies (7,13).
Origins identified CEL groups within a country
(e.g., Kashmir in Pakistan or northern India) and divided
Great Britain and Ireland into 4 CEL groups (Table 1).
This enhanced differentiation could be useful in future
population-based studies because migration patterns may
be localized to specific areas within countries and common social networks could be identified. CEL groups can
be assigned to any dataset in which the patient’s name is
known. Traditional epidemiologic identification of ethnic
groups requires a questionnaire, but if patient names are
not in a dataset, then CEL groups cannot be assigned. Origins showed some discrepancies because the black Caribbean CEL group usually has British names and will be
assigned as a British CEL group (8). However, the utility of Origins is maximized when it is applied to diverse
populations.
Many countries now routinely type M. tuberculosis isolates by using MIRU-VNTR typing. This analysis
identifies clusters of strain types across place and time. By
using Origin software for identification of CEL groups,
public health officials can identify and investigate possible
cultural links for transmission of M. tuberculosis.
UK and European distributor of the commercial version of this
software.
Mr Evans is a clinical scientist at the Health Protection
Agency Midlands Regional Centre for Mycobacteriology at the
Heart of England National Health Service Foundation Trust in
Birmingham. His primary research studies focus on the molecular
and epidemiologic analysis of M. tuberculosis strains.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Acknowledgments
We thank all referring microbiology laboratories in the Midlands for providing specimens and isolates for MIRU-VNTR typing and all staff involved in culture and identification of M. tuberculosis. Origins software was originally developed and continues
to be maintained and improved by R.W.
11.
This study was supported in part by a grant from the UK Department of Health. Continued development of Origins software
is supported by an agreement between R.W. and Experian, the
12.
544
Allix-Beguec C, Fauville-Dufaux M, Supply P. Three-year population-based evaluation of standardized mycobacterial interspersed
repetitive-unit-variable-number tandem-repeat typing of Mycobacterium tuberculosis. J Clin Microbiol. 2008;46:1398–406 10.1128/
JCM.02089-07. DOI: 10.1128/JCM.02089-07
Cowan LS, Diem L, Monson T, Wand P, Temporado D, Oemig TV,
et al. Evaluation of a two-step approach for large-scale, prospective
genotyping of Mycobacterium tuberculosis isolates in the United
States. J Clin Microbiol. 2005;43:688–95 10.1128/JCM.43.2.688695.2005. DOI: 10.1128/JCM.43.2.688-695.2005
Mazars E, Lesjean S, Banuls AL, Gilbert M, Vincent V, Gicquel B,
et al. High-resolution minisatellite-based typing as a portable approach to global analysis of Mycobacterium tuberculosis molecular
epidemiology. Proc Natl Acad Sci U S A. 2001;98:1901–6 10.1073/
pnas.98.4.1901. DOI: 10.1073/pnas.98.4.1901
Fleischmann RD, Alland D, Eisen JA, Carpenter L, White O, Peterson J, et al. Whole-genome comparison of Mycobacterium tuberculosis clinical and laboratory strains. J Bacteriol. 2002;184:5479–90.
DOI: 10.1128/JB.184.19.5479-5490.2002
Sreevatsan S, Pan X, Stockbauer KE, Connell ND, Kreiswirth BN,
Whittam TS, et al. Restricted structural gene polymorphism in the
Mycobacterium tuberculosis complex indicates evolutionarily recent
global dissemination. Proc Natl Acad Sci U S A. 1997;94:9869–74.
DOI: 10.1073/pnas.94.18.9869
van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD,
Gicquel B, et al. Strain identification of Mycobacterium tuberculosis
by DNA fingerprinting: recommendations for a standardized methodology. J Clin Microbiol. 1993;31:406–9.
Gagneux S, DeRiemer K, Van T, Kato-Maeda M, de Jong BC, Narayanan S, et al. Variable host-pathogen compatibility in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A. 2006;103:2869–73
10.1073/pnas.0511240103. DOI: 10.1073/pnas.0511240103
Webber R. Using names to segment customers by cultural, ethnic or
religious origin. Journal of Direct Data and Digital Marketing Practice. 2007;8:226–42. DOI: 10.1057/palgrave.dddmp.4350051
Leaman AM, Rysdale E, Webber R. Use of the emergency department by Polish migrant workers. Emerg Med J. 2006;23:918–9
10.1136/emj.2006.035980. DOI: 10.1136/emj.2006.035980
Evans JT, Smith EG, Banerjee A, Smith RM, Dale J, Innes JA, et
al. Cluster of human tuberculosis caused by Mycobacterium bovis: evidence for person-to-person transmission in the UK. Lancet.
2007;369:1270–6 10.1016/S0140-6736(07)60598-4. DOI: 10.1016/
S0140-6736(07)60598-4
Allix-Beguec C, Harmsen D, Weniger T, Supply P, Niemann S.
Evaluation and strategy for use of MIRU-VNTRplus, a multifunctional database for online analysis of genotyping data and phylogenetic identification of Mycobacterium tuberculosis complex isolates.
J Clin Microbiol. 2008;46:2692–9 10.1128/JCM.00540-08. DOI:
10.1128/JCM.00540-08
United Nations Statistics Division. United Nations standard country
and area codes classification scheme [cited 2009 Apr 17]. http://unstats.un.org/unsd/methods/m49/m49regin.htm
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Global Origin of M. tuberculosis, UK
13.
Reed MB, Pichler VK, McIntosh F, Mattia A, Fallow A, Masala S,
et al. Major Mycobacterium tuberculosis lineages associate with patient country of origin. J Clin Microbiol. 2009;47:1119–28 10.1128/
JCM.02142-08. DOI: 10.1128/JCM.02142-08
Address for correspondence: Jason T. Evans, Health Protection Agency
West Midlands Laboratory, Heart of England National Health Service,
Bordesley Green East, Birmingham B9 5SS, UK; email: [email protected]
heartofengland.nhs.uk
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
545
DISPATCHES
Quinine-Resistant
Malaria in Traveler
Returning from
Senegal, 2007
Bruno Pradines, Thierry Pistone,
Khaled Ezzedine, Sébastien Briolant,
Lionel Bertaux, Marie-Catherine Receveur,
Daniel Parzy, Pascal Millet, Christophe Rogier,
and Denis Malvy
We describe clinical and parasitologic features of in
vivo and in vitro Plasmodium falciparum resistance to quinine in a nonimmune traveler who returned to France from
Senegal in 2007 with severe imported malaria. Clinical quinine failure was associated with a 50% inhibitory concentration of 829 nmol/L. Increased vigilance is required during
treatment follow-up.
R
esistance of Plasmodium falciparum to antimalarial
drugs is one the most worrisome problems in tropical
medicine. Quinine remains the first-line antimalarial option
for treatment of patients with complicated malaria in Europe and Africa. However, emergence of quinine resistance
has been sparsely documented (1). Maximizing the efficacy
and longevity of quinine as a drug to control malaria will
critically depend on pursuing intensive research into identifying in vitro markers and implementing active in vitro
and in vivo surveillance programs such as those supported
by the World Antimalarial Resistance Network. Such molecular markers are needed to monitor temporal trends in
parasite susceptibility (2). We report quinine-resistant P.
falciparum malaria in a patient who returned to France
from Senegal.
The Patient
A 17-year-old white man from France spent ≈2 months
(April and most of May) in 2007 in Dielmo, Senegal, where
malaria is highly endemic and shows intense perennial
transmission (3). He did not use antimalarial prophylaxis
or protection against mosquitoes. After returning to France,
he was admitted to the Bordeaux University Hospital CenAuthor affiliations: Institut de Médecine Tropicale du Service de
Santé des Armées, Marseille, France (B. Pradines, S. Briolant, L.
Bertaux, D. Parzy, C. Rogier); Centre Hospitalier Universitaire St.André, Bordeaux, France (T. Pistone, K. Ezzedine, M.-C. Receveur,
D. Malvy); and Université Victor Segalen Bordeaux 2, Bordeaux (K.
Ezzedine, P. Millet, D.Malvy)
DOI: 10.3201/eid1603.091669
546
ter on May 27, 2007 (day 0). The patient had P. falciparum
parasitemia level of 7% and a 2-day history of fever, myalgia, vomiting, and rapid deterioration of consciousness
into an arousable coma. A diagnosis of severe malaria with
cerebral involvement was confirmed.
Intravenous quinine formiate (loading dose 17 mg/
kg) was administered, followed by a maintenance dose
(8.3 mg/kg 3×/day for 7 days). The patient was afebrile on
day 3, and his thin and thick blood films became negative
for P. falciparum on day 6. He was discharged from the
hospital on day 7. However, on day 26, he relapsed and
had fever and vomiting. He was hospitalized again on day
27 with a core temperature of 40°7C, deterioration of consciousness, and a P. falciparum parasitemia level of 4%.
He received the same regimen of quinine formiate plus
intravenous clindamycin (10 mg 3×/day) for 7 days. His
serum quinine level (free and bound drug assayed by high
performance liquid chromatography) taken immediately
before the fourth drug dose was low (7 mg/L). The patient
was then given quinine (10 mg/kg 3×/day from day 30
through day 34). Serum quinine levels then increased and
fever cleared within 72 hours. However, a blood smear
was positive on day 34.
Because of the treatment failure with quinine and clindamycin, the patient was treated with oral co-artemether
(20 mg artemether and 120 mg lumefantrine, given as 4
tablets, followed by 4 tablets after 8 hours, and 4 tablets 2×/
day for 2 days; total = 24 tablets). Parasitic clearance was
observed within 48 hours. Blood smears and results of a
PCR for P. falciparum were negative from day 36 through
day 62. No further recrudescence occurred over the next
12 months.
The isotopic microdrug susceptibility tests used have
been described (4). The chloroquine-susceptible 3D7 P.
falciparum clone (Africa) and the chloroquine-resistant
W2 clone (Indochina), after 2 rounds of sorbitol synchronization, were used as controls. The 50% inhibitory concentration (IC50) values for 12 antimalarial drugs for the study
isolate and these 2 controls are shown in the Table. The
strain isolated on day 27 showed reduced susceptibility to
quinine (IC50 829 nmol/L, threshold 800 nmol/L) and chloroquine (472 nmol/L, threshold 100 nmol/L). The IC50 for
clindamycin was 39 μmol/L (the in vitro resistance cutoff
value was not determined). The isolate was susceptible to
all other antimalarial drugs tested. Phenotypes and genotypes were assessed only for parasites obtained on day 27.
We concurrently screened blood samples for resistance-associated point mutations. A sequence containing the ms4760 microsatellite was amplified as described
(5). The observed ms4760–18 profile was composed of 2
DNNND repeats and 2 DDDNHNDNHNN repeats. Genotyping of the P. falciparum chloroquine resistance transporter (Pfcrt) gene, which encodes a transport protein
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Quinine-Resistant Malaria
Table. In vitro susceptibility of 3 Plasmodium falciparum isolates to 12 antimalarial drugs, France*
50% Inhibitory concentration
Drug
Study isolate
3D7
W2
Quinine
829 nmol/L
157 nmol/L
574 nmol/L
Chloroquine
472 nmol/L
21 nmol/L
392 nmol/L
Mefloquine
10.4 nmol/L
49.3 nmol/L
39.3 nmol/L
Lumefantrine
19 nmol/L
29 nmol/L
35 nmol/L
Monodesethylamodiaquine
47 nmol/L
17 nmol/L
162 nmol/L
Dihydroartemisinin
1.1 nmol/L
2.5 nmol/L
3.0 nmol/L
Atovaquone
13.3 nmol/L
4.1 nmol/L
3.6 nmol/L
Cycloguanil
70 nmol/L
<10 nmol/L
1191 nmol/L
Pyrimethamine
354 nmol/L
<50 nmol/L
9139 nmol/L
Doxycycline
12.8 ȝmol/L
10.5 ȝmol/L
13.5 ȝmol/L
Azithromycin
24 ȝmol/L
48 ȝmol/L
39 ȝmol/L
Clindamycin
39 ȝmol/L
108 ȝmol/L
126 ȝmol/L
Cutoff value
>800 nmol/L
>100 nmol/L
>30 nmol/L
>150 nmol/L
>80 nmol/L
>10.5 nmol/L
>350 nmol/L
>500 nmol/L
>2,000 nmol/L
>35 ȝmol/L
ND
ND
*P. falciparum strains 3D7 and W2 were used as controls. ND, not determined.
involved in chloroquine resistance (K76T), and the dihydroopteroate synthase gene, which encodes the sulfadoxine
target (A437G), identified the resistant allele in our isolate
(6). There was no mutation in codon 268, which encodes
the atovaquone target (4). The isolate had only 1 copy of
the P. falciparum multidrug resistance (Pfmdr1) gene and a
mutation in codon 184, which suggested in vitro susceptibility to mefloquine (7). Amplification of DNA from parasites obtained on day 0 and preserved on fixed and stained
thin blood films by a modification of the procedure of Edoh
et al. (8) was not successful.
Conclusions
Quinine remains a reliable treatment for patients with
complicated or severe P. falciparum malaria outside southern Asia. Clinical failure with quinine used alone or in
combination with clindamycin is common in Africa. In our
case-patient, a correlation between the results of the in vivo
and in vitro assessments was demonstrated at day 27. Because of the lack of reliable data on the correlation between
quinine IC50 and clinical failure, arbitrary IC50 cutoff values
were chosen for in vitro quinine resistance (300 nmol/L,
500 nmol/L, or 800 nmol/L) (9).
Quinine resistance appears to share common characteristics with chloroquine resistance. It is associated
with mutations in the pfmdr1 (10) and pfcrt (11) genes.
Nevertheless, the mechanism of quinine resistance is still
unknown. In addition to the pfmdr1 and pfcrt genes, other
genetic polymorphisms such as microsatellite length variations in the P. falciparum sodium/hydrogen exchanger
(pfnhe-1) gene (5) and mutations in the P. falciparum
multidrug resistance protein gene may contribute to quinine resistance (12).
We report an association of clinical failure of quinine
treatment with an IC50 of 829 nmol/L, a mutation in codon
76 of the pfcrt gene, and an ms4760–18 profile for pfnhe-1
composed of 2 DNNND repeats. Isolates of P. falciparum
with >2 DNNND repeats may be associated with reduced
susceptibility to quinine. Henry et al. (5) reported that 2
DNNND repeats were associated with quinine IC50 values
ranging from 300 nmol/L to 700 nmol/L, and that 3 repeats
were associated with an IC50 >600 nmol/L. However, the
3 strains with IC50s >800 nmol/L had >2 DNNND repeats
(6). Our results are consistent with these data.
P. falciparum resistance levels may differ depending
on malaria transmission and drug pressure. Data from Senegal are fragmentary and were obtained by in vitro susceptibility studies conducted with isolates reported to have decreased in vitro susceptibility to quinine (6). Our patient had
traveled to Dielmo, Senegal, where in vitro surveillance of
antimalarial drug susceptibility has been conducted since
1996. During 1996–2005, the overall prevalence of isolates
with IC50 >800 nmol/L for quinine was <6%: 1% in 1996,
4% in 1997, 0% in 1998, 6% in 1999, and 0% in 2005 (13).
Quinine was used for 96.4% of the treatments administered
in Dielmo during 1990–1995 (14). This drug has since been
replaced by chloroquine, sulfadoxine-pyrimethamine, and
artemisinin-based combination therapies.
We report a patient with clinical failure associated quinine resistance in a traveler to Senegal. Our results are consistent with those of a recent review of the Uganda Malaria
Surveillance Project that reported a higher risk for selecting
quinine-resistant parasites associated with a 7-day quinine
treatment course (15). Thus, resistance to quinine should be
monitored in West Africa. Although such clinical failure of
therapy is rare, increased vigilance is required during treatment follow-up, and surveillance of the parasite population
should also be increased.
Dr Pradines is a senior researcher at the Research Unit in
Parasitological Biology and Epidemiology of the Institute for
Tropical Medicine of the French Army, Le Pharo, Marseille,
France. His primary research interests are the epidemiology and
population genetics of malaria.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
547
DISPATCHES
9.
References
1.
2.
3.
4.
5.
6.
7.
8.
548
Bjorkman A, Phillips-Howard PA. The epidemiology of drug-resistant malaria. Trans R Soc Trop Med Hyg. 1990;84:177–80. DOI:
10.1016/0035-9203(90)90246-B
Plowe CV, Rooper C, Barnwell JW, Happi CT, Joshi HH, Mbacham
W, et al. World Antimalarial Resistance Network (WARN) III: molecular markers for drug resistant malaria. Malar J. 2007;6:121.
DOI: 10.1186/1475-2875-6-121
Trape JF, Rogier C, Konate L, Diagne N, Bouganali H, Canque B,
et al. The Dielmo project: a longitudinal study of natural malaria
infection and the mechanism of protective immunity in a community living in a holoendemic area of Senegal. Am J Trop Med Hyg.
1994;51:123–37.
Parola P, Pradines B, Simon F, Carlotti MP, Minodier P, Ranjeva
MP, et al. Antimalarial drug susceptibility and point mutations associated with drug resistance in 248 Plasmodium falciparum isolates
imported from Comoros to Marseille, France in 2004–2006. Am J
Trop Med Hyg. 2007;77:431–7.
Henry M, Briolant S, Zettor A, Pelleau S, Baragatti M, Baret E, et al.
Plasmodium falciparum Na+/H+ exchanger 1 transporter is involved
in reduced susceptibility to quinine. Antimicrob Agents Chemother.
2009;53:1926–30. DOI: 10.1128/AAC.01243-08
Henry M, Diallo L, Bordes J, Ka S, Pradines B, Diatta B, et al. Urban
malaria in Dakar: chemosusceptibility and genetic diversity of Plasmodium falciparum isolates. Am J Trop Med Hyg. 2006;75:146–
51.
Price RN, Uhleman UC, Brockman A, McReady R, Asley E,
Phaipun L. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number. Lancet. 2004;364:438–47. DOI:
10.1016/S0140-6736(04)16767-6
Edoh D, Steiger S, Genton B, Beck HP. PCR amplification of DNA
from malaria parasites on fixed and stained thick and thin blood
films. Trans R Soc Trop Med Hyg. 1997;91:361–3. DOI: 10.1016/
S0035-9203(97)90109-7
Brasseur P, Kouamouo J, Moyou-Somo R, Druilhe P. Multi-drug
resistant falciparum malaria in Cameroon in 1987–1988. I. Stable
figures of prevalence of chloroquine- and quinine-resistant isolates
in the original foci. Am J Trop Med Hyg. 1992;46:1–7.
10. Reed MB, Saliba KJ, Caruana SR, Kirk K, Cowman AF. Pgh1 modulates sensitivity and resistance to multiple antimalarials in Plasmodium falciparum. Nature. 2000;403:906–9. DOI: 10.1038/35002615
11. Cooper RA, Lane KD, Deng B, Mu J, Patel JJ, Wellems TE, et al.
Mutations in transmembrane domains 1, 4 and 9 of the Plasmodium
falciparum chloroquine resistance transporter alter susceptibility to
chloroquine, quinine and quinidine. Mol Microbiol. 2007;63:270–
82. DOI: 10.1111/j.1365-2958.2006.05511.x
12. Mu J, Ferdig MT, Feng X, Joy DA, Duan J, Furuya T, et al. Multiple
transporters associated with malaria parasite responses to chloroquine and quinine. Mol Microbiol. 2003;49:977–89. DOI: 10.1046/
j.1365-2958.2003.03627.x
13. Pradines B, Tall A, Rogier C, Spiegel A, Mosnier J, Marrrama L,
et al. In vitro activities of ferrochloroquine against 55 Senegalese
isolates of Plasmodium falciparum in comparison with those of standard antimalarial drugs. Trop Med Int Health. 2002;7:265–70. DOI:
10.1046/j.1365-3156.2002.00848.x
14. Noranate N, Durand R, Tall A, Marrama L, Spiegel A, Sokhna C, et
al. Rapid dissemination of Plasmodium falciparum drug resistance
despite strictly controlled antimalarial use. PLoS One. 2007;2:e139.
DOI: 10.1371/journal.pone.0000139
15. Yeka A, Achan J, D’Alessandro U, Talisuna AO. Quinine monotherapy for treating uncomplicated malaria in the era of artemisinin-based
combination therapy: an appropriate public health policy? Lancet
Infect Dis. 2009;9:448–52. DOI: 10.1016/S1473-3099(09)70109-4
Address for correspondence: Khaled Ezzedine, Centre René Labusquière,
Tropical Disease Branch, PPF Parasitologie, Université Victor Segalen
Bordeaux 2, 146 Rue Léo Saignat, 33076 Bordeaux CEDEX, France;
email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Putative New
Lineage of West
Nile Virus, Spain
Ana Vázquez, María Paz Sánchez-Seco,
Santiago Ruiz, Francisca Molero,
Lourdes Hernández, Juana Moreno,
Antonio Magallanes, Concepción Gómez Tejedor,
and Antonio Tenorio
To ascertain the presence of West Nile virus (WNV),
we sampled mosquitoes in 2006 in locations in southern
Spain where humans had been infected. WNV genomic
RNA was detected in 1 pool from unfed female Culex pipiens mosquitoes. Phylogenetic analysis demonstrated that
this sequence cannot be assigned to previously described
lineages of WNV.
W
est Nile virus (WNV) has been described in Africa,
Europe, the Middle East, Asia, Australia, and, most
recently, the Americas. Over the last few years, many reports about WNV have been published after the outbreaks
in Romania, Morocco, Italy, Russia, and Israel, but especially with the introduction and spread of the virus in the
Americas. Currently, the virus has a wide geographic distribution, and WNV infection is considered an emerging
zoonosis (1).
Although only WNV lineage 1 is present in the
Americas, >5 lineages of the virus seem to circulate in
the Old World (2). In 2008, several countries in Europe
reported WNV activity due to different lineages. WNV
lineage 1 was isolated from horses and birds in northern
Italy, and WNV infection was described in 6 persons (3).
The Austrian veterinary authorities reported 2 outbreaks
of WNV in wild birds, 1 in northern Austria, and 1 in
the region of Vienna. The virus isolated from these birds,
sparrow hawks, was WNV lineage 2 and was very homologous to 2 strains previously found in goshawks in
Hungary in 2004 and 2005. These reports represented the
emergence of a WNV lineage 2 strain outside Africa for
the first time (4). Migratory birds that overwintered in
central Africa may have recently introduced this exotic
strain in the wetlands of different eastern European countries. Consequently, this neurotropic, exotic WNV strain
Author affiliations Centro Nacional de Microbiología–Instituto de
Salud Carlos III, Majadahonda, Spain (A. Vázquez, M.P. SánchezSeco, F. Molero, L. Hernández, A. Tenorio); Diputación Provincial de
Huelva, Huelva, Spain (S. Ruiz, J. Moreno, A. Magallanes); and Laboratorio Central de Veterinaria, Algete, Spain (C. Gómez Tejedor)
DOI: 10.3201/eid1603.091033
may become a resident pathogen in Europe with public
health consequences.
A new lineage of WNV (named Rabensburg virus),
of as yet unknown human pathogenicity, was isolated
from Culex pipiens mosquitoes in 1997 and 1999 on the
Czech Republic–Austria border, only a few hundred kilometers from the region where WNV emerged in Hungary (5). The Rabensburg isolate 97–103, obtained from
Cx. pipiens mosquitoes (1997) in Czech Republic (6), and
LEIVKrnd88–190, isolated from Dermacentor marginatus
ticks in a valley in the northwestern Caucasus Mountains
in 1998 (7), have been proposed to be novel variants of
WNV. These isolates are genetically different from viruses
of lineage 1 and 2 and have been proposed as members of
lineages 3 and 4, respectively. Moreover, 2 other related
viruses show no clear relationships with WNV, the strain
KUN MP502–66 from Malaysia, and Koutango (KOUV),
an African virus, with poor statistical support for clustering
with either of the WNVs, which suggests that they represent 2 single-isolate lineages (8).
Previous serologic surveys conducted with small rodents and humans in different areas of Spain have shown
evidence of WNV circulation (9). Although no neurologic
illness outbreaks have been documented in Spain, recent
studies indicate that WNV is circulating in the southern
part of the country, close to the areas of the recent foci in
Portugal and Morocco. This part of Spain contains several
wetlands, which have high densities of migratory birds and
mosquitoes. WNV activity has been reported in this region
on the basis of serologic surveys in birds, horses, and humans (10–12). Moreover, the first clinical case of WNV
infection in Spain was reported in 2004 in a patient visiting
southwestern Spain (13), and WNV lineage 1 was detected
and further isolated in free-living and captive Spanish golden eagles in south-central Spain (14). Following up these
results, we collected mosquito samples especially from areas from which positive serum samples had been obtained
to look for WNV in its vector.
The Study
The area of study included 2 wetlands: Marismas del
Odiel (tidal marshes) and Doñana (freshwater marshes),
both located in southwestern Spain. Mosquitoes were captured in 2006 with U.S. Centers for Disease Control and
Prevention light traps supplied with CO2 and with gravid
traps, which were used in the field during the late afternoon and retrieved the following morning. Mosquitoes
were pooled by species, sex, collecting site, and date. The
number of mosquitoes per pool ranged from 1 to 50. Mosquitoes/pools were homogenized in a range of 500–700 μL
of minimal essential medium supplemented with 200 U/mL
of antimicrobial drugs (penicillin/streptomycin) and 10%
of fetal bovine serum and then were stored at –80°C until
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
549
DISPATCHES
Table 1. Mosquitoes collected and tested for flavivirus in Huelva,
Spain, 2006
Species
No. pools
No. positive pools
6
0
Anopheles algeriensis
21
0
An. atroparvus
1
0
An. claviger
Anopheles sp.
1
0
2
0
Coquillettidia richiardii
491
33
Ochlerotatus caspius
71
1
Oc. detritus
2
0
Oc. geniculatus
2
0
Ochlerotatus sp.
131
1
Culex modestus
54
0
Cx. perexiguus
457
3
Cx. pipiens
308
151
Cx. theileri
Culex sp.
28
2
13
0
Culiseta annulata
51
0
Cs. longiareolata
1
0
Cs. subochrea
Culiseta sp.
1
0
Total
1,641
191
they were tested for flavivirus. The homogenate was centrifuged at 13,000 rpm for 5 min at 4°C, and the screening
was performed with a generic nested reverse transcription
PCR (15) to detect flavivirus genome.
This study comprised 35,424 mosquito specimens
grouped in 1,641 pools and representing 14 species (Table 1). Approximately 11% of the pools (191) showed a
positive result for flavivirus amplification. However, WNV
was identified in only 1 (pool HU2925/06). The pool contained 50 unfed Cx. pipiens complex females, captured
in June 2006 in Palos de la Frontera (Huelva; latitude
37°12′41.76′′N; longitude 6°55′9.58′′W).
A fragment of 1,813 nt from the nonstructural protein
5 (NS5) gene from this WNV genome (GenBank accession no. GU047875) was amplified by using 3 WNV-specific nested-PCRs designed in this study. The phylogenetic analysis resulted in a tree in which, as expected, this
sequence fell under the branch of WNV, with a value of
certainty of 100% (Figure, panel A). A common evolutionary branch between the Spanish strain and lineage 4
(99% certainty) can be observed, and both strains seem
related to lineage 3. Sequence differences observed between HU2925/06 and other strains of WNV are shown
in Table 2. The minor genetic distance was obtained for
lineage 4 and the highest for lineage 5. To confirm that
the sequence detected in Spain did not correspond to those
of the isolates KUN MP502–66 and KOUV, we analyzed
part of the genome sequence of both viruses, and partial
sequences showed that these viruses cluster into a distinct
genetic lineage (Figure, panel B). The sequence data for
KOUV was retrieved from GenBank (strain Koutango
DakArD1470, accession no. AF013384), and the partial
550
sequence for KUN MP502–66 was obtained in this work
amplifying part of the NS5 gene (GenBank accession no.
GU047874).
To isolate the virus, the positive pool was diluted 1:20
in the minimal essential medium, and 200 μL were injected
onto C6/36 (Aedes albopictus cells), RK-13 (rabbit kidney
cells), and Vero (African green monkey cells) monolayer
cells grown at a constant temperature for each cell line
(33°C, 37°C, and 37°C, respectively). Cell cultures were
incubated under the same conditions for 7 days, and 3 blind
passages were carried out. Signs of cytopathic effect were
checked daily, and the culture supernatants were tested by
Figure. Phylogenetic tree of 79 WNV isolates by the neighbor-joining
method and distance-p model on MEGA3.1 (www.megasoftware.
net/mega_dos.html). Bootstrap values correspond to 1,000
replications. A) Analysis of a 1,813-nt fragment of the nonstructural
protein 5 (NS5) gene. B) Analysis of the 800-nt fragment of the NS5
gene. KOUV (strain DakArD1470, AF013384) and Malaysia (strain
KUN MP502–66, GU047874) (boldface) were also used to obtain
this tree. Scale bars indicate nucleotide substitutions per site.
WNV, West Nile virus; nt, nucleotide; MBV, mosquito-borne viruses;
JEG, Japanese encephalitis group; JEV, Japanese encephalitis
virus; USUV, Usutu virus. Viruses used in the phylogenetic study
(GenBank accession nos.): WNV lineage 1 (AY712948, AY712947,
AY490240, AY278442, AY278441, AY277252, AF404757,
AF404756, AF404755, AF404754, AF404753, AF481864,
AY603654, AY646354, AY289214, AY795965, AY842931,
AY660002, AF196835, DQ164206, DQ164202, DQ164197,
AF260969, AF260968, AF260967, DQ211652, DQ164204,
DQ164200, DQ164201, AF533540, DQ005530, DQ118127,
DQ164205, DQ164203, DQ164199, D00246, DQ164196,
DQ080058, DQ080054, DQ080055, DQ080056, DQ164193,
DQ164186, DQ164195, DQ164191, DQ164205, DQ080053,
AY848696, AB185917, DQ080052, AB185914, DQ080051,
DQ164189, AF404756, DQ164190, AY712945, AY712946,
DQ080059, DQ164188, DQ164187, DQ164192, AF404757,
AY277252, AY274505); WNV lineage 2 (DQ116961, DQ318019,
M12294,
EF429200, AY532665,
EF429198,
EF429199,
EF429197, NC001563, AY688948, DQ176636, DQ318020); WNV
lineage 3 (AY765264); WNV lineage 4 (AY277251); WNV lineage
5 (DQ256376); Spanish WNV (HU2925/06, GU047875); JEV:
(NC001437); and USUV (NC006551) (as an outgroup).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Putative New Lineage of West Nile Virus, Spain
Table 2. Sequence differences between HU2925/06 and other strains representing previously described West Nile virus lineages or
related flaviviruses*
Nucleotide difference, %
Amino acid difference, %
Lineages
1a
1b
2
3
4
5
HU2925/06
JEV
USUV
1a
–
1.1
5
6.7
7.8
6
8.3
17.8
16.5
1b
11.1
–
4.8
6.8
7.6
6
8.1
17.9
16.7
20
21.4
–
5.5
6.1
6.7
7.7
18.5
17.6
2
3
21.6
22
20.8
–
6.8
7.8
8.6
18.1
18.1
21.8
22
22
22.6
–
9.5
5
19.6
19.1
4
19.6
20.2
21.3
22.3
23.4
–
10.9
18.4
17.1
5
HU2925/06
22.5
22.4
22.2
22
18.3
23.4
–
19.1
19.2
27.3
28.2
27.1
26.9
29
27.7
28
–
14.3
JEV
USUV
26.1
26.8
27.8
29.1
28.1
27.6
28.2
25
–
*Values of nucleotide and amino acid differences were calculated by p distance and multiplied by 100. JEV, Japanese encephalitis virus; USUV, Usutu
virus.
reverse transcription–PCR. Neither cytopathic effect nor
amplification was obtained. No virus was isolated from any
of the 3 cell cultures.
Conclusions
The phylogenetic analysis performed on a 1,813-nt
fragment of the NS5 gene clearly shows that the sequence
recovered in Spain grouped within the branch of WNV with
high values of certainty (100%). The tree topology shows
a common evolutionary branch between the Spanish WNV
genome (HU2925/06) and lineage 4, which clusters close to
lineage 3. The lineages 3 and 4 were detected recently in Europe (1997 and 1998, respectively), and they have not been
previously associated with natural disease in vertebrates.
In addition, the phylogenetic analysis performed on 800 nt
fragments of the NS5 gene indicated that the Spanish strain
was not the same that KUN MP502–66 and KOUV, and that
KUN MP502–66 seems to be a different lineage.
This report and the recent description of WNV lineage
1 in wild birds (14) demonstrate the circulation of both
WNV lineages in Spain. This finding should lead to the
analysis of serologic evidence of WNV infections in birds,
horses, and humans in Spain and surrounding countries,
where the highly pathogenic WNV strains sporadically
cause clinical infections. An explanation for the high WNV
seroprevalence levels found in birds, horses, and humans
in the absence of neurologic disease in Spain could be that
this new lineage infects birds and protects them from most
pathogenic strains of WNV.
Acknowledgments
We are grateful to Gema Rojo, Rubén Villalba, Azucena
Sánchez, Tomás Mayoral, and Montserrat Agüero for their help
and technical support. We also thank Hervé Zeller for providing
an aliquot of virus from Malaysia (isolate KUN MP502-66).
This work is part of the multidisciplinary network Enfermedades Viricas Transmitidas por Artrόpodos y Roedores (funded by
Instituto de Salud Carlos III [ISCIII] G03/059). It has been sup-
ported in part by the European Commission (contract 010284-2,
Emerging Diseases in a Changing European Environment Project
contribution EDEN0157), and grants FIS PI07/1308, Red de Investigacion de Centros de Enfermedaes Tropicales RD06/0021,
and the agreement signed between the Institute of Health Carlos
III and the Spanish Ministry of Health and Social Policy for the
surveillance of imported viral hemorrhagic fevers.
Dr Vázquez is a postdoctoral researcher at the Spanish Institute of Health Carlos III. Her research interests include emerging
arboviruses transmitted by mosquitoes, especially flaviviruses.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Hubálek Z, Halouzka J. West Nile fever—a reemerging mosquitoborne viral disease in Europe. Emerg Infect Dis. 1999;5:643–50.
DOI: 10.3201/eid0505.990505
Bondre VP, Jadi RS, Mishra AC, Yergolkar PN, Arankalle VA. West
Nile virus isolates from India: evidence for a distinct genetic lineage.
J Gen Virol. 2007;88:875–84. DOI: 10.1099/vir.0.82403-0
Gobbi F, Napoletano G, Piovesan C, Russo F, Angheben A, Rossanese A, et al. Where is West Nile fever? Lessons learnt from recent
human cases in northern Italy. Euro Surveill. 2009;14:pii:19143.
Bakonyi T, Ivanics E, Erdélyi K, Ursu K, Ferenczi E, Weissenböck
H, et al. Lineage 1 and 2 strains of encephalitic West Nile virus,
Central Europe. Emerg Infect Dis. 2006;12:618–23.
Bakonyi T, Hubalek Z, Rudolf I, Nowotny N. Novel flavivirus or
new lineage of West Nile virus, central Europe. Emerg Infect Dis.
2005;11:225–31.
Hubalek Z, Halouzka J, Juricova Z, Sebesta O. First isolation of
mosquito-borne West Nile virus in the Czech Republic. Acta Virol.
1998;42:119–20.
Lvov DK, Butenko AM, Gromashevsky VL, Kovtunov AI, Prilipov
AG, Kinney R, et al. West Nile virus and other zoonotic viruses in
Russia: examples of emerging–reemerging situations. Arch Virol
Suppl. 2004;18:85–96.
Scherret JH, Poidinger M, Mackenzie JS, Broom AK, Deubel V,
Lipkin WI, et al. The relationships between West Nile and Kunjin viruses. Emerg Infect Dis. 2001;7:697–705. DOI: 10.3201/
eid0704.010418
Filipe AR, de Andrade HR. Arboviruses in the Iberian Peninsula.
Acta Virol. 1990;34:582–91.
Bernabeu-Wittel M, Ruiz-Pérez M, del Toro MD, Aznar J, Muniain A, de Ory F, et al. West Nile virus past infections in the general population of southern Spain. Enferm Infecc Microbiol Clin.
2007;25:561–5. DOI: 10.1157/13111181
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
551
DISPATCHES
11.
Figuerola J, Jiménez-Clavero MA, Rojo G, Gómez-Tejedor C,
Soriguer R. Prevalence of West Nile virus neutralizing antibodies in
colonial aquatic birds in southern Spain. Avian Pathol. 2007;36:209–
12. DOI: 10.1080/03079450701332329
12. Jiménez-Clavero MA, Gómez-Tejedor C, Rojo G, Soriguer R,
Figuerola J. Seorsurvey of West Nile virus antibodies in equids and
bovids in Spain. Vet Rec. 2007;161:212.
13. Kaptoul D, Viladrich PF, Domingo C, Niubó J, Martínez-Yélamos S,
de Ory F, et al. West Nile virus in Spain: report of the first diagnosed
case (in Spain) in a human with aseptic meningitis. Scand J Infect
Dis. 2007;39:70–1. DOI: 10.1080/00365540600740553
14. Jiménez-Clavero MA, Sotelo E, Fernandez-Pinero J, Llorente F,
Blanco JM, Rodriguez-Ramos J, et al. West Nile virus in golden
eagles, Spain, 2007. Emerg Infect Dis. 2008;14:1489–91. DOI:
10.3201/eid1409.080190
552
15.
Sánchez-Seco MP, Rosario D, Domingo C, Hernandez L, Valdes
K, Guzmán MG, et al. Generic RT-nested-PCR for detection of
flaviviruses using degenerated primers and internal control followed by sequencing for specific identification. J Virol Methods.
2005;126:101–9. DOI: 10.1016/j.jviromet.2005.01.025
Address for correspondence: Ana Vázquez, González Laboratory
of Arboviruses and Imported Viral Diseases, National Centre for
Microbiology, Institute of Health Carlos III, Madrid, Spain; email:
[email protected]
Use of trade names is for identification only and does not imply
endorsement by the Public Health Service or by the U.S.
Department of Health and Human Services.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Venezuelan Equine
Encephalitis and
2 Human Deaths,
Peru
Stalin Vilcarromero, Patricia V. Aguilar,
Eric S. Halsey, V. Alberto Laguna-Torres,
Hugo Razuri, Juan Perez, Yadira Valderrama,
Eduardo Gotuzzo, Luis Suárez,
Manuel Céspedes, and Tadeusz J. Kochel
Studies have suggested that enzootic strains of Venezuelan equine encephalitis (VEE) subtype ID in the Amazon region, Peru, may be less pathogenic to humans than
are epizootic variants. Deaths of 2 persons with evidence of
acute VEE virus infection indicate that fatal VEEV infection
in Peru is likely. Cases may remain underreported.
V
enezuelan equine encephalitis (VEE) is an emerging
zoonotic disease in the Amazon region of Peru. After dengue, it is considered the second most important arboviral disease in Peru. Most human infections with VEE
virus (VEEV) are caused by subtype ID (1–5), and within
subtype ID, 6 genotypes have been described (6). In Peru,
the Colombia/Venezuela, Panama/Peru, and Peru/Bolivia
genotypes have been identified among VEEV subtype ID
isolates (1,5,7). Epidemiologic investigations have failed
to detect neurologic disease or deaths among >200 VEE
cases in this country (T.J. Kochel, unpub. data). Only 2 fatal cases with VEEV subtype ID have been reported, both
in Panama (6,8). In contrast, fatal cases with neurologic
complications (estimated mortality rate 0.7%) have been
described regularly for human outbreaks caused by VEEV
subtypes IAB and IC (9–12). On the basis of these reports,
it has been suggested that enzootic VEEV strains in Peru
may be less pathogenic to humans than the epizootic variants (13). However, only 200 cases identified in Peru may
not be enough to make such an assertion.
We recently described a severe infection in a 3-yearold boy who had VEEV subtype ID (14). Here we describe
Author affiliations: Naval Medical Research Center Detachment,
Lima, Peru (S. Vilcarromero, P.V. Aguilar, E.S. Halsey, V.A. Laguna-Torres, H. Razuri, J. Perez, T.J. Kochel); Universidad Peruana
Cayetano Heredia, Lima (S. Vilcarromero, E. Gotuzzo); Hospital de
Apoyo Yurimaguas, Loreto, Peru (Y. Valderrama); Dirección General de Epidemiología, Lima (L. Suárez); and Instituto Nacional de
Salud, Lima (M. Céspedes)
DOI: 10.3201/eid1603.090970
2 fatal infections in persons with evidence of acute VEEV
infection in Peru. One patient had confirmed subtype ID.
The Study
In 2000, the Naval Medical Research Center Detachment (NMRCD) and the Ministry of Health of Peru established a passive surveillance study to determine arboviral
causes of febrile illness (protocol NMRCD.2000.0006).
Patients with acute, undifferentiated febrile illness of <7
days were invited to enroll, and demographic and clinical
information was obtained at the time of enrollment. Blood
samples were obtained and assayed by virus isolation, and
convalescent-phase samples were obtained 10 days to 4
weeks later for serologic studies.
Patient 1 was a 7-year-old girl from San Benito, a rural
community near Yurimaguas city (Figure 1), who on June
19, 2006, was noted to have nasal congestion, sneezing,
chills, malaise, myalgia, abdominal pain, and fever followed by several episodes of watery, nonbloody feces, and
vomiting. Her condition rapidly worsened, and she began
having tonic–clonic seizures. The next day the involuntary
movement and vomiting stopped; however, other signs
worsened and she became somnolent and prostrate. Later
that day she was admitted to the Hospital Santa Gema of
Loreto
Iquitos
Yurimaguas
Lima
Puerto Maldonado
Madre de Dios
Figure 1. Selected sites in Peru of passive surveillance study to
determine arboviral causes of febrile illness in Peru, established
in 2000 by Naval Medical Research Center Detachment and the
Ministry of Health of Peru (protocol NMRCD.2000.0006). Sites
shown include those of 2 patients with evidence of acute Venezuelan
equine encephalitis virus infection. Shaded area is Titicaca Lake.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
553
DISPATCHES
Yurimaguas with fever, dehydration, stupor, and signs of
respiratory distress along with tonic–clonic seizures. Temperature was 40°C (104°F), blood pressure 90/50 mm Hg,
respiratory rate markedly increased, and heart rate 132
beats/min. Distal cyanosis, nasal flaring, rhonchi without
crackles, and supraclavicular and intercostal retractions
were noted, but no jaundice, lymphadenopathy or conjunctival hemorrhage were observed. Hepatomegaly (liver 4 cm
under the costal border), stupor, and neck stiffness were
also noted. Laboratory test results showed a left shift in the
leukocyte count and renal failure (Table 1). Blood smears
were negative for malaria parasites. Preliminary diagnoses
were sepsis, convulsive status, and respiratory distress.
Later that day the patient was considered to have a complicated, febrile, neurologic illness, and a blood sample was
sent for advanced analysis at the NMRCD in Lima, Peru,
and the National Institute of Health of Peru.
The girl was given supportive therapy with broad spectrum antibiotics, intravenous hydration, oxygen, and anticonvulsive medications (diazepam, phenytoin). On June
21, seizures persisted, and the patient became comatose
and later died of respiratory arrest. Arterial blood gasses
and electrolytes could not be measured because of the limited capacity of the hospital laboratory. The girl’s parents
did not consent to lumbar puncture or autopsy.
Examination of the girl’s serum in Vero cells identified
VEEV, and sequencing and phylogenetic analyses using
previously described methods further identified it as subtype ID Panama/Peru genotype (Figure 2) (15). On the day
the serum was collected (1 day after onset of signs), viremia titer was 1.8 ×104 PFU/mL, similar to titers from other
VEEV-infected study patients who did not have neurologic
complications (Table 2). The National Institute of Health
reported the sample to be negative for leptospiral and rickettsial organisms, according to ELISA immunoglobulin
(Ig) M and indirect immunofluorescent assays, respectively. Blood and cerebrospinal fluid cultures for bacteria were
not attempted.
DEI5191 PE94 AF004852
FSL507 PE01 AY966915
Subtype IC/IAB/ID
71D1392 PE71 U88648
Colombia/
71D1394 PE71 U88649
Venezuela/Peru
75D143 PE75 U88650
IC 3908 VE95 U55350
FSL3344 PE07 GQ844875
FSL2612 PE06 GQ368473
FSL2649 PE06 GQ336477
FSL2314 PE06 EU935737
OBT4458 PE06 GQ336476
FSL1137 PE04 GQ161190
FSL201 PE00GQ503335
FSL240 PE00 GQ503336
100
FSL985 PE03 GQ336471
Subtype ID
FSL1065 PE03 GQ336473
FSL1063 PE03 GQ161198
Panama/
FSL995 PE03 GQ336472
Peru
IQT6088 PE98 AY966908
PE30609 PE98 AY966915
FSL252 PE00 GQ503337
100
IQT7988 PE98 AY966911
IQT8131 PE98 AY966912
IQT6415 PE98 AY966909
IQU664 PE99 AY966904
IQT3971 PE97 AY966906
P Quintero PA64 U88636
100
903843 PA84 U88640
Fe5 47 FL65 AF004469 Subtype II
OAX131 MX96 U96406
OAX142 MX96 U96407
73U157 GU73 AF055844 Subtype IE
100 77U214 GU77 AF055843
80U76 GU80 AF055845
63U16 MX63 U96403
FSL190 PE00 AY966913
81 PE407660 PE98 AY966916
PE409040 PE98 AY966917
PE409100 PE98 AY966918 Subtype III
PC256 PE97 AY964683
PC254 PE97 AY966905
54 001 PE02 AY964684
Mucambo BeAn8 BR54 AF075253
Tonate CaAn 410 FG73 AF075254
Cabassou CaAr508 FG68 AF075259
Pixuna BeAr 35645 BR61 AF075256
Rio Negro 663 AG80 AF004436
100
EEE FL93 939 AF159554
EEE PA86 435731 AF159560
EEEV Br56 BeAn5122 AF159559
Figure 2. Neighbor-joining phylogenetic tree of Venezuelan equine
encephalitis virus (VEEV) complex based on partial sequence of
the PE2 segment (nucleotide positions ≈8385–9190 of the VEEV
genome). The tree was rooted by using an outgroup of 3 major
lineages of Eastern equine encephalitis virus (EEEV). The strain
isolated from a 7-year-old girl who died from acute VEEV infection
in Peru, June 21, 2006, is in boldface. Viruses are labeled by
code designation, abbreviated location name, year of isolation
(last 2 digits of year only), and GenBank accession numbers of
the corresponding sequences. PA, Panama; GU, Guatemala;
MX, Mexico; FG, French Guiana; VE, Venezuela; BR, Brazil; AG,
Argentina; PE, Peru; FL, Florida. Numbers indicate bootstrap
values. Scale bar indicates nucleotide substitutions per site.
Patient 2 was a 25-year-old man from Puerto Maldonado, a city in the department of Madre de Dios (Figure 1).
On February 24, 2005, he reported fever, headache, myal-
Table 1. Laboratory test results for 2 patients infected with Venezuelan equine encephalitis virus, Peru*
Testing
Patient no. 1
Patient no. 2
Date blood collected
2006 Jun 20
2005 Feb 28
2005 Mar 1
Hematocrit, %
36
36
22
3
Thromocytes, cells/mm
233,000
143,750
NM
Leukocytes
3
Total, cells/mm
21,450
3,900
NM
Bands, %
7
4
NM
Segmented cells, %
84
72
NM
Eosinophils, %
0
0
NM
Monocytes, %
0
14
NM
Lymphocytes, %
9
10
NM
ESR, mm/h
41
NM
NM
Creatinine, mg/dL
2.1
9.1
8.8
Urea, mg/dL
115
206
238
*NM, not measured; ESR, erythrocyte sedimentation rate.
554
0.01
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Reference range
38–44
150,000–450,000
4,500–10,000
3–5
55–65
0.5–4.0
3–8
25–35
1–15
0.8–1.4
20–45
VEE and Human Deaths
Table 2. Venezuelan equine encephalitis virus titers in 10 patients, Peru
Date of
Date of
Serum
Patient
Age,
symptom
blood
titer,
code
y/sex
Location
onset
collection PFU/mL
4
Patient 1
7/F
Yurimaguas,
2006
2006
1.8 × 10
Loreto
Jun 19
Jun 20
FSL2612
4
FSL2649
32/M
Yurimaguas,
2006
2006
3.4 × 10
Loreto
Aug 7
Aug 8
3
IQE1149
14/F Iquitos, Loreto
2005
2005
1.0 × 10
Apr 14
Apr 15
2
IQE831
8/F
Iquitos, Loreto
2005
2005
3.0 × 10
Mar 13
Mar 14
2
IQE3605
6/M
Iquitos, Loreto
2006
2006
1.0 × 10
Apr 3
Apr 4
2
IQE3741
10/F Iquitos, Loreto
2006
2006
5.0 × 10
Apr 21
Apr 24
4
IQE5023
7/M
Iquitos, Loreto
2007
2007
1.3 × 10
Feb 27
Feb 28
2
FMD1737
18/M
Puerto
2007
2007
5.0 × 10
Dec 17
Dec 19
Maldonado,
Madre de Dios
3
FMD1905
21/F
Puerto
2008
2008
3.0 × 10
Feb 9
Feb 12
Maldonado,
Madre de Dios
Patient 2¶ 25/M
Puerto
2005
NM
2005
Feb 24
Feb 28
Maldonado,
Madre de Dios
Signs and symptoms
Death
+
Bleed*
–
Fever
+
Seizure
+
GI†
+
Resp‡
+
Aches§
+
–
–
+
–
+
+
+
–
–
+
–
–
–
+
–
–
+
–
–
–
+
–
–
+
–
+
–
+
–
–
+
–
+
–
+
–
–
+
–
+
–
+
–
–
+
–
–
–
+
–
–
+
–
+
–
+
+
+
+
–
+
–
+
*Epistaxis, bleeding gums, ecchymosis, purpura, hematochezia, or melena.
†Gastrointestinal (nausea, vomiting, diarrhea, or abdominal pain).
‡Respiratory (cough, dyspnea, or cyanosis).
§Arthralgia, myalgia, bone pain, malaise, or prostration.
¶Virus isolation attempts unsuccessful; ELISA immunoglobulin M results positive for Venezuelan equine encephalitis. NM, not measured.
gia, nausea, vomiting, and diarrhea. Because he was from
an outlying rural area, he was taken to the local health center where he received intravenous rehydration and partially
recovered. The patient stayed at home, but his signs and
symptoms persisted. On February 27, jaundice and epistaxis developed, and the local health center referred him to
the Santa Rosa Hospital in Puerto Maldonado, where he
was admitted on February 28. The patient’s status deteriorated quickly; hematuria and hematemesis were followed
by liver and renal failure (Table 1), and the patient died on
March 1. Postmortem examination found multiple hemorrhages in his lungs, kidneys, and stomach. A serum sample
collected at the time of admission was positive for VEEV
antibodies, according to ELISA IgM (titer 6,400) (2,3). The
case was presumed to be VEE, although virus isolation attempts were unsuccessful. Serologic assays produced negative results for leptospiral and arboviral diseases, including
dengue, Mayaro, yellow fever, Oropouche, and Eastern
equine encephalitis.
Conclusions
Patient 1 had no previous history of neurologic disease
or poor health. VEEV subtype ID infection (Panama/Peru
genotype) was confirmed. Because her viremia titer was
similar to titers of other patients who did not have neurologic complications and survived VEEV infection, viremia
levels alone may not account for the difference in disease
outcome. Although VEEV was isolated from the patient’s
serum and she met the Centers for Disease Control and Prevention’s diagnostic criteria for confirmed VEE (www.cdc.
gov/ncphi/disss/nndss/casedef/arboviral_current.htm), we
cannot rule out concomitant bacterial meningitis in this patient, who had meningismus and leukocytosis. The limited
extent of our diagnostic procedures prevent us from concluding with certainty that VEEV infection was the main
cause of death.
Patient 2 had severe hemorrhagic complications.
Although an uncommon manifestation of VEEV infection, these complications have been reported elsewhere
(6,8,14). To date, only VEEV subtype ID has been isolated in and around Puerto Maldonado (5); thus, this patient
was probably also infected with this subtype. However,
we cannot unequivocally state that the patient died from
VEEV infection.
Both fatal cases described in this report were clinically
similar to previously reported enzootic and epidemic VEE
cases (1,6,8,9,11,14). Initially, both patients had fever, body
aches, vomiting, and diarrhea (Table 1) (1, 6,8,9,11), which
are also caused by other tropical diseases like dengue. Only
some patients, such as patient 1 from Yurimaguas, had neurologic complications (Table 1), which are more commonly
observed in children<15 years of age (6,8,9,11).
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
555
DISPATCHES
Our surveillance activities were limited to only 8 surveillance sites in Peru (Figure 1), so VEE cases in other
areas may remain undiagnosed. Because of the lack of surveillance activities and proper diagnostic capabilities, fatal
VEEV infection in Peru is likely; many cases may remain
underreported in isolated rural locations where the disease
is most common. Additional studies are needed to fully
measure the extent and effects of VEE in Peru.
Acknowledgments
We thank Carolina Guevara, Zonia Rios, Roxana Caceda,
Vidal Felices, Cristhopher Cruz, Connie Fernandez, Aydee Cruz,
and Javier Ignacio Effio for invaluable support in the execution of
the study. We also thank the personnel of the Hospital de Apoyo
Yurimaguas for supporting our febrile illness surveillance study.
This study was funded by the US Department of Defense
Global Emerging Infections Systems Research Program, Work
Unit no. 847705.82000.25GB.B0016. The study protocol for
Surveillance and Etiology of Acute Febrile Illnesses in Peru was
approved by the Naval Medical Research Center Institutional Review Board (protocol NMRCD.2000.0006) in compliance with all
applicable federal regulations governing the protection of human
subjects.
Dr Vilcarromero is a physician who participates in the Surveillance and Etiology of Febrile Acute Diseases in Peru project, conducted by the NMRCD, Peruvian Ministry of Health, and
Cayetano Heredia and San Marcos Universities in Lima. He is
responsible for the project in an extensive area in the jungle of
Peru, and his work is now based in the city of Iquitos.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
References
1. Aguilar PV, Greene IP, Coffey LL, Medina G, Moncayo AC, Anishchenko M, et al. Endemic Venezuelan equine encephalitis in northern Peru. Emerg Infect Dis. 2004;10:880–8.
2. Watts DM, Callahan J, Rossi C, Oberste MS, Roehrig JT, Wooster
MT, et al. Venezuelan equine encephalitis febrile cases among humans in the Peruvian Amazon River region. Am J Trop Med Hyg.
1998;58:35–40.
3. Watts DM, Lavera V, Callahan J, Rossi C, Oberste MS, Roehrig JT,
et al. Venezuelan equine encephalitis and Oropouche virus infections among Peruvian army troops in the Amazon region of Peru.
Am J Trop Med Hyg. 1997;56:661–7.
556
4.
Morrison AC, Forshey BM, Notyce D, Astete H, Lopez V, Rocha C,
et al. Venezuelan equine encephalitis virus in Iquitos, Peru: urban
transmission of a sylvatic strain. PLoS Negl Trop Dis. 2008;2:e349.
DOI: 10.1371/journal.pntd.0000349
Aguilar PV, Adams AP, Suarez V, Beingolea L, Vargas J, Manock
S, et al. Genetic characterization of Venezuelan encephalitis virus
from Bolivia, Ecuador and Peru: identification of a new subtype ID
lineage. PLoS Negl Trop Dis. 2009;3:e514. DOI: 10.1371/journal.
pntd.0000514
Quiroz E, Aguilar PV, Cisneros J, Tesh RB, Weaver SC. Venezuelan
equine encephalitis in Panama: fatal endemic disease and genetic diversity of etiologic viral strains. PLoS Negl Trop Dis. 2009;3:e472.
DOI: 10.1371/journal.pntd.0000472
Oberste MS, Weaver SC, Watts DM, Smith JF. Identification and genetic analysis of Panama-genotype Venezuelan equine encephalitis
virus subtype ID in Peru. Am J Trop Med Hyg. 1998;58:41–6.
Johnson KM, Shelokov A, Peralta PH, Dammin GJ, Young NA. Recovery of Venezuelan equine encephalomyelitis virus in Panama. A
fatal case in man. Am J Trop Med Hyg. 1968;17:432–40.
Rivas F, Diaz LA, Cardenas VM, Daza E, Bruzon L, Alcala A, et al.
Epidemic Venezuelan equine encephalitis in La Guajira, Colombia,
1995. J Infect Dis. 1997;175:828–32. DOI: 10.1086/513978
Weaver SC, Salas R, Rico-Hesse R, Ludwig GV, Oberste MS,
Boshell J, et al. Re-emergence of epidemic Venezuelan equine
encephalomyelitis in South America. VEE Study Group. Lancet.
1996;348:436–40. DOI: 10.1016/S0140-6736(96)02275-1
Bowen GS, Fashinell TR, Dean PB, Gregg MB. Clinical aspects
of human Venezuelan equine encephalitis in Texas. Bull Pan Am
Health Organ. 1976;10:46–57.
Centers for Disease Control and Prevention. Venezuelan equine
encephalitis–Colombia, 1995. MMWR Morb Mortal Wkly Rep.
1995;44:721–4.
Weaver SC, Ferro C, Barrera R, Boshell J, Navarro JC. Venezuelan
equine encephalitis. Annu Rev Entomol. 2004;49:141–74. DOI:
10.1146/annurev.ento.49.061802.123422
Vilcarromero S, Laguna-Torres VA, Fernandez C, Gotuzzo E, Suarez L, Cespedes M, et al. Venezuelan equine encephalitis and upper
gastrointestinal bleeding in child. Emerg Infect Dis. 2009;15:323–5.
DOI: 10.3201/eid1502.081018
Moncayo AC, Medina GM, Kalvatchev Z, Brault AC, Barrera R,
Boshell J, et al. Genetic diversity and relationships among Venezuelan equine encephalitis virus field isolates from Colombia and Venezuela. Am J Trop Med Hyg. 2001;65:738–46.
Address for correspondence: Tadeusz J. Kochel, US Naval Medical
Research Center Detachment, 3230 Lima Pl, Washington, DC 205213230, USA; email: [email protected]
All material published in Emerging Infectious Diseases is in the
public domain and may be used and reprinted without special
permission; proper citation, however, is required.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Extensively
Drug-Resistant
Mycobacterium
tuberculosis from
Aspirates, Rural
South Africa
Scott K. Heysell, Anthony P. Moll, Neel R. Gandhi,
François J. Eksteen, Palav Babaria,
Yacoob Coovadia, Lynn Roux, Umesh Lalloo,
Gerald Friedland, and N. Sarita Shah
The yield from aspirating lymph nodes and pleural fluid
for diagnosing extensively drug-resistant (XDR) tuberculosis is unknown. Mycobacterium tuberculosis was cultured
from lymph node or pleural fluid aspirates of 21 patients;
7 (33%) cultures grew XDR M. tuberculosis. Additive diagnostic yield for XDR M. tuberculosis was found in parallel
culture of sputum and fluid aspirate.
T
uberculosis (TB) is the leading cause of death among
HIV-infected persons in sub-Saharan Africa (1). Drugresistant TB is an emerging public health threat in HIVprevalent settings, but diagnosis is challenging because
of the severely limited laboratory capacity for culture and
drug-susceptibility testing (DST). TB diagnosis for HIVinfected patients is particularly challenging because these
patients may be more likely to have smear-negative pulmonary disease or extrapulmonary TB (2,3). Extrapulmonary TB often is diagnosed by clinical findings, indirect
measures (e.g., chemistry and cell count of cerebrospinal
or pleural fluid, ultrasound of lymph nodes, or pericardial
effusions), or smear microscopy for acid-fast bacilli from
aspirated extrapulmonary fluid. However, drug-resistant
TB is impossible to diagnose by these methods, instead requiring mycobacterial culture and DST (4,5).
Author affiliations: Tugela Ferry Care and Research Collaboration,
Tugela Ferry, South Africa (S.K. Heysell, A.P. Moll, N.R. Gandhi, F.J.
Eksteen, P. Babaria, U. Lalloo, G. Friedland, N.S. Shah); University
of Virginia, Charlottesville, Virginia, USA (S.K. Heysell); Philanjalo
Care Center, Tugela Ferry (A.P. Moll, FJ. Eksteen); Yale University, New Haven, Connecticut, USA (P. Babaria, G. Friedland); Albert Einstein College of Medicine and Montefiore Medical Center,
Bronx, New York, USA (N.R. Gandhi, N.S. Shah); National Health
Laboratory Services, Durban, South Africa (Y. Coovadia, L. Roux);
and Enhancing Care Initiative-KZN, Nelson R. Mandela School of
Medicine, Durban (U. Lalloo)
DOI: 10.3201/eid1603.091486
CME ACTIVITY
Medscape, LLC is pleased to provide online continuing medical education (CME) for this journal article, allowing clinicians the
opportunity to earn CME credit. This activity has been planned and
implemented in accordance with the Essential Areas and policies of
the Accreditation Council for Continuing Medical Education through
the joint sponsorship of Medscape, LLC and Emerging Infectious
Diseases. Medscape, LLC is accredited by the ACCME to provide
continuing medical education for physicians. Medscape, LLC designates this educational activity for a maximum of 0.25 AMA PRA
Category 1 Credits™. Physicians should only claim credit commensurate with the extent of their participation in the activity. All
other clinicians completing this activity will be issued a certificate of
participation. To participate in this journal CME activity: (1) review
the learning objectives and author disclosures; (2) study the education content; (3) take the post-test and/or complete the evaluation at
www.medscapecme.com/journal/eid; (4) view/print certificate.
Learning Objectives
Upon completion of this activity, participants will be able to:
• Recognize how concomitant HIV infection can affect the
diagnosis of tuberculosis
• Describe procedures and patient characteristics in the
current study
• Identify how aspirate cultures can help identify extensively
drug-resistant tuberculosis
• Specify the percentage of patients with tuberculosis who
were diagnosed with aspirate but not sputum cultures.
Editor
Karen L. Foster, Writer/Editor, Emerging Infectious Diseases.
Disclosure: Karen L. Foster has disclosed no relevant financial
relationships.
CME Author
Charles P. Vega, MD, Associate Professor; Residency Director,
Department of Family Medicine, University of California, Irvine,
California, USA. Disclosure: Charles P. Vega, MD, has disclosed
no relevant financial relationships.
Authors
Disclosures: Scott K. Heysell, MD, MPH; Anthony P. Moll,
MBChB; Neel R. Gandhi, MD; François J. Eksteen, MD; Palav
Babaria, MD; Yacoob Coovadia, MBBCh, FCPath; Lynn Roux;
Gerald Friedland, MD; and N. Sarita Shah, MD, have disclosed
no relevant financial relationships. Umesh Lalloo, MD, has
disclosed the following relevant financial relationships: served as
an advisor or consultant for AstraZeneca Pharmaceuticals LP,
GlaxoSmithKline, and Boehringer Ingelheim Pharmaceuticals,
Inc.; served as a speaker or a member of a speakers bureau for
AstraZeneca Pharmaceuticals LP, GlaxoSmithKline, Boehringer
Ingelheim Pharmaceuticals, Inc.; received grants for clinical
research from the National Institutes of Health.
The prevalence of multidrug-resistant and extensively
drug-resistant TB (XDR TB) in South Africa has risen exponentially during the past decade. At our rural study site,
≈10% of all TB cases now are drug resistant, and >90% of
TB patients are HIV infected (6). Death from XDR TB exceeds 80%; most infected persons die before sputum culture
and DST results are known (6). To improve case detection
and decrease diagnostic delay of drug-resistant TB among
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
557
DISPATCHES
patients with suspected extrapulmonary TB, we initiated a
program to aspirate lymph nodes and pleural fluid for culture and DST. We quantified the yield of these lymph node
and pleural fluid aspirates for diagnosing XDR TB.
The Study
We performed a retrospective cross-sectional study to
determine the proportion of patients in whom TB and XDR
TB could be diagnosed by culture of fine-needle aspiration
of a lymph node or pleural fluid. Additionally, we sought to
determine the yield of lymph node and pleural fluid aspiration beyond culture of sputum alone. All patients were eligible who had an aspirate of a noninguinal lymph node or
pleural fluid sent for mycobacterial culture and DST during
September 1, 2006–December 31, 2008, from the district
hospital in rural Tugela Ferry, South Africa. This 355-bed
hospital serves 200,000 Zulu persons.
Hospital protocol was for lymph node aspirates to be
obtained at the bedside by using sterile technique and largebore needle at the point of maximal swelling. Pleural fluid
was obtained by standard thoracentesis. Care was taken not
to introduce air while injecting the fluid specimen into mycobacterial blood culture bottles (BACTEC MycoF-lytic,
Becton Dickinson, Sparks, MD, USA). Smear microscopy
was not performed on the fluid aspirate. Bottles were transported to the provincial TB referral laboratory in Durban
and cultured by using the automated BACTEC 9240 analyzer (Becton Dickinson) in which growth is continuously
monitored for 42 days. Mycobacterium tuberculosis was
confirmed with niacin and nitrate reductase tests. DST of
positive cultures was performed by using the 1% proportional method on Middlebrook 7H11 agar for isoniazid
(critical concentration, 0.2 μg/mL), rifampin (1 μg/mL),
ethambutol (7.5 μg/mL), ofloxacin (2 μg/mL), kanamycin
(6 μg/mL), and streptomycin (2 μg/mL) (7). XDR TB was
defined as M. tuberculosis resistant to at least isoniazid,
rifampin, ofloxacin, and kanamycin (8). Aspirate culture
results were compared with sputum culture results if the
patient also had a sputum culture performed within 2 weeks
of the lymph node or pleural fluid culture. Standard practice
was for 1 sputum specimen to be collected for smear microscopy and another specimen to be collected for culture,
depending on the patient’s ability to expectorate. Sputum
was cultured by using the automated BACTEC MGIT 960
system (Becton Dickinson); DST of positive specimens
was performed as described above (9).
Medical records were reviewed for basic demographic
and clinical data, including age, sex, HIV status, antiretroviral therapy, and TB history. The yield of lymph node
and pleural fluid aspirates for detecting M. tuberculosis and
drug resistance was described by using simple frequencies.
Incremental yield of aspirate was calculated for patients
who had collection for sputum and either lymph node or
558
pleural fluid aspirate. Ethical approval was obtained from
the University of KwaZulu-Natal, Yale University, and Albert Einstein College of Medicine.
For 77 patients, either a lymph node (n = 34) or pleural
fluid (n = 33) was aspirated for culture and DST during the
study period (Table 1). No patient had both pleural fluid
and lymph node aspirates performed.
Of the 34 lymph node cultures performed, 12 (35%)
grew M. tuberculosis, 1 (3%) grew nontuberculous mycobacteria, and 2 (6%) were other bacteria that were not further speciated (Table 1). Of the 12 positive M. tuberculosis
cultures, 9 (75%) were drug-susceptible M. tuberculosis,
and 1 (8%) was XDR M. tuberculosis; for 2, DST results
were missing. Concurrent sputum samples were available for 6 (50%) of the 12 culture-positive M. tuberculosis lymph node aspirates: 3 (50%) were concordant with
the aspirate culture (2 drug-susceptible and 1 XDR), and 3
(50%) were sputum culture negative.
Of the 33 pleural fluid cultures performed, 9 (27%)
grew M. tuberculosis, 1 grew Cryptococcus sp., and 1
grew another bacterium (Table 1). Of the 9 M. tuberculosis culture-positive pleural fluid specimens, 3 (33%) were
drug-susceptible and 6 (67%) were XDR. Among these 9
patients, 5 (55%) had concurrent sputum samples available: 3 (60%) were concordant with the aspirate culture (1
drug-susceptible and 2 XDR), and 2 (40%) were sputum
culture negative.
From 17 patients, a sputum sample and either a lymph
node or a pleural fluid aspirate was collected for culture and
DST (Table 2). For 14, at least 1 specimen was culture positive for M. tuberculosis, of which 9 (64%) were positive for
sputum, 11 (79%) were positive in the lymph node or pleural
fluid, and 5 (36%) were positive by fluid aspirate alone, including 2 patients with XDR M. tuberculosis (Table 2).
Conclusions
In this study of predominately HIV-infected patients
suspected of having extrapulmonary TB, one third of positive M. tuberculosis cultures from lymph node or pleural
fluid aspirates were XDR. The additive yield for the diagnosis of any TB of these aspirates above sputum culture
alone was 36%. Our findings suggest that strategies of
solitary sputum culture or reliance on microscopy of nonsputum fluid analysis would miss opportunities to diagnose
drug-resistant TB. Parallel culture of sputum and aspirate
fluid appears to be of substantial added benefit for diagnosing XDR TB in this setting.
Our study has several limitations. Aspirates were collected on the basis of the attending physician’s clinical
judgment. Therefore, the yield for M. tuberculosis and
XDR M. tuberculosis may be overestimated, and other
factors that may have influenced the physician’s suspicion
of drug-resistant TB or increased the likelihood of a posi-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Extensively Drug-Resistant M. tuberculosis
Table 1. Patient characteristics and results of aspirate cultures for Mycobacterium tuberculosis, South Africa, September 1, 2006–
December 31, 2008*
Characteristic
Lymph node
Pleural fluid
Total no. patients
34
33
Median age, y (IQR)
31 (25–39)
33 (28–39)
Female sex, no. (%)
18 (53)
21 (64)
HIV status, no. (%)
Positive
30 (88)
24 (73)
Negative
1 (3)
1 (3)
Unknown
3 (9)
8 (24)
3
Median CD4 cells/mm (IQR)
128.5† (84–375)
207‡ (118–334)
Receiving ARVs,§ no. (% of HIV-infected)
Yes
14 (47)
13 (54)
No
13 (43)
10 (42)
Unknown
3 (10)
1 (4)
Median duration on ARVs, wk (IQR)
8.4¶ (2.4–21.1)
10.5# (5.8–55.1)
History of prior TB, no. (%)
8 (24)
9 (27)
Receiving TB treatment,§ no. (%)
20 (59)
18 (55)
Median duration of TB treatment, wk (IQR)
12** (4–16)
6†† (3–14)
Positive culture results, no. (%)
12 (35)
9 (27)
M. tuberculosis
Drug-susceptible TB, no. (% of M. tuberculosis)
9 (75)
3 (33)
XDR TB, no. (%)
1 (8)
6 (67)
Missing drug susceptibility results, no. (%)
2 (17)
0
Nontuberculous mycobacteria
1 (3)
0
Cryptococcus sp.
0
1 (3)
Other bacteria
2 (6)
1 (3)
*IQR, interquartile range; ARVs, antiretroviral drugs; TB, tuberculosis; XDR TB, extensively drug-resistant TB.
†Available for 26 HIV-infected patients, excluding CD4% for 1 infant (36%).
‡Available for 18 HIV-infected patients.
§At time of aspirate collection.
¶Available for 10 of 14 patients receiving ARVs.
#Available in 12 of 13 patients receiving ARVs.
**Available for 9 patients.
††Available for 12 patients.
tive aspirate are not known without additional prospective
study. It is also not possible to comment on the true incremental yield after comparing with sputum culture; sputum
was not collected from all patients, nor were the reasons for
lack of collection documented.
Nonetheless, as co-infection with HIV and TB increases in sub-Saharan Africa, the number of persons with extrapulmonary TB, both drug-susceptible and drug-resistant,
is anticipated to rise (10,11). Therefore, diagnostic algorithms for extrapulmonary TB must consider the critical
importance of extrapulmonary fluid culture and DST for
diagnosis of drug-resistant TB, particularly in HIV-infected persons. Furthermore, this study highlights the need to
validate novel diagnostic tests for M. tuberculosis drug resistance on nonsputum fluids.
Dr Heysell was supported by the Burroughs Wellcome Fund
and the American Society of Tropical Medicine and Hygiene.
Drs Shah and Gandhi are supported by the Doris Duke Charitable
Foundation Clinical Scientist Development Awards and President’s Emergency Plan for AIDS Relief (PEPFAR). Dr Friedland
is supported by the Gilead Foundation and PEPFAR. Additional
support for this work was provided by the Howard Hughes Medical Institute and Irene Diamond Fund. No supporting organization
had any role in the study.
While conducting the study, Dr Heysell was a Burroughs
Wellcome Fund/American Society of Tropical Medicine and Hygiene postdoctoral fellow in tropical infectious disease at Yale
University and living in Tugela Ferry, South Africa. He is currently a fellow in infectious diseases and international health at
Table 2. Comparison of culture yield for Mycobacterium tuberculosis in patients with collection of sputum and either lymph node or
pleural fluid aspirate, South Africa, September 1, 2006–December 31, 2008*
Lymph node, n = 9
Pleural fluid, n = 8
Result from sputum
DS TB
XDR TB
No DST
No growth
DS TB
XDR TB
No DST
No growth
DS TB
2
1
1
XDR TB
1
2
2
No growth
1
2
3
2
*DS TB, drug-susceptible tuberculosis; XDR TB, extensively drug-resistant tuberculosis; DST, drug susceptibility testing.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
559
DISPATCHES
the University of Virginia, with research interests in the epidemiology, diagnosis, and susceptibility testing of drug-resistant
tuberculosis.
2.
3.
4.
5.
560
7.
Gandhi NR, Shah NS, Andrews J, Vella V, Moll A, Scott M, et al.
Early mortality among MDR and XDR TB patients in rural South
Africa. Am J Respir Crit Care Med. 2010;181:80–6.
Mitchison DA. Drug resistance in tuberculosis. Eur Respir J Suppl.
2005;25:376–9. DOI: 10.1183/09031936.05.00075704
Centers for Disease Control and Prevention. Revised definition of
extensively drug-resistant tuberculosis. MMWR Morb Mortal Wkly
Rep. 2006;55:1176.
Hanna BA, Ebrahimzadeh A, Elliott LB, Morgan MA, RuschGerdes S, Cio M, et al. Multicenter evaluation of the BACTEC
MGIT 960 system for the recovery of mycobacteria. J Clin Microbiol. 1999;37:748–52.
World Health Organization. Improving the diagnosis and treatment
of smear-negative pulmonary and extrapulmonary tuberculosis
among adults and adolescents. Recommendations for HIV-prevalent
and resource-constrained settings. Geneva: The Organization; 2006.
World Health Organization. Anti-tuberculosis drug resistance in the
world. Report no. 4. Geneva: The Organization; 2008.
8.
References
1.
6.
Corbett EL, Marston B, Churchyard GJ, De Cock KM. Tuberculosis in sub-Saharan Africa: opportunities, challenges and change in
the era of antiretroviral therapy. Lancet. 2006;367:926–37. DOI:
10.1016/S0140-6736(06)68383-9
Shenoi S, Heysell SK, Moll AP, Friedland G. Multi-drug resistant
and extensively drug-resistant tuberculosis: consequences for the
global HIV community. Curr Opin Infect Dis. 2009;22:11–7. DOI:
10.1097/QCO.0b013e3283210020
Elliott AM, Namaambof K, Allent BW, Luo N, Hayes RJ, Pobee JO,
et al. Negative sputum smear results in HIV-positive patients with
pulmonary tuberculosis in Lusaka, Zambia. Int J Tuberc Lung Dis.
1993;74:191–4. DOI: 10.1016/0962-8479(93)90010-U
Perenboom RM, Richter C, Swai ABM, Kitinya J, Mtoni I, Chande
H, et al. Diagnosis of tuberculous lymphadenitis in an area of
HIV infection and limited diagnostic facilities. Trop Geogr Med.
1994;46:288–92.
Hudson CP, Wood R, Maartens G. Diagnosing HIV-associated tuberculosis: reducing costs and diagnostic delay. Int J Tuberc Lung
Dis. 2000;4:240–5.
9.
10.
11.
Address for correspondence: Scott K. Heysell, Infectious Diseases
and International Health, University of Virginia, PO Box 801337,
Charlottesville, VA 22908, USA; email: scott.[email protected]
Use of trade names is for identification only and does not imply
endorsement by the Public Health Service or by the U.S.
Department of Health and Human Services.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
Parvovirus 4–like
Virus in Blood
Products
Jozsef Szelei, Kaiyu Liu, Yi Li, Sandra Fernandes,
and Peter Tijssen
Porcine plasma and factor VIII preparations were
screened for parvovirus 4 (PARV)–like viruses. Although the
prevalence of PARV4-like viruses in plasma samples was
relatively low, viruses appeared to be concentrated during
manufacture of factor VIII. PARV4-like viruses from human
and porcine origins coevolved likewise with their hosts.
I
n 2005, a previously unknown virus, parvovirus 4
(PARV4), was detected in a plasma sample from a
hepatitis B–positive injection drug user (IDU) (1). Although PARV4 was subsequently detected in plasma from
healthy donors, its prevalence is higher in samples from
IDUs, AIDS patients, and hepatitis C virus–infected persons (2,3). In recent serologic studies, 67% of HIV-infected
IDUs had antibodies to PARV4, whereas non-IDU controls
were seronegative (4) This increased prevalence in IDUs
and persons with hemophilia most likely reflects parenteral
transmission of the virus (4,5). Furthermore, PARV4 was
frequently detected in human coagulation factor concentrates prepared from older plasma samples (6). The lower
detection frequency in current concentrates may be due to
exclusion of high-risk batches, e.g., from IDU or hepatitis
C virus–infected persons during plasma collection, and to
improved purification methods. The presence of PARV4
in plasma suggests a viremic phase enabling spread of the
virus to different organs. Even though recent studies by
Kleinman et al. indicate that parvovirus B19 is not readily
transmitted to susceptible hosts by blood component transfusion, similar evaluation of PARV4 transmission will be
invaluable in assessing the need to routinely screen for this
emerging virus (7).
PARV4 contains a 5-kb single-stranded DNA genome
with inverted terminal repeats and a large open reading frame (ORF) in each half of the genome coding for
nonstructural (NS) protein and structural protein, respectively. PARV4-like viruses form a separate cluster
among the parvoviruses (1,8). Three genotypes of human
PARV4 parvoviruses with ≈93% nucleotide sequence
Author affiliations: Institut National de la Recherche Scientifique–Institut Armand-Frappier, Laval, Quebec, Canada (J. Szelei, K. Liu, Yi
Li, S. Fernandes, P. Tijssen); and Central People’s Republic of China
Normal University, Wuhan, People’s Republic of China (Y. Li)
DOI: 10.3210/eid1603.090746
identity have been described. The sequence of genotype
1 (PARV4-g1) is highly conserved, whereas that of genotype 2 (PARV4-g2 [formerly PARV5]) is somewhat more
diverse. PARV4-g2 is found mostly in older coagulation
factor concentrates (1960s–1980s), suggesting that genotype 1 emerged recently (6,8). A third genotype (PARV4g3) was isolated from persons in sub-Saharan Africa
(9). Additionally, PARV4-like viruses with a 60%–65%
nucleotide identity were recently identified at high frequencies in porcine and bovine tissue samples in People’s
Republic of China (10).
In this study, porcine plasma samples and factor VIII
(FVIII) concentrates used by persons with hemophilia who
have autoimmune antibodies against human FVIII were investigated for PARV4-like viruses. We then determined the
degree of identity of these isolates with the human virus.
The Study
Plasma samples from healthy pigs were collected
in Great Britain in 2001. Initially, these samples were
tested for PARV4-like viruses by using previously described degenerate PCR primers (10). DNA was extracted from samples by using the High Pure DNA Isolation
Figure 1. Parallel PCR amplification of PARV4-like (A) and PPV
(B) by using purified DNA from clotting FVIII preparations. The
results of this PCR usually suggested a higher PARV4 load despite
the higher efficiency of the PPV PCR (J. Szelei and P. Tijssen,
unpub. data). This finding was confirmed with the quantitative
MIMIC PCR method for PPV (11). Numbers indicate different lots
of FVIII prepared in 1:1994A, 2:1994B, 3:1996A, 4:1996B, 5:1999,
6:2000A, 7:2000B, 8:2001A, 9:2001B, 10:2001C, 11:2001D, and
12: DNA marker (1-kb ladder; Invitrogen, Carlsbad, CA USA).
PARV4, parvovirus 4; PPV, porcine parvovirus; FVIII, factor VIII.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
561
DISPATCHES
Table 1. Percentage diversity of genome sequences of PARV4-like viruses*†
Genotype
PARV4-p
PHoV
BHoV
PARV4-p
98–99
PHoV
97–98
98–99
BHoV
62
62
99
PARV4-g1
58
58
60
PARV4-g2
58–59
58
59–60
PARV4-g3
58
58
60
PARV4-g1
PARV4-g2
98–100
91–92
92
96–99
91–92
*PARV4, parvovirus type 4; PARV4-p, porcine PARV-4; PHoV, porcine hokovirus; BHoV, bovine hokovirus; PARV4-g1, PARV4 genotype 1; PARV4-g2,
PARV4 genotype 2; PARV4-g3, PARV4 genotype 3.
†Pairwise sequence comparisons were performed by using the ClustalW program (www.ebi.ac.uk/Tools/clustalw) as described in Figure 2 and
percentages of sequence identities were calculated. Nucleotide sequences representing the equivalent regions (position 248–5088, numbered according
to the PARV4 sequence NC_007018) were used to align the DNA fragments.
Kit (Roche Applied Science, Roche Diagnostics Canada; Laval, Quebec, Canada). Only 3 of the 98 plasma
samples contained detectable amounts of PARV4-like
viruses. To further study these porcine viruses, we obtained nearly full-length genomes from overlapping PCR
fragments. Primers designed for these PCRs were PrS1:
5′-CCACACCTACCTCGCCTATAAGAATCAG-3′;
PrAS1:
5′-CTCCACTTGTTCAGCACGGGATCC-3′;
PrS2: 5′-CCACGAGCTGGAAGTCTTTA-3′; PrAS2: 5′GGAGTCCGCATACCCATAACAGGCTG-3′; PrS3: 5′GTGTACCGCAGTGGGAGCCATG-3′; and PrAS3: 5′TTCTGGGCAACCCACTGATCAGAAGG-3′. The nearly
full-length clones were sequenced by primer-walking. Ge-
nomic analysis confirmed that these viruses were related to
the PARV4 viruses and were close relatives of the recently
identified porcine hokoviruses (PHoVs) (10).
We also confirmed the moderate frequency of PARV4like viremia in the previously tested pig plasma samples
with a more sensitive PCR assay by using specific primers
PrS4 (5′-AGTTACGGGGGACCGCTACAGTG-3′) and
PrAS3. In contrast, examination of 11 commercial clotting
FVIII preparations showed that all of these independent
lots contained substantial amounts of PARV4-like parvovirus, whereas the level of porcine parvovirus DNA was
generally lower in the corresponding samples (Figure 1).
Similar to the plasma samples, long overlapping PCR frag-
Table 2. Analysis of relationships among the protein sequences of PARV4-like viruses*†
Sequence
PARV4-p
PHoV
BHoV
PARV4-g1
PARV4-p
NS
99–100
(99)
(80)
(68)
VP
99–100
(99)
(79)
(77)
SAT
100
PHoV
NS
97–98
98–99
(79)
(68)
VP
99
99
(79)
(77)
SAT
98–100
98–100
BHoV
NS
67–68
67
99
(70)
VP
66
66
NA
(78)
SAT
79
79
100
PARV4-g1
NS
53–55
53–54
56–57
96–99
VP
65
65
65
99
SAT
59
59
59
100
PARV4-g2
NS
54–55
53–54
56
96–97
VP
65
65
64–65
98
SAT
59
59
59
100
PARV4-g3
NS
54
53–54
56
96–97
VP
65
65
64
98
SAT
59
59
59
100
PARV4-g2
PARV4-g3
(68)
(78)
(68)
(77)
(68)
(77)
(68)
(77)
(70)
(78)
(70)
(78)
(99)
(99)
(98)
(98–99)
98–99
98–99
100
(98)
(98)
96–97
97–98
100
NA
NA
*PARV4, parvovirus type 4; PARV4-p, porcine PARV-4; PHoV, porcine hokovirus; BHoV, bovine hokovirus; PARV4-g1, PARV4 genotype 1; PARV4-g2,
PARV4 genotype 2; PARV4-g3, PARV4 genotype 3; NS, nonstructural protein; VP, viral protein; NA, no alignment; SAT, small alternatively translated
proteins.
†Numbers indicate percentages of amino acid sequence identity; numbers in parentheses indicate percentages of amino acid similarity (preserved
physicochemical properties). Sequence similarity was not calculated for the SAT proteins, because of their relatively smaller size. When only 1 sequence
was available (e.g., VP of BHoV), no alignment was performed.
562
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
PARV4-like Virus in Blood Products
ments were amplified from the FVIII preparations to obtain
nearly full-length sequences. Their analysis provided information about the evolution of PARV4-like viruses, during
nearly a decade, in pigs. Sequence data were registered by
GenBank (accession nos. Cl2001A: FJ982246; Cl2001B:
FJ982247; Cl2001C: FJ982248; F8–1994A: FJ982249;
F8–1994B: FJ982250; F8–1996A: FJ982251; F8–1996B:
FJ982252; F8–1999: FJ982253; F8–2000A: FJ982254; and
F8–2000B: FJ982255). Phylogenetic and molecular evolutionary analyses were conducted by using MEGA version
4 (12).
The genomes of these newly isolated PARV4-like
viruses were similar to the PHoVs previously identified
in Hong Kong Special Administrative Region, People’s
Republic of China. Although, these new isolates showed
some diversity (98%–99% identity), they differed somewhat more from the PHoVs (97%–98% identity). The viral
protein (VP)-ORF was highly conserved (99%), whereas
the NS-ORF showed more diversity (97%–98%). Genomic
and protein-coding sequences were also compared with
other PARV4-like viruses (Tables 1, 2). Phylogenic analysis using neighbor-joining and maximum parsimony methods demonstrated that PHoVs grouped together, whereas
PARV4-like sequences from FVIII prepared at different
times were less uniform (Figure 2). Older FVIII PARV4
contaminants (especially from 1994) were related more
closely to the bovine hokoviruses (BHoVs) and to PARV4g2. Finally, analysis of the newly identified virus genomes
Figure 2. Construction of phylogenic trees for newly identified porcine viruses and comparison with previously identified prototype parvovirus
4 (PARV4)–like sequences. Sequences of other PARV4-like viruses indicated by the accession numbers were obtained from GenBank,
and their origins are marked by letters (p, porcine; b, bovine; PARV4-g1, g2, g3, human parvovirus 4 genotypes 1, 2, and 3). ClustalWaligned genomes (A) and nonstructural (NS) protein (B) and viral protein (VP) (C) were all trimmed to obtain sequences with similar
lengths. All computer analysis was performed by using the neighbor-joining method. Branches corresponding to partitions reproduced
in <70% bootstrap replicates are collapsed. The tree is drawn to scale, and the percentage of replicate trees in which the associated
taxa clustered together in the bootstrap test (1,000 replicates) are shown below the branches. F8-year, year of the factor VIII lot; Cl-year,
plasma samples and year of collection. Scale bar represents the number of nucleotide (A) or amino acid (B, C) substitutions per site.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
563
DISPATCHES
showed an alternative coding sequence inside of the VP
gene with a recognizable relationship to small alternatively
translated proteins (SAT) (13). In the porcine PARV4-like
viruses, the start codon for the SAT protein was 3 nt downstream relative to the position of SAT-ATG in the human
and bovine PARV4 viruses. Although the SAT protein was
67 aa in all the characterized human PARV4 viruses, porcine and bovine PARV-like viruses contained SAT proteins
with 84 aa. The amino acid sequences of the SAT proteins
were highly conserved in each PARV4 virus group; however, they differed greatly between PARV4 viruses belonging to different host species (Table 2).
Conclusions
Improved virus detection methods have facilitated the
discovery of new viruses and have provided insight into the
existence of a wide variety of potentially pathogenic strains
in biopharmaceutical products. Plasma samples, collected
from individual pigs in 2001–2002, and FVIII samples,
prepared during 1994–2001, were tested for PARV4-like
viruses.
Sequence analysis showed that PARV4-like viruses
may have undergone some degree of selective pressure
during this time because the genomes sequenced showed a
greater variability than the porcine parvovirus NS sequences isolated from the same samples (J. Szelei and P. Tijssen, unpub. data). In the current study, comparison of the
genomic and NS protein coding sequences indicated that
viruses in the older samples were more closely related to
BHoV and PARV4-g2 (Figure 2). Fewer changes were observed in the VP coding sequence (Table 2). Because VPs
are responsible for the entry of parvoviruses, they usually
adapt to host-specific receptor(s). The presence of PARV4g2–like isolates in older samples and the omnipresence of
PARV4-like viruses in more recent samples suggested that
the porcine PARV4-like virus and human PARV4 may
have similarly evolved (8). These new parvovirus isolates
from Great Britain would belong to a different cluster of
porcine PARV4-like viruses than the hokoviruses from
Hong Kong Special Administrative Region.
Although older isolates shared more identity with
BHoV and PARV4-g2, the substantial differences in the
DNA sequences of PARV4-like viruses from different species (human, bovine, pig) suggested that they would have
diverged a long time ago. This hypothesis was also supported by the sequence stabilization of the SAT proteins,
which may play important host-specific roles in the viral
exit (13). Nevertheless, the existence of a wide variety of
different PARV4 strains, most of which result in chronic
infections, could provide a basis for an evolutionary jump
and recombination and should raise major concerns about
the dangers of parenteral transmission.
564
This research was supported by a grant to P.T. from the Natural Sciences and Engineering Council of Canada.
Dr Szelei is senior research associate at the Institut National
de la Recherche Scientifique–Institut Armand-Frappier. His work
focuses on the molecular biology of parvoviruses.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Jones MS, Kapoor A, Lukashov VV, Simmonds P, Hecht F, Delwart
E. New DNA viruses identified in patients with acute viral infection
syndrome. J Virol. 2005;79:8230–6.DOI: 10.1128/JVI.79.13.82308236.2005
Fryer JF, Delwart E, Bernardin F, Tuke PW, Lukashov VV, Baylis
SA. Analysis of two human parvovirus PARV4 genotypes identified
in human plasma for fractionation. J Gen Virol. 2007;88:2162–7.
DOI: 10.1099/vir.0.82620-0
Longhi E, Bestetti G, Acquaviva V, Foschi A, Piolini R, Meroni L, et al. Human parvovirus 4 in the bone marrow of Italian patients with AIDS. AIDS. 2007;21:1481–3.DOI: 10.1097/
QAD.0b013e3281e38558
Sharp CP, Lail A, Donfield S, Simmons R, Leen C, Klenerman P,
et al. High frequencies of exposure to the novel human parvovirus
PARV4 in hemophiliacs and injection drug users, as detected by a serological assay for PARV4 antibodies. J Infect Dis. 2009;200:1119–
25.DOI: 10.1086/605646
Simmonds P, Manning A, Kenneil R, Carnie FW, Bell JE. Parenteral
transmission of the novel human parvovirus PARV4. Emerg Infect
Dis. 2007;13:1386–8.
Schneider B, Fryer JF, Oldenburg J, Brackmann HH, Baylis SA, EisHübinger AM. Frequency of contamination of coagulation factor
concentrates with novel human parvovirus PARV4. Haemophilia.
2008;14:978–86.DOI: 10.1111/j.1365-2516.2008.01800.x
Kleinman SH, Glynn SA, Lee TH, Tobler LH, Schlumpf KS,
Todd DS, et al. A linked donor-recipient study to evaluate parvovirus B19 transmission by blood component transfusion. Blood.
2009;114:3677–83.DOI: 10.1182/blood-2009-06-225706
Manning A, Willey SJ, Bell JE, Simmonds P. Comparison of tissue
distribution, persistence, and molecular epidemiology of parvovirus
B19 and novel human parvoviruses PARV4 and human bocavirus. J
Infect Dis. 2007;195:1345–52. Medline DOI: 10.1086/513280
Simmonds P, Douglas J, Bestetti G, Longhi E, Antinori S, Parravicini C, et al. A third genotype of the human parvovirus PARV4 in
sub-Saharan Africa. J Gen Virol. 2008;89:2299–302.DOI: 10.1099/
vir.0.2008/001180-0
Lau SK, Woo PC, Tse H, Fu CT, Au WK, Chen XC, et al. Identification of novel porcine and bovine parvoviruses closely related to
human parvovirus 4. J Gen Virol. 2008;89:1840–8.DOI: 10.1099/
vir.0.2008/000380-0
Zádori Z, Szelei J, Lacoste MC, Li Y, Gariépy S, Raymond P, et al.
A viral phospholipase A2 is required for parvovirus infectivity. Dev
Cell. 2001;1:291–302.DOI: 10.1016/S1534-5807(01)00031-4
Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol
Evol. 2007;24:1596–9.DOI: 10.1093/molbev/msm092
Zádori Z, Szelei J, Tijssen P. SAT: a late NS protein of porcine parvovirus. J Virol. 2005;79:13129–38. DOI: 10.1128/JVI.79.20.1312913138.2005
Address for correspondence: Peter Tijssen, Institut National de la
Recherche Scientifique–Institut Armand-Frappier, Université du Québec,
531 Blvd des Prairies, Laval, Québec H7V 1B7, Canada; email: peter.
[email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
LETTERS
Rhabdomyolysis
and Pandemic
(H1N1) 2009
Pneumonia in Adult
To the Editor: A 56-year-old
man came to the emergency department (ED) of Malcolm Grow Medical
Center at Andrews Air Force Base in
suburban Maryland, USA, just outside
Washington, DC. He had a history
of several days of cough, fever, and
malaise; was a nonsmoker; was overweight (body mass index 28 kg/m2);
and did not have chronic pulmonary
disease. Radiographs showed bilateral
pulmonary infiltrates, and he was hypoxemic. Two weeks previously, the
patient had begun receiving therapy
for recurrent multiple myeloma (lenalidomide and high-dose dexamethasone). He was intubated at the time
of initial visit to the ED for influenza
symptoms, and broad-spectrum antimicrobial drugs were administered
(vancomycin 1,000 mg every 12 h,
piperacillin-tazobactam 4.5 gm every
6 h, and levofloxacin 750 mg 1×/d).
Initial nasopharyngeal wash was negative for influenza A and B antigen by
enzyme immunoassay; serum creatine
kinase was 271 U/L (reference range
38–174 U/L).
After oxygenation worsened,
bronchoalveolar lavage was performed, and drug therapy was
broadened to include voriconazole,
trimethoprim-sulfamethoxazole, and
prednisone. Bronchoalveolar lavage
viral culture was positive for influenza
A, and real-time reverse transcription–
PCR confirmed pandemic (H1N1)
2009 virus infection. Therapy with
oseltamivir (75 mg every 12 h) was
initiated, and the patient’s respiratory
status gradually improved. On hospital day 14, total creatine kinase levels
were elevated at 4,854 U/L and rose
to 76,015 U/L over the next 4 days
before decreasing. Urine myoglobin
peaked at 286,000 μg/L (reference
range 0–28 μg/L). Renal function re-
mained at baseline until the patient
was discharged 2 weeks later; measured glomerular filtration rates were
>120 mL/min. Hydration with normal
saline and supportive care was provided; the patient was extubated and
discharged to a rehabilitation hospital
on hospital day 19. No medications or
other treatments could be implicated
as the cause of rhabdomyolysis in this
patient.
More commonly reported in children, myositis associated with influenza A and B has been well documented
and appears to occur most often during
the convalescent phase of illness (1).
Influenza-associated rhabdomyolysis
with myoglobinuria have been shown
to complicate 3% of cases of myositis
in children, are more likely to be associated with influenza A infection (1),
and have been associated with renal
insufficiency requiring renal replacement therapy (1,2). The frequency of
myositis or rhabdomyolysis among
adults with pandemic (H1N1) 2009
infection is unclear, but a recently
published case series of 18 severely ill
patients in Mexico showed that mild
to moderate creatine kinase elevation
(1,000–5,000 U/L) occurred in >60%
of tested patients (3). A report from
Australia documented rhabdomyolysis as a complication of pandemic
(H1N1) 2009 infection in a 16-yearold-boy (4), and, more recently, a case
of rhabdomyolysis was reported in a
28-year-old patient (5).
Our case demonstrates rhabdomyolysis with myoglobinuria that
arose during convalescence from severe pandemic (H1N1) 2009 pneumonia in an immunocompromised adult.
It is yet to be determined whether
pandemic (H1N1) 2009 virus infection has a higher propensity toward
muscular inflammation than do other
viral infections or seasonal influenza.
Rhabdomyolysis should be considered
in the evaluation of muscle symptoms
associated with pandemic (H1N1)
2009 virus infection, especially
among critically ill patients. When
influenza suspicion is high, obtaining
bronchoalveolar lavage specimens for
viral culture, PCR, and antigen testing
should be considered if nasopharyngeal sampling and testing for influenza
antigen and viral culture are initially
negative.
Ramiro L. Gutierrez,
Michael W. Ellis,
and Catherine F. Decker
Author affiliations: National Naval Medical
Center, Bethesda, Maryland, USA (R.L.
Gutierrez, C.F. Decker); and Uniformed
Services University of the Health Sciences,
Bethesda (M.W. Ellis, C.F. Decker)
DOI: 10.3201/eid1603.091818
References
1.
2.
3.
4.
5.
Agyeman P, Duppenthaler A, Heininger
U, Aebi C. Influenza associated myositis
in children. Infection. 2004;32:199–03.
DOI: 10.1007/s15010-004-4003-2
Morgensen JL. Myoglobinuria and renal
failure associated with influenza. Ann Intern Med. 1974;80:362–3.
Perez-Padilla R, de la Rosa-Zamboni D,
Ponce de Leon S, Hernandez M, Quiñones-Falconi F, Bautista E, et al.; INER
Working Group on Influenza. Pneumonia
and respiratory failure from swine-origin
influenza A (H1N1) in Mexico. N Engl
J Med. 2009;361:680–9. DOI: 10.1056/
NEJMoa0904252
D’Silva D, Hewagama S, Doherty R,
Korman TM, Buttery J. Melting muscles: novel H1N1 influenza A associated rhabdomyolysis. Pediatr Infect Dis J.
2009;28:1138–9. Medline DOI: 10.1097/
INF.0b013e3181c03cf2
Ayala E, Kagawa FT, Whener JH, Tam
J. Rhabdomyolysis associated with
2009 influenza A (H1N1). JAMA.
2009;302:1863–4.
DOI:
10.1001/
jama.2009.1582
Address for correspondence: Ramiro L.
Gutierrez, Infectious Diseases Clinic, National
Naval Medical Center, 8901 Wisconsin Ave,
Bethesda, MD 20889-5600, USA; email:
[email protected]
The opinions expressed by authors
contributing to this journal do not
necessarily reflect the opinions of
the Centers for Disease Control and
Prevention or the institutions with
which the authors are affiliated.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
565
LETTERS
Yersinia
pseudotuberculosis
and Y. enterocolitica
Infections,
FoodNet, 1996–2007
To the Editor: Yersinia pseudotuberculosis, a gram-negative zoonotic
bacterial pathogen, causes acute gastroenteritis and mesenteric lymphadenitis, which are often accompanied
by fever and abdominal pain. Although
Y. pseudotuberculosis infections are
distributed worldwide, little is known
about their incidence and epidemiology
in the United States. Y. pseudotuberculosis was first reported in the United
States in 1938 and has rarely been
identified since then (1). No outbreaks
have been reported, and only 14 cases
were documented from 1938 through
1973 (2). Although not reportable nationally, yersiniosis is a notifiable disease in all Foodborne Diseases Active
Surveillance Network (FoodNet) sites.
We describe the Y. pseudotuberculosis
infections reported through FoodNet
surveillance sites and compare these infections with those caused by the more
commonly identified Yersinia species,
Y. enterocolitica.
During 1996–2007, FoodNet
conducted active surveillance for
laboratory-confirmed Yersinia spp.
infections (excluding Y. pestis) in
Connecticut, Georgia, Maryland,
Minnesota, New Mexico, Oregon,
Tennessee, and selected counties in
California, Colorado, and New York.
All clinical laboratories in these areas
were routinely contacted to ascertain
cases. Demographic and outcome
(e.g., hospitalization and death) information was collected for all cases.
On the basis of the source of specimen
collection, infections were categorized
as invasive (isolated from cerebrospinal fluid, blood, or another normally
sterile site) or noninvasive (isolated
from urine, stool, or other site). Data
were analyzed by using SAS version
9.2 (SAS Institute, Cary, NC, USA).
Differences were evaluated by using
χ2 and Fisher exact tests, and medians
were compared by using the Wilcoxon
rank-sum test. A 2-tailed p value of
<0.05 was considered significant.
During 1996–2007, 1,903 Yersinia infections were reported in FoodNet
sites. Of these, 1,471 (77%) had species information available. Most of the
isolates were Y. enterocolitica (1,355;
92%); 18 (1%) Y. pseudotuberculosis
infections were identified. The average
annual incidence of Y. pseudotuberculosis infections was 0.04 cases per
1,000,000 persons. Most Y. pseudotuberculosis cases were reported from
the western FoodNet areas of California (5 cases) and Oregon (5 cases).
The median age of persons with
Y. pseudotuberculosis infection was 47
years (range 16–86 years), and 67%
were male (Table). Of the 13 Y. pseudotuberculosis cases for which race was
reported, 10 (77%) were in whites.
Eight (44%) Y. pseudotuberculosis
cases occurred in the winter months
(December–February). Thirteen (72%)
persons with Y. pseudotuberculosis
infection required hospitalization; the
median hospital stay was 9 days (range
2–35 days). Two deaths were reported,
yielding a case-fatality rate of 11%.
Twelve (67%) of the Y. pseudotuberculosis isolates were recovered from
blood specimens, and only 1 isolate
was recovered from stool.
In comparison, the average annual incidence of Y. enterocolitica infections in FoodNet was 3.5 cases per
1,000,000 persons, and many of the
cases occurred in the southern FoodNet site of Georgia (443 cases, 33%)
(Table). Persons with Y. enterocolitica
infection were significantly younger
than those with Y. pseudotuberculosis infection (median age 6 years, p
= 0.0002), and unlike Y. pseudotuberculosis infections, Y. enterocolitica
infections were evenly distributed
among male and female patients and
among whites and blacks. Compared
with those with Y. enterocolitica infection, persons with Y. pseudotuberculosis infection were more likely to be
hospitalized (p = 0.0003), have longer
hospital stays (p = 0.0118), die (p =
0.0248), and have an isolate recovered
from an invasive site (p<0.0001).
Most of the Y. pseudotuberculosis
infections reported in FoodNet sites appeared to be severe and invasive. The
rarity of diagnosed Y. pseudotuberculosis infections is consistent with earlier
reports from North America (3,4), but
Table. Comparison of Yersinia pseudotuberculosis and Y. enterocolitica infections, FoodNet, 1996–2007*
Characteristic
Y. enterocolitica
Y. pseudotuberculosis
No. infections
18
1,355
Annual average incidence† (range)
0.04 (0.00–0.10)
3.45 (0.77–7.87)
Median patient age, y (range)
47 (16–86)
6 (0–94)
Male sex, no. (%) patients
12 (67)
672 (50)
White race, no. (%) patients
10 (56)
480 (35)
Western region of USA (CA, OR), no. (%)
10 (56)
308 (22)
Winter season, no. (%)
8 (44)
536 (40)
Invasive specimen collection site, no. (%)
12 (67)
106 (8)
Hospitalized, no. (%) patients
13 (72)
411 (30)
Median hospitalization, d (range)
9 (2–35)
4 (0–107)
Died, no. (%) patients
2 (11)
15 (1)
*CA, California; OR, Oregon.
†Cases per 1,000,000 persons.
566
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
p value
<0.0001
0.1638
0.0115
0.0024
0.8091
<0.0001
0.0003
0.0118
0.0248
LETTERS
this rarity remains unexplained. This
rarity contrasts with the observation
that cases and outbreaks are more common in other parts of the developed
world, particularly in northern climes
(1,5,6–8). The recent appearance of epizootic Y. pseudotuberculosis in farmed
deer in the southern United States suggests that this could change (9).
The high proportion of Y. pseudotuberculosis cases that were diagnosed by blood culture suggests that
less invasive Y. pseudotuberculosis
infections are underrecognized in the
United States. Diagnosis of Yersinia
infections is difficult without specific
culture, Yersinia is not routinely tested
for in the United States, and isolation
of the organism by culture may be
difficult with standard media (2,10).
Clinical diagnosis of Y. pseudotuberculosis infections can be challenging
because physicians are not aware that
Y. pseudotuberculosis is a potential
cause of gastroenteritis (10). In the
syndrome of pseudoappendicitis, the
distinctive findings found by surgical exploration of severe mesenteric
lymphadenitis can be suggestive, but
diagnosis would require confirmation
by culture of nodes or feces (2,3).
Unless the physician is both aware
of Y. pseudotuberculosis as a cause of
gastroenteritis and knows which diagnostic test to order, Y. pseudotuberculosis infections will go undiagnosed.
Clinicians should consider Y. pseudotuberculosis as a cause of gastroenteritis and pseudoappendicitis and request
appropriate microbiologic testing
for patients with suspected cases. If
more cases are identified in the United States, another investigation of Y.
pseudotuberculosis might clarify the
epidemiology of this infection.
Cherie Long, Timothy F. Jones,
Duc J. Vugia, Joni Scheftel,
Nancy Strockbine,
Patricia Ryan,
Beletshachew Shiferaw,
Robert V. Tauxe,
and L. Hannah Gould
Author affiliations: Georgia Department of
Human Resources, Atlanta, Georgia, USA
(C. Long); Atlanta Research and Education Foundation, Atlanta (C. Long); Tennessee Department of Health, Nashville,
Tennessee, USA (T.F. Jones); California
Department of Public Health, Richmond,
California, USA (D.J. Vugia); Minnesota
Department of Health, St. Paul, Minnesota, USA (J. Scheftel); Centers for Disease
Control and Prevention, Atlanta (N. Strockbine, R.V. Tauxe, L.H. Gould); Maryland
Department of Health and Mental Hygiene,
Baltimore, Maryland, USA (P. Ryan); and
Oregon Department of Human Services,
Portland, Oregon, USA (B. Shiferaw)
9.
10.
Zhang S, Zhang Z, Liu S, Bingham W,
Wilson F. Fatal yersiniosis in farmed deer
caused by Yersinia pseudotuberculosis
serotype O:3 encoding a mannosyltransferase-like protein WbyK. J Vet Diagn
Invest. 2008;20:356–9.
Knapp W. Mesenteric adenitis due to
Pasteurella pseudotuberculosis in young
people. N Engl J Med. 1958;259:776–8.
Address for correspondence: L. Hannah Gould,
Centers for Disease Control and Prevention,
1600 Clifton Rd NE, Mailstop F22, Atlanta, GA
30333, USA; email: [email protected]
DOI: 10.3201/eid1603.091106
References
1.
2.
3.
4.
5.
6.
7.
8.
Hnatko SI, Rodin AE. Pasteurella pseudotuberculosis infection in man. Can Med
Assoc J. 1963;88:1108–12.
Paff JR, Triplett DA, Saari TN. Clinical
and laboratory aspects of Yersinia pseudotuberculosis infections, with a report of two
cases. Am J Clin Pathol. 1976;66:101–10.
Hubbert WT, Petenyi CW, Glasgow
LA, Uyeda CT, Creighton SA. Yersinia
pseudotuberculosis infection in the United
States. Septicema, appendicitis, and mesenteric lymphadenitis. Am J Trop Med
Hyg. 1971;20:679–84.
Toma S. Human and nonhuman infections
caused by Yersinia pseudotuberculosis in
Canada from 1962 to 1985. J Clin Microbiol. 1986;24:465–6.
Nuorti JP, Niskanen T, Hallanvuo S, Mikkola J, Kela E, Hatakka M, et al. A widespread outbreak of Yersinia pseudotuberculosis O:3 infection from iceberg lettuce.
J Infect Dis. 2004;189:766–74. DOI:
10.1086/381766
Jalava K, Hallanvuo S, Nakari UM,
Ruutu P, Kela E, Heinasmaki T, et al.
Multiple outbreaks of Yersinia pseudotuberculosis infections in Finland. J Clin Microbiol. 2004;42:2789–91. DOI: 10.1128/
JCM.42.6.2789-2791.2004
Vincent P, Leclercq A, Martin L, Duez
JM, Simonet M, Carniel E. Sudden onset
of pseudotuberculosis in humans, France,
2004–05. Emerg Infect Dis. 2008;14:1119–
22. DOI: 10.3201/eid1407.071339
Tertti R, Granfors K, Lehtonen OP, Mertsola J, Makela AL, Valimaki I, et al. An
outbreak of Yersinia pseudotuberculosis
infection. J Infect Dis. 1984;149:245–50.
Measles Outbreak,
the Netherlands,
2008
To the Editor: From June 1
through October 16, 2008, an outbreak
of 99 reported measles cases occurred
in the Netherlands (1). This outbreak
was the largest measles outbreak in the
Netherlands since 1999–2000, when
>3,200 cases, including 3 deaths, were
reported (2).
In the Netherlands, clinical symptoms compatible with measles in a person with laboratory-confirmed measles
virus infection or an epidemiologic
link to a laboratory-confirmed case
are notifiable (i.e., must be reported
to public health authorities). The National Measles Reference Laboratory
conducts genotyping and submits sequences to the World Health Organization European Region Measles Nucleotide Surveillance database (www.
hpa-bioinformatics.org.uk/Measles/
Public/Web_Front/main.php).
Of the 99 measles cases reported
in the 2008 outbreak, 40 were laboratory confirmed and 59 were notified
based on an epidemiologic link. The
first case-patient in the outbreak was
a 6-year-old unvaccinated resident of
The Hague who had not been abroad
in the month before onset of illness.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
567
LETTERS
The source of her infection was unknown. She attended a school based
on anthroposophic principles; the
school had an estimated measlesmumps-rubella (MMR) vaccination
coverage of 80% (M. Monné-van Wirdum, pers. comm.). Subsequently, 52
additional cases were reported from
this and from another anthroposophic
school in The Hague (cluster 1; online Appendix Figure, www.cdc.gov/
EID/content/16/3/567-appF.htm).
Two months after the first case, 22
additional cases were reported associated with an anthroposophic summer
camp in the east of the Netherlands
(cluster 2; online Appendix Figure).
Five additional cases had an epidemiologic link with an anthroposophic
summer camp in France (cluster 3, 2
cases; online Appendix Figure) and
Switzerland (cluster 4, 3 cases; online
Appendix Figure). No known measles
patients in Switzerland were linked to
this cluster (J. Richard, pers. comm.).
Subsequently, 12 cases were reported
that were associated with 2 daycare
centers in the city of Utrecht (cluster
5 and 6), both linked to an anthroposophic community. From all 6 clusters
and from 2 of the 7 cases with an unknown source, indistinguishable measles viruses (genotype D8, 22 cases)
were identified. Given the low prevalence of this strain in Europe (J. Kremer, pers. comm.), we concluded that
virus transmission occurred between
all 6 clusters. The first cluster was not
epidemiologically linked to any of the
recent outbreaks in anthroposophic
groups in Europe (3).
No case had an epidemiologic
link to more than 1 cluster, suggesting
the 6 cases introducing measles into
these clusters were unreported. When
the 7 cases with an unknown source
were considered, this finding suggests
that at least 13 cases were not reported
(maximum reporting completeness
88%). However, transmission through
patients with subclinical cases may
also have played a role (4).
568
There were no deaths. Four casepatients (4%) were admitted to hospitals. The median age was 9 years
(range 8 months–48 years). Of the
98 case-patients with information
on vaccination status, 91 (93%) had
been unvaccinated, 6 (6%) had had 1
dose, none (0%) had had 2 doses, and
1 (1%) had had 3 doses before onset
of illness. One of the 6 case-patients,
vaccinated only once, had received
her MMR vaccine only 11 days before
the date of onset of illness and is hence
not considered a vaccine failure. Of all
99 case-patients, 91% had been eligible for >1 MMR vaccination according to the vaccination schedule in the
Netherlands. Of these cases, available
information for 84 case-patients indicated 48% (40 persons) were reported
to be unvaccinated because of their
anthroposophic beliefs, 49% (41 persons) because of a critical attitude towards vaccination, and 4% (3 persons)
for other reasons.
Outbreak control plans in the
Netherlands focus on protecting the
population by adjusting the vaccination schedule during a nationwide
outbreak (5). Studies are ongoing into
knowledge and attitudes toward vaccination in communities with low vaccination coverage, aiming to identify
opportunities to improve coverage.
The outbreak remained largely
restricted to persons with philosophical objections to MMR vaccination,
which suggests that there are sufficient
levels of herd immunity in the general
population. Remarkably, no cases
were reported from the Dutch Orthodox Reformed Church community, despite the low vaccine coverage in this
group. This finding suggests that orthodox reformed and anthroposophic
population subgroups have little direct
contact, consistent with previous observations (6).
Measles vaccination was introduced in the Netherlands in 1976. The
single-dose regimen was in 1987 replaced by a 2-dose regimen of MMR
vaccine; the first dose at 14 months
and the second at 9 years. The vaccination coverage for >1 MMR dose
has been >95% from birth cohort 1986
onward (7). During 2002–2007, the
incidence of measles notifications in
the Netherlands was below the World
Health Organization regional threshold for elimination (1/1 million population/year) (8). Nevertheless, this
outbreak demonstrates the continued
risk for measles transmission in the
Netherlands. This suggests that indicators based merely on incidence and
national vaccination coverage are of
limited usefulness for certification of
measles elimination. Data on measles
seroprevalence and mixing patterns
that will soon be available from the
second national seroprevalence study
will provide more insight into the dynamics of measles transmission in a
population with pockets of low vaccination coverage. These data will also
help assess progress toward measles
elimination from the Netherlands.
Acknowledgments
We thank the staff of Municipal
Health Authorities and Microbiological
Laboratories and Leslie Isken for their
support in obtaining information on the
cases reported.
Susan Hahné,
Margreet J.M. te Wierik,
Liesbeth Mollema,
Eva van Velzen,
Eric de Coster, Corien Swaan,
Hester de Melker,
and Robert van Binnendijk
Author affiliations: National Institute for
Public Health and the Environment (RIVM),
Bilthoven, the Netherlands (S. Hahné, L.
Mollema, C. Swaan, H. de Melker, R. van
Binnendijk); Municipal Health Service, The
Hague, the Netherlands (E. van Velzen, E.
de Coster ); and Municipal Health Service,
Utrecht, the Netherlands (M.J.M. te Wierik)
DOI: 10.3201/eid1603.090114
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
LETTERS
References
1.
2.
3.
4.
5.
6.
7.
8.
van Velzen E, de Coster E, van Binnendijk
R, Hahné S. Measles outbreak in an anthroposophic community in The Hague,
the Netherlands, June–July 2008. Euro
Surveill. 2008;13(31):18945.
van den Hof S, Meffre CM, Conyn-van
Spaendonck MA, Woonink F, de Melker
HE, van Binnendijk RS. Measles outbreak
in a community with very low vaccine
coverage, the Netherlands. Emerg Infect
Dis. 2001;7(Suppl):593–7. DOI: 10.3201/
eid0703.010343
Schmid D, Holzmann H, Abele S, Kasper
S, Konig S, Meusburger S et al. An ongoing multi-state outbreak of measles linked
to non-immune anthroposophic communities in Austria, Germany, and Norway, March–April 2008. Euro Surveill.
2008;13:18838.
Glass K, Grenfell BT. Waning immunity and subclinical measles infections in
England. Vaccine. 2004;22:4110–6. DOI:
10.1016/j.vaccine.2004.02.047
van den Hof S, Wallinga J, Widdowson
MA, Conyn-van Spaendonck MA. Protecting the vaccinating population in the
face of a measles epidemic: assessing the
impact of adjusted vaccination schedules.
Epidemiol Infect. 2002;128:47–57. DOI:
10.1017/S0950268801006409
Hahné S, Macey J, van Binnendijk R,
Kohl R, Dolman S, van der Veen Y, et
al. Rubella outbreak in the Netherlands,
2004–2005: high burden of congenital
infection and spread to Canada. Pediatr
Infect Dis J. 2009;28:795–800.
van Lier EA, van Oomen PJ, Oostenbrug MW, Zwakhals SL, Drijfhout IH, de
Hoogh PA, et al. Immunization coverage
National Immunization Programme in the
Netherlands, year of report 2006–2008 [in
Dutch]. RIVM report 2008;210021007
[cited 2009 June 8]. http://www.rivm.nl/
bibliotheek/rapporten/210021007.html
World Health Organization EURO. Eliminating measles and rubella and preventing
congenital rubella infection: WHO European Region strategic plan 2005–2010.
2005 [cited 2009 Jun 8]. http://www.euro.
who.int/Document/E87772.pdf
Address for correspondence: Susan Hahné,
RIVM, Centre for Infectious Disease Control,
PO Box 1, 3720 BA Bilthoven, the Netherlands;
email: [email protected]
All material published in Emerging
Infectious Diseases is in the public
domain and may be used and
reprinted without special permission;
proper citation, however, is required.
Neurologic
Manifestations of
Pandemic (H1N1)
2009 Virus
Infection
To the Editor: In April 2009,
the outbreak of influenza A pandemic
(H1N1) 2009 virus was reported. Subsequently, the disease spread throughout the world, and the pandemic alert
level was raised to level 6 in June by
the World Health Organization. Pandemic (H1N1) 2009 virus infection
spread to Thailand and is now found
throughout Thailand. Similar to the
effects of other viruses, pandemic
(H1N1) 2009 virus may cause neurologic complications. Associated neurologic symptoms were first reported
from Dallas, Texas, USA: 4 children
experienced unexplained seizures or
had an alteration of consciousness
level that was associated with this virus (1). We report an adult patient with
pandemic (H1N1) 2009 infection who
had neurologic complications.
A 34-year-old man, previously
healthy, was admitted to Chaiyaphum
Hospital in Chaiyaphum, Thailand, on
August 24, 2009, with influenza-like
symptoms. Two days after admission,
progressive quadriparesis with bilateral, symmetric paresthesia (glove-andstocking pattern), and areflexia developed. His motor weakness (grades
III/V) began in both legs and then
involved both arms and hands. Other
neurologic examinations showed limitation of extraocular movement in all
directions, normal pupil size and light
reflex, and facial diplegia. A lumbar
puncture was performed, and cerebrospinal fluid (CSF) contained neither
leukocytes nor erythrocytes, with a
protein level of 19.5 mg/dL.
On day 3 after the patient’s admission, acute respiratory failure developed. A nasopharyngeal aspirate
specimen was positive for pandemic
(H1N1) 2009 virus by PCR. The patient received oseltamivir, zanamivir,
and ventilator support. His chest radiograph showed diffuse alveolar infiltration. On day 10, his motor weakness worsened to grade 0, and his
consciousness level was diminished to
a drowsy state.
A computed tomography scan of
the brain showed diffuse white matter lesions (Figure). Repeated lumbar
punctures continued to show CSF
findings within the reference range.
An electrophysiologic study, electromyogram, and nerve conduction study
showed polyneuropathy, axonopathy
type. Guillain-Barré syndrome was
suspected, and intravenous immunoglobulin was given for 5 days. Tests
for GQ1b and GM1 antibodies were
carried out at Oxford University; results were negative.
Other laboratory tests showed
mild transaminitis and negative results
for syphilis testing and for serologic
tests for HIV, hepatitis B virus, hepatitis C virus, Japanese encephalitis
virus, herpes simplex virus, and Mycoplasma pneumoniae. A CSF antigen
test was negative, and CSF culture
was negative for bacteria. Meropenem
was given to treat ventilator-associated pneumonia, which was caused by
β-lactam–resistant Klebsiella pneumoniae. After a month of treatment,
the patient regained consciousness,
his motor strength improved considerably, and he was able to be gradually
removed from the ventilator. After 3
months, he was discharged with selfassisted status.
Our report shows neurologic
manifestations associated with pandemic (H1N1) 2009 virus infection in
an adult. The manifestation of progressive quadriplegia with diffuse sensory
loss is compatible with a polyneuropathy. The neurologic signs developed 2
days after the respiratory tract signs.
Although a diagnosis of Guillain-Barré syndrome was considered
initially, according to the National
Institute of Neurologic Disorders and
Stroke criteria (2), some clinical features did not support this diagnosis.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
569
LETTERS
Rickettsia felis,
West Indies
Figure. Computed tomography images of the brain of an adult patient with pandemic
(H1N1) 2009 virus infection and neurologic signs. A noncontrast study showed hypodense
lesions in both occipital lobes (A) and in both upper parietal lobes (B).
These included the lack of CSF albuminocytologic dissociation, the fact
that the clinical signs occurred during the outbreak of pandemic (H1N1)
2009 virus infection rather than after
it, and the fact that antibodies were
not found in gangliosides. CSF albuminocytologic dissociation and serum
ganglioside antibodies may be found
in 85%–90% of Guillain-Barré syndrome patients (2).
Alternatively, the patient might
have had central nervous system complication from pandemic (H1N1) 2009
virus infection. Acute disseminated
encephalomyelitis is a condition that
might occur within 30 days after an
infectious process (3). It can lead to
quadriplegia and diffuse white matter
lesions. The clinical feature that makes
acute disseminated encephalomyelitis less likely in this patient was the
CSF findings in the reference range.
In summary, however, we believe that
pandemic (H1N1) 2009 virus infection
can cause neurologic complications affecting both the peripheral and central
nervous systems in adult patients.
This work was supported by the Office of the Higher Education Commission
and Khon Kaen University, Thailand.
570
Sarawut Kitcharoen,
Moragot Pattapongsin,
Kittisak Sawanyawisuth,
Vincent Angela,
and Somsak Tiamkao
Authos affiliations: Khon Kaen University,
Khon Kaen, Thailand (S. Kitcharoen, K.
Sawanyawisuth, S. Tiamkao); Chaiyaphum
Hospital, Chaiyaphum, Thailand (M. Pattapongsin); and University of Oxford, Oxford,
UK (V. Angela)
DOI: 10.3201/eid1603.091699
References
1.
Centers for Disease Control and Prevention. Neurologic complications associated
with novel influenza A (H1N1) virus infection in children—Dallas, Texas, May
2009. MMWR Morb Mortal Wkly Rep.
2009;58:773–8.
2. National Institute of Neurological and
Communicative Disorders and Stroke
ad hoc Committee. Criteria for diagnosis of Guillain-Barré syndrome. Ann
Neurol. 1978;3:565–6.DOI: 10.1002/
ana.410030628
3. Sonneville R, Klein I, de Broucker T,
Wolff M. Post-infectious encephalitis
in adults: diagnosis and management. J
Infect. 2009;58:321–8.DOI: 10.1016/j.
jinf.2009.02.011
Address for correspondence: Somsak Tiamkao,
Department of Medicine, Faculty of Medicine,
Khon Kaen University, 123 Mitraparp Rd, Khon
Kaen, 40002, Thailand; email: [email protected]
ac.th
To the Editor: A spay–neuter
(sterilization) program for feral cats
from Basseterre, the capital of the
Caribbean Island St. Kitts, found that
most (45/58; 66%) cats had antibodies to spotted fever group rickettsiae
(SFGR). The antibodies were detected
with Rickettsia rickettsii antigen in a
standard microimmunofluorescence
assay (1). Titers for 13 (20%) cats
were >320.
Most SFGR are transmitted by
ticks, but because of their grooming
habits, cats seldom have many ticks
(2), and we did not find any ticks on the
cats we saw through the program. We
did, however, commonly find cat fleas,
Ctenocephalides felis, which are the
main vector of R. felis, a recently described member of the SFGR. R. felis
seems to be apathogenic in cats (3) but
is the agent of flea-borne spotted fever
in humans (4). Although R. felis has
been reported from North and South
America, Europe, Africa, the MiddleEast, and Oceania (4), its presence in
the Caribbean islands has not been
established. To provide this information we tested DNA extracted with the
QIAamp DNA Mini-Kit (QIAGEN,
Valencia, CA, USA) from C. felis fleas
preserved in 70% ethanol.
Of 57 (19%) C. felis fleas from
St. Kitts, 11 were positive for R. felis
DNA when tested by PCR using primers targeting SFGR ompA (5) or TaqMan assay using primers targeting gltA
and a probe specific for the organism
(6,7). For a negative control we used
distilled water; for a positive control
we used DNA from R. montanensis
cultures or recombinant control plasmids constructed by amplifying target
fragments from R. typhi strain Wilmington and R. felis strain LSU (7). The
sequences of the ompA and gltA amplicons obtained had 100% nucleotide
sequence similarity with homologous
fragments of the type reference isolate
R. felis URRxCal2. We used the Na-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
LETTERS
tional Center for Biotechnology Information basic local alignment sequence
tool, BLAST (www.ncbi.nlm.nih.gov/
blast/Blast.cgi).
To determine whether R. felis occurs on another Caribbean island, we
tested 32 C. felis fleas from Dominica
and found 1 (3%) to be positive by PCR
when primers targeting ompA were
used. The sequence obtained was also
identical to that of R. felis URRxCal2.
Our study provides further evidence that cats can be sentinels for the
presence of rickettsiae (1). However,
although rickettsemia can develop
in cats experimentally infected with
R. felis (3), no compelling evidence
shows that cats help maintain the organism or transmit it to humans (8,9).
Rather, it appears that C. felis fleas,
which are also commonly found on
dogs and to a lesser extent other mammals, are the major reservoir hosts
and vectors of infection, although the
exact mechanisms are unknown (10).
Our study also expands the known
distribution of R. felis and should alert
healthcare workers who see residents
of or vacationers from the Caribbean
islands of the possibility of flea-borne
spotted fever in their patients.
DOI: 10.3201/eid1603.091431
References
1.
2.
3.
4.
5.
6.
7.
Patrick J. Kelly, Helene Lucas,
Marina E. Eremeeva,
Kathryn G. Dirks,
Jean Marc Rolain,
Charles Yowell,
Reginald Thomas,
Trevrone Douglas,
Gregory A. Dasch,
and Didier Raoult
8.
Author affiliations: Ross University School
of Veterinary Medicine, St. Kitts, West Indies (P.J. Kelly, H. Lucas); Centers for
Disease Control and Prevention, Atlanta,
Georgia, USA (M.E. Eremeeva, K.G. Dirks,
G.A. Dasch); Unité de Recherche sur les
Maladies Infectieuses et Tropicales Emergentes, Marseille, France (J.M. Rolain, D.
Raoult); University of Florida, Gainesville,
Florida, USA (C. Yowell); and Division of
Agriculture, Roseau, Dominica, West Indies
(R. Thomas, T. Douglas)
10.
9.
Matthewman L, Kelly P, Hayter D, Downie S, Wray K, Bryson N, et al. Domestic
cats as indicators of the presence of spotted fever and typhus group rickettsiae.
Eur J Epidemiol. 1997;13:109–11. DOI:
10.1023/A:1007375718204
Garris GI. Control of ticks. Vet Clin
North Am Small Anim Pract.Review.
1991;21:173–83.
Wedincamp J Jr, Foil LD. Infection and
seroconversion of cats exposed to cat
fleas (Ctenocephalides felis Bouche) infected with Rickettsia felis. J Vector Ecol.
2000;25:123–6.
Pérez-Osorio CE, Zavala-Velázquez JE,
Zavala-Velázquez JE. Rickettsia felis
as emergent global threat for humans.
Emerg Infect Dis. 2008;14:1019–23
10.3201/eid1407.071656. DOI: 10.3201/
eid1407.071656
Kelly PJ, Meads N, Theobald A, Fournier
P-E, Raoult D. Rickettsia felis, Bartonella
henselae, and B. clarridgeiae, New Zealand. Emerg Infect Dis. 2004;10:967–8.
Bitam I, Parola P, De La Cruz KD, Matsumoto K, Baziz B, Rolain JM, et al. First
molecular detection of Rickettsia felis in
fleas from Algeria. Am J Trop Med Hyg.
2006;74:532–5.
Karpathy SE, Hayes EK, Williams AM,
Hu R, Krueger L, Bennett S, et al. Detection of Rickettsia felis and Rickettsia typhi
in an area of California endemic for murine typhus. Clin Microbiol Infect. 2009
Apr 3; [Epub ahead of print]
Bayliss DB, Morris AK, Horta MC,
Labruna MB, Radecki SV, Hawley JR, et
al. Prevalence of Rickettsia species antibodies and Rickettsia species DNA in the
blood of cats with and without fever. J
Feline Med Surg. 2009;11:266–70. DOI:
10.1016/j.jfms.2008.06.007
Tabar MD, Altet L, Francino O, Sánchez A,
Ferrer L, Roura X. Vector-borne infections
in cats: molecular study in Barcelona area
(Spain). Vet Parasitol. 2008;151:332–6.
DOI: 10.1016/j.vetpar.2007.10.019
Reif KE, Makaluso KR. Ecology
of Rickettsia felis: a review. J Med
Entomol.
2009;46:723–36.
DOI:
10.1603/033.046.0402
Address for correspondence: Patrick J. Kelly,
Ross University School of Veterinary Medicine,
PO Box 334, West Farm, St. Kitts, West Indies;
email: [email protected]
Rickettsia africae,
Western Africa
To the Editor: Rickettsia africae,
the causative agent of African tickbite fever, is transmitted by Amblyomma hebraeum and A. variegatum
ticks (1,2). These ticks are common
in western, central, and southern Africa. Adults rarely feed on humans, although nymphs attach more frequently
and larvae are sometimes serious pests
(abundant and aggressive) (3).
African tick-bite fever is a neglected disease that has been mainly
detected in tourists who were bitten
by a tick while traveling in diseaseendemic areas (2). A recent worldwide
report showed rickettsial infection incidence to be 5.6% in a group of travelers in whom acute febrile infection
developed after they returned from
sub-Saharan Africa. African tick-bite
fever is the second most frequently
identified cause for systemic febrile
illness among travelers, following malaria (4). Seroprevalence for spotted
fever group rickettsiae is high in the
Sahel regions of Africa (5), although
there may be different emergent and
classic rickettsioses in Africa.
R. africae has been detected by
PCR in many African countries, including Niger, Mali, Burundi, and
Sudan (6), and in most countries of
equatorial and southern Africa (Figure). Most strains and cases have been
found in South Africa (2). R. africae
and African tick-bite fever have not
previously been reported in Senegal,
and few positive human serum samples have been documented in western Africa. A. variegatum, the main
vector of R. africae, was introduced
by cattle into Guadeloupe, West Indies, from Senegal in the early 1800s.
Spotted fever caused by R. africae has
become endemic there in the past 30
years (7). In addition to R. africae, A.
variegatum ticks may transmit other
human and animal pathogens, including Crimean-Congo hemorrhagic fever virus, Dugbe virus, Thogoto virus,
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
571
LETTERS
Bhanja virus, Ehrlichia ruminantium,
Theileria spp., Anaplasma spp., and
Dermatophilus congolensis (3,6).
From November through December 2008, ticks were collected from
domestic animals (cattle, goats, sheep,
dogs, horses, donkeys) in the SineSaloum region of Senegal (villages
Dielmo, Ndiop, Medina, and Passi).
Among the collected ticks, 8 fully
engorged nymphs were kept alive in
flasks at 90%–95% relative humidity.
Other ticks were stored in 70% ethanol. Flagging at ground level was used
to collect ticks from pastures. Species
were identified according to standard taxonomic keys for adult ticks.
Nymphs were allowed to molt before
identification and subsequent bacterial
culture. Rickettsial DNA in other ticks
was detected by semiquantitative PCR
with Rickettsia-specific primers (8).
All positive samples were subjected to
PCR by using primers designed for the
gltA and ompA genes (6). Three rickettsial spacers were chosen for typing: dksA-xerC, rpmE-tRNAmet, and
mppA-purC (9).
Tick larvae were the only stage
collected by flagging at ground level.
Flagging for 30 minutes collected
495 larvae near the village of Passi
and 325 in Dielmo. The larvae were
aggressive, and several attached onto
the collector’s ankles despite preventive measures. All larvae were
morphologically identified as Amblyomma spp. Amplification and sequencing of the portion of mitochondrial cytochrome oxidase I gene of
3 adult A. variegatum ticks, 2 individual larvae, and 1 pool of 10 larvae
detected a 659-bp sequence 100%
identical among all larvae and adults
and corresponding to cytochrome oxidase I of other ticks. The sequence is
Molecular detection in ticks
Cases of spotted fever documented
by serologic examination
Human cases documented by PCR
Isolates obtained from patients
Isolates obtained from ticks
Figure. Distribution of Rickettsia africae in the African continent and serologic evidence of
spotted fevers in humans. Gray shading indicates location of Senegal.
572
deposited in GenBank, accession no.
GU062743.
Adult ticks (n = 492) were collected from domestic animals; 85
(17.3%) were A. variegatum, and 74
(87.1%) were positive for rickettsial
genes according to real-time PCR.
No associations between animal host,
place of collection, and presence of R.
africae were found (data not shown).
During the subsequent amplification
and sequencing of the 632-bp fragment of the ompA gene, all amplicons
were found to be 100% identical to
the ompA sequence of R. africae published in GenBank (CP001612.1).
Molted nymphs were the source
of 3 strains of R. africae. Although
dogs are rarely reported to be hosts of
A. variegatum (3), a dog was the host
of the tick that carried the first isolated strain. A 1,290-bp fragment of
the rickettsial gltA gene and a 632-bp
fragment of the ompA gene from all 3
strains were identical to the published
sequence of the R. africae genome
(CP001612.1). Multispacer typing
showed that all 3 R. africae strains
exhibited a genotype identical to that
of all previously genotyped R. africae
strains (genotype 38). To the best of
our knowledge, this is the northernmost reported isolation of this pathogen in western Africa.
Taking into consideration data
described in previous studies and the
results of our work, we conclude that
A. variegatum is an aggressive and
abundant species of tick. The reported
transovarial transmission rate of 100%
for R. africae (10), the abundance of
ticks, and the high percentage of ticks
that are infected (3) increase the probability that humans will be bitten by
infected ticks. R. africae is present
in Senegal, and human infections (in
tourists and indigenous populations)
may be as common there as in southern Africa, but better availability of
diagnostic assays is needed. Surveys
of the distribution of vector ticks and
rickettsiae should be performed, and
target groups should be screened.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
LETTERS
Oleg Mediannikov,
Jean-François Trape,
Georges Diatta, Philippe Parola,
Pierre-Edouard Fournier,
and Didier Raoult
Author affiliations: Unité de Recherche sur
les Maladies Infectieuses et Tropicales
Emergentes, Marseille, France (O. Mediannikov, P. Parola, P.-E. Fournier, D. Raoult);
and Unité de Recherche sur les Maladies
Infectieuses et Tropicales Emergentes, Dakar, Senegal (O. Mediannikov, J.F. Trape,
G. Diatta)
DOI: 10.3201/eid1603.090346
9.
10.
Fournier PE, Raoult D. Identification of
rickettsial isolates at the species level using multi-spacer typing. BMC Microbiol.
2007;7:72. DOI: 10.1186/1471-2180-7-72
Socolovschi C, Huynh TP, Davoust B,
Gomez J, Raoult D, Parola P. Transovarial
and trans-stadial transmission of Rickettsiae africae in Amblyomma variegatum
ticks. Clin Microbiol Infect. 2009 May 18;
[Epub ahead of print].
Address for correspondence: Oleg Mediannikov,
Mediterranean University, CNRS-IRD UMR
6236-198, 27 blvd Jean Moulin, Marseille
13385 CEDEX 5, France; email: [email protected]
gmail.com
References
1.
2.
3.
4.
5.
6.
7.
8.
Kelly PJ. Rickettsia africae sp. nov., the
etiological agent of African tick bite fever.
Int J Syst Bacteriol. 1996;46:611–4.
Jensenius M, Fournier PE, Vene S, Hoel
T, Hasle G, Henriksen AZ, et al. African tick bite fever in travelers to rural
sub-equatorial Africa. Clin Infect Dis.
2003;36:1411–7. DOI: 10.1086/375083
Hoogstraal H. African Ixodoidea: I. Ticks
of the Sudan (with special reference to
Equatoria Province and with preliminary
reviews of the genera Boophilus, Margaropus, and Hyalomma). Washington: US
Navy; 1956.
Freedman DO, Weld LH, Kozarsky PE,
Fisk T, Robins R, von Sonnenburg F, et al.
Spectrum of disease and relation to place
of exposure among ill returned travelers.
N Engl J Med. 2006;354:119–30. DOI:
10.1056/NEJMoa051331
Dupont HT, Brouqui P, Faugere B, Raoult
D. Prevalence of antibodies to Coxiella
burnetii, Rickettsia conorii, and Rickettsia
typhi in seven African countries. Clin Infect Dis. 1995;21:1126–33.
Parola P, Inokuma H, Camicas JL, Brouqui
P, Raoult D. Detection and identification
of spotted fever group Rickettsiae and
Ehrlichiae in African ticks. Emerg Infect Dis. 2001;7:1014–7. DOI: 10.3201/
eid0706.010616
Parola P, Jourdan J, Raoult D. Tickborne infection caused by Rickettsia
africae in the West Indies. N Engl J
Med. 1998;338:1391. DOI: 10.1056/
NEJM199805073381918
Rolain JM, Sthul L, Maurin M, Raoult
D. Evaluation of antibiotic susceptibilities of three rickettsial species including
Rickettsia felis by a quantitative PCR
DNA assay. Antimicrob Agents Chemother. 2002;46:2747–51. DOI: 10.1128/
AAC.46.9.2747-2751.2002
Transmission of
West Nile Virus
during Horse
Autopsy
To the Editor: West Nile virus
(WNV) circulates mainly in birds and
ornithophilic mosquitoes. Humans and
horses are considered incidental, deadend hosts (1). Fever, rash, arthralgia,
and myalgia develop in ≈20% of cases
in humans; severe neurologic disease
may develop in <1% (1). In horses,
20% of infections result in clinical
disease, of which ≈90% involve neurologic disease with ataxia, weakness,
recumbency, muscle fasciculation, and
high death rates (30%) (2).
Genetic variants of WNV include
lineage 1 found in the Northern Hemisphere and Australia; lineage 2 found
mainly in southern Africa and Madagascar (3); lineages 3 and 4 found in
central and eastern Europe (4); and lineage 5 found in India (5). Differences
in neuroninvasiveness and pathogenic
potential are functions of individual
genotypes, not lineage (3,6–8).
We recently reported WNV lineage 2 in several cases of neurologic
disease in horses in South Africa
(most cases were fatal) (7). We report
a case of zoonotic transmission to a
veterinary student during the autopsy
of a horse. The study was reviewed
and approved by the Ethics Committee of the University of Pretoria, and
informed consent was provided by the
veterinary student.
On April 9, 2008, a 4-month-old
Welsh pony from Gauteng in South
Africa had fever, Schiff-Sherrington
signs, and a leukocyte count of 32 ×
109 cells/L. He was treated with dimethyl sulfoxide, dexamethasone, and
chloramphenicol and responded well.
He was able to stand with help, and
did not show neurologic signs at this
stage. On May 9, he was sent home
and was able to walk with support.
On May 12, he had a relapse with
neurologic deterioration and rectal
prolapse, and was treated with antiinflammatory agents. Symptoms worsened and he was humanely killed
on May 15 by using ketamine and
MgSO4. The carcass was sent to the
Faculty of Veterinary Sciences, University of Pretoria, for autopsy because of unusual neurologic signs in
the pony. Autopsy was performed by
a veterinary pathologist and 2 students on May 16, 2008.
Macroscopic findings included
moderate intermuscular, fascicular,
perineural edema, severe diffuse pulmonary edema, mild hydropericardium, and rectal prolapse resulting in
marked submucosal edema and mucosal hyperamia, i.e., traumatic proctitis. The spinal cord up to C1 showed
marked Wallerian degeneration of the
peripheral white matter from the median fissure, which extended along the
ventral funiculus up to the most dorsal
section of the lateral funiculus. Changes were characterized by white matter
spongiosis with numerous digestion
chambers containing phagocytosing
myelinophages and scattered interstitial gemistocytes. No inflammatory reaction was detected. We also observed
septal edema and moderate multifocal
perivascular and peribronchiolar lymphocytic infiltration with occasional
apoptosis in the lungs.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
573
LETTERS
developed in the veterinary student
who had handled the horse brain. A
rash appeared 2 days later. Symptoms
persisted for ≈10 days. The patient
was treated symptomatically by an
infectious disease specialist and prescribed bed rest. Because cases of Rift
Valley fever were recently reported
in veterinarians in South Africa, serum was sent to the National Institute
for Communicable Diseases, where
a virus isolate was obtained in suckling mice and identified as WNV by
RT-PCR.
After diagnosis of WNV infection in the pony, RNA extracted from
the original human serum and from
the suckling mouse isolate was sent
to the Department of Medical Virol-
The brain, which was removed by
1 of the students, was sent to the Department of Medical Virology, University of Pretoria for WNV reverse transcription–PCR (RT-PCR). The lungs
were sent to Onderstepoort Veterinary
Institute for African horse sickness RTPCR. WNV-specific real-time RT-PCR
showed positive results. DNA sequencing and phylogenetic analysis identified
WNV lineage 2 in several sections of
the brain (HS23/2008, GenBank accession no. FJ464376). Results of African
horse sickness RT-PCR on lung tissue
specimens were inconclusive and could
not be confirmed by culture.
On May 22, six days after the autopsy on the horse, fever, malaise, myalgia, stiff neck, and severe headache
SA268_2008 MB
HS123/2008
SA268_2008RNA
HS101/2008
SAE126/2008
SA93/2001
89
90 ArD76104
Lineage 2
B956
95
SA381/2000
H442
99
SPU116/89
Goshawk Hungary/2004
Sarafend
Madagascar AnMg798
Lineage 3
LEIV-Krnd88-190
Lineage 4
WNV804994
Lineage 5
Rabensburg 97-103
Egypt 101
73
ogy, University of Pretoria, for DNA
sequencing and phylogenetic analysis
of the virus. Comparison of part of the
nonstructural protein 5 gene identified
identical sequences from the student’s
serum, the virus isolate, and the pony’s
brain. All sequences clustered with lineage 2 WNV and were closely related
to isolates obtained from horses diagnosed with fatal WNV encephalitis in
South Africa in 2008 (7) (Figure).
Human infections with WNV
have been described after bird autopsies and needle stick injury in laboratory workers (9,10). The case acquired
by our patient suggests a zoonotic risk
exists for infection with WNV during autopsy of horses that died from
neurologic disease. Although humans
and horses are considered to have
low-grade viremia, virus levels may
be higher in nerve tissue.
The patient wore latex gloves, his
only protection during the autopsy,
and had removed the spinal cord and
brain. No protective inhalation or eye
equipment was worn. No autopsy assistants or other students who worked
with or were near the carcass became
sick or seroconverted. The most likely
route of infection may have involved
exposure of mucous membranes to
droplets. After the incident, biosafety
measures were improved and included
wearing of masks and eye protection
gear during autopsies at the facility.
EthAn4766
MRM61C
WN Italy 1998-equine
90
WNV Ast02-2-25
Lineage 1
LEIV-Vlg00-27924
Acknowledgments
We thank Janice Croft and Busi Mogodi for technical assistance.
This study was supported by a grant
from the National Research Foundation of
South Africa.
Goose-Hungary/2003
Mex03
78
NY385/99
WNV TX 2002 2
JEV
0.05
Figure. Phylogenetic comparison of West Nile virus (WNV) nonstructural protein 5 partial
gene fragment identified in a veterinary student’s serum and in the virus isolate obtained
from mouse brain and the horse’s brain after autopsy (triangles) relative to other WNV
strains from South Africa and elsewhere. The neighbor-joining tree was compiled by using
MEGA version 4 software (www.megasoftware.net/under) and 1,000 bootstrap replicates
by using the maximum composite likelihood algorithm. Genetic lineages are indicated on
the right as described (3–7). Scale bar indicates nucleotide substitutions per site. JEV,
Japanese encephalitis virus (included as outgroup).
574
Marietjie Venter, Johan Steyl,
Stacey Human,
Jacqueline Weyer,
Dewald Zaayman,
Lufcille Blumberg,
Patricia A. Leman,
Janusz Paweska,
and Robert Swanepoel
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
LETTERS
Author affiliations: University of Pretoria,
Pretoria, South Africa (M. Venter, J. Steyl,
S. Human, D. Zaayman); and National Institute for Communicable Diseases, Sandringham, South Africa (M. Venter, J. Weyer, L.
Blumberg, P.A. Lehman, J. Paweska, R.
Swanepoel)
DOI: 10.3201/eid1603.091042
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
Hayes EB, Sejvar JJ, Zaki SR, Lanciotti
RS, Bode AV, Campbell GL. Virology,
pathology, and clinical manifestations of
West Nile virus disease. Emerg Infect Dis.
2005;11:1174–9.
Hayes EB, Gubler DJ. West Nile virus:
epidemiology and clinical features of an
emerging epidemic in the United States.
Annu Rev Med. 2006;57:181–94. DOI:
10.1146/annurev.med.57.121304.131418
Burt FJ, Grobbelaar AA, Leman PA, Anthony FS, Gibson GV, Swanepoel R. Phylogenetic relationships of southern African
West Nile virus isolates. Emerg Infect Dis.
2002;8:820–6.
Lvov DK, Butenko AM, Gromashevsky
VL, Kovtunov AI, Prilipov AG, Kinney R,
et al. West Nile virus and other zoonotic
viruses in Russia: examples of emergingreemerging situations. Arch Virol Suppl.
2004;18:85–96.
Bondre VP, Jadi RS, Mishra AC, Yergolkar
PN, Arankalle VA. West Nile virus isolates
from India: evidence for a distinct genetic
lineage. J Gen Virol. 2007;88:875–84.
DOI: 10.1099/vir.0.82403-0
Beasley DW, Li L, Suderman MT, Barrett AD. Mouse neuroinvasive phenotype of West Nile virus strains varies depending upon virus genotype.
Virology. 2002;296:17–23. DOI: 10.1006/
viro.2002.1372
Venter M, Human S, Zaayman D, Gerdes
GH, Williams J, Steyl J, et al. Lineage
2 West Nile virus as cause of fatal neurologic disease in horses, South Africa.
Emerg Infect Dis. 2009;15:877–84. DOI:
10.3201/eid1506.081515
Venter M, Myers TG, Wilson MA, Kindt
TJ, Paweska JT, Burt FJ, et al. Gene
expression in mice infected with West
Nile virus strains of different neurovirulence. Virology. 2005;342:119–40. DOI:
10.1016/j.virol.2005.07.013
Centers for Disease Control and Prevention. Laboratory-acquired West Nile
virus infections⎯United States, 2002.
JAMA. 2003;289:414–5. DOI: 10.1001/
jama.289.4.414
10.
Venter M, Burt FJ, Blumberg L, Fickl
H, Paweska J, Swanepoel R. Cytokine
induction
after
laboratory-acquired
West Nile virus infection. N Engl J
Med. 2009;360:1260–2. DOI: 10.1056/
NEJMc0808647
Address for correspondence: Marietjie Venter,
Department of Medical Virology, Faculty of
Health Sciences, University of Pretoria, PO
Box 2034, Pretoria 0001, South Africa; email:
[email protected]
Breeding Sites of
Bluetongue Virus
Vectors, Belgium
To the Editor: Bluetongue (BT)
is an emerging disease of ruminants in
northern Europe (1,2). This disease was
reported in August 2006 in the Netherlands and a few days later in Belgium.
In 2006, animals in the Netherlands,
Belgium, and Germany were affected.
In contrast to 2006, when BT virus
(BTV) was identified in ≈2,000 enclosures on farms, BTV was identified
in >40,000 farm buildings containing
ruminants in 2007; many infected animals had severe disease. In addition,
the virus expanded its range to include
large areas of France, Denmark, the
United Kingdom, Switzerland, and the
Czech Republic (2).
In 2008, BTV serotype 8 (BTV-8)
continued its spread across Europe
and showed virulence in France where
26,925 BTV-8 outbreaks were reported (3). This observation indicates possible overwintering of the vector from
year to year. However, the mechanism
of overwintering is not clear. The biting midges responsible for transmission of BTV in northern Europe belong
to the genus Culicoides, but only few
species are vectors of this virus (2).
During the winter of 2006–2007,
Losson et al. (1) monitored the pres-
ence of biting midges inside farm
buildings. Zimmer et al. (4) observed
potential vectors of BTV inside a
sheepfold during the winter of 2007–
2008 and in farm buildings in 2008.
These authors suggested that Culicoides spp. may be more abundant indoors than outdoors when animals are
kept in these buildings. Breeding sites
of bluetongue vector species have been
found near farms (silage residues) (5)
and in neighboring meadows (overwintering cattle dung and silt along a
pond) (5,6) but not inside sheds.
We conducted a study on 5 cattle
farms in Belgium during February–
October 2008. Three samplings were
performed: the first in late February, the second in mid-June, and the
third in late October. Soil samples
(15 biotopes) were collected inside
cowsheds. These samples were incubated at 24°C to enable adult midges
to emerge. All Culicoides specimens
were identified by sex and to the species level by using the morphologic
key of Delécolle (7).
Among 15 soil biotopes obtained
from farm buildings, only 1 showed
the emergence of adult Culicoides biting midges. At a cattle farm in Spy
(50°28′31′′N, 4°40′39′′E), we found
that dried dung adhering to walls inside animal enclosures and used animal litter was a breeding site for the C.
obsoletus/scoticus complex (Table).
Only 25% of emerging Culicoides
midges were females.
We observed that C. obsoletus/
scoticus complex midges are more
prevalent in soil samples with a high
carbon:nitrogen (C:N) index; this index indicates the amount of organic
matter in soil. C:N indices between 15
and 30 support production of humus
and ensure good microbial growth.
In addition, larvae of Culicoides spp.
feed on organic material and microorganisms in soil (8).
Our observations suggest that
biting midges can complete their life
cycle in animal enclosures. This finding is consistent with the high capture
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
575
LETTERS
Table. Culicoides species obtained from dried dung samples inside a cowshed, Spy,
Belgium, 2008
Culicoides species
Carbon:
No.
nitrogen
Culicoides
C. obsoletus
C. obsoletus/scoticus
specimens
Sampling period
index
males
females
Late February
19.5
53
40
13
Mid-June
12.8
13
10
3
Late October
12.5
3
2
1
rates of nulliparous (empty and unpigmented abdomens) (9) adult midges
observed when suction light traps
(Onderstepoort Veterinary Institute,
Onderstepoort, South Africa) were
used on cattle farms during April–
May 2007 (4).
We identified a breeding site for
the primary BTV vector in a cowshed
in northern Europe (10). Vectors feed
on blood, overwinter inside cowsheds
(1), lay eggs, and larvae develop under
such conditions. These observations
could explain the persistence of BTV
from year to year despite fairly harsh
winters.
Hygienic measures on farms
could reduce midge populations and
improve efficacy of vaccination campaigns against BT in Europe. We
strongly recommend that such integrated control strategies be evaluated.
Removal of residual animal feed and
feces on farms and of material from silage structures and sheds, particularly
deposits of manure adhering to walls
of sheds and used litter, are simple and
inexpensive measures that should be
implemented. However, their success
will depend on active participation by
farmers.
Jean-Yves Zimmer,
Claude Saegerman,
Bertrand Losson,
and Eric Haubruge
Author affiliation: University of Liege, Liege,
Belgium
DOI: 10.3201/eid1603.091311
References
1.
576
Losson B, Mignon B, Paternostre J, Madder M, De Deken R, De Deken G, et al.
Biting midges overwintering in Belgium.
Vet Rec. 2007;160:451–2.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Saegerman C, Berkvens D, Mellor PS.
Bluetongue epidemiology in the European
Union: current status and perspectives.
Emerg Infect Dis. 2008;14:539–44. DOI:
10.3201/eid1404.071441
Saegerman C, Berkvens D, Mellor
PS, Dal Pozzo F, Porter S, Zientara S.
Fièvre catarrhale ovine: l'Europe au carrefour de l'enzootie. Point Vétérinaire.
2008;290:41–7.
Zimmer JY, Haubruge E, Francis F, Bortels J, Joie E, Simonon G, et al. Distribution of potential bluetongue vectors on
Belgium farms. Vet Rec. 2008;162:700.
Zimmer JY, Haubruge E, Francis F, Bortels J, Simonon G, Losson B, et al. Breeding sites of bluetongue vectors in northern
Europe. Vet Rec. 2008;162:131.
Chaker E. Contribution à l’étude de la
morphologie et de la diagnose des larves
de Culicoides (Diptera, Ceratopogonidae
[Thèse d’Université]. Strasbourg (France):
Université Louis Pasteur de Strasbourg;
1983.
Delécolle JC. Nouvelle contribution à
l’étude systématique et iconographique
des espèces du genre Culicoides (Diptera: Ceratopogonidae) du Nord-Est de la
France [Thèse d’Université]. Strasbourg
(France): Université Louis Pasteur de
Strasbourg; 1985.
Williams RE, Turner EC. An improved
laboratory larval medium for Culicoides
guttipennis (Coq.) (Diptera: Ceratopogonidae). J Med Entomol. 1976;13:157–61.
Dyce AL. The recognition of nulliparous and parous Culicoides (Diptera:
Ceratopogonidae) without dissection.
Journal of the Australian Entomological Society. 1969;8:11–5. DOI: 10.1111/
j.1440-6055.1969.tb00727.x
Carpenter S, McArthur C, Selby R,
Ward R, Nolan DV, Mordue Luntz AJ,
et al. Experimental infection studies of
UK Culicoides species midges with bluetongue virus serotypes 8 and 9. Vet Rec.
2008;163:589–92.
Address for correspondence: Eric Haubruge,
Department of Functional and Evolutionary
Entomology, Gembloux Agro-Bio Tech,
University of Liege, Liege, Belgium; email:
[email protected]
Two Lineages of
Dengue Virus
Type 2, Brazil
To the Editor: Dengue viruses
(DENVs) belong to the genus Flavivirus (family Flaviviridae) and exist as
4 antigenic types, serotypes 1–4, each
with well-defined genotypes. Dengue
virus is associated with clinical manifestations that range from asymptomatic infections and relatively mild
disease (classic dengue fever) to more
severe forms of dengue hemorrhagic
fever and dengue shock syndrome.
Dengue has become one of the most
serious vector-borne diseases in humans. The World Health Organization
estimates that 2.5 billion persons live
in dengue-endemic areas and >50 million are infected annually (1).
In 1986, dengue virus type 1
(DENV-1) caused an outbreak in the
state of Rio de Janeiro and has since
become a public health concern and
threat in Brazil. (2). In 1990, DENV-2
was reported in the state of Rio de Janeiro, where the first severe forms of
dengue hemorrhagic fever and fatal
cases of dengue shock syndrome were
documented. The disease gradually
spread to other regions of the country
(3). In 2002, DENV-3 caused the most
severe dengue outbreak in the country
and sporadic outbreaks continued to
be documented through 2005 (4).
Since 1990, two additional epidemics caused by DENV-2 have occurred (1998 and 2007–2008) in Brazil. A severe DENV-2 epidemic in
the state of Rio de Janeiro began in
2007 and continued in 2008; a total of
255,818 cases and 252 deaths were reported (5). This epidemic prompted us
to investigate the genetic relatedness
of DENV-2 for all of these epidemics.
DENV-2 isolates from these
epidemic periods were subjected to
sequencing and comparison. Gross
sequences of DENV-2 isolates from
all epidemic periods grouped with
sequences from DENV-2 American/
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
LETTERS
Asian genotype; this finding was expected because this genotype is circulating in the Americas (6,7). Sequences of DENV-2 isolates from the 1998
epidemic grouped with sequences of
DENV-2 isolates from the 1990 epidemic (data not shown) suggesting
that viruses circulating during these 2
epidemic periods belong to the same
lineage of the DENV-2 strain originally found in the state of Rio de Janeiro. However, sequences of DENV-2
isolates from 2007/2008 epidemics
grouped separately and distinctly
from the 1990 and 1998 DENV-2 isolates and represented a monophyletic
group in the phylogenetic tree with
bootstraps of 98% (Figure). This result shows a temporal circulation of
genetically different viruses in Rio de
Janeiro that could be a result of local
evolution of DENV-2 since its introduction in 1990, or even an introduction of a new lineage of DENV-2 in
the region.
A study conducted by Aquino et al.
(7) showed that Paraguayan DENV-2
strains could be grouped as 2 distinct
variants within the American/Asian
genotype, thus further supporting that
the introduction of new DENV-2 variants may likely associate with the shift
of dominant serotypes from DENV-3
to DENV-2 in 2005 and might have
caused an outbreak of DENV-2. Our
results are consistent with this scenario because was a shift of a dominant
serotype from DENV-3 to DENV-2
that was observed in 2008 in Rio de
Janeiro. However, other factors, such
as immunity level to DENV-3 and
DENV-2, could explain the shift of
dominant serotype besides the circulation of a new viral variant.
Because the dengue outbreaks of
2007 and 2008 were the most severe
of the dengue infections in Brazil in
terms of number of cases and deaths,
this genetically distinct DENV-2 could
have contributed to this pathogenic
profile. Additionally, these samples
came from disperse locations in Rio
de Janeiro and we do not believe that
there is a clustering issue in our sampling. However, again, other factors
must be considered as contributors to
this scenario because of the intrinsic
properties of this distinct virus, host
susceptibility, and secondary cases of
infection.
In addition, detailed examination
of amino acid sequences of Brazilian
DENV-2 strains isolated in 1998 and
86
83
0.005
2008/BR/305
2008/BR/312
2007/BR/88034
2008/BR/258
2008/BR/T1
2008/BR/303
2008/BR/246
2008/BR/T2
2007/BR/86977
98
2007/BR/87730
2007/BR/87183
2008/BR/337
2008/BR/030
2008/BR/316
97 2001/DO/AB122020
II
2005/PR/EU687216
2001/DO/AB122022
99
2001/DO/AB122021
2005/PR/EU687217
2005/PR/EU482731
95
2007/PR/EU596491
99
2006/PR/EU482726
95
1998/PR/EU687212
99
1998/PR/DQ364516
99
1999/PR/EU677145
1998/PR/EU482546
1998/PR/EU482560
1998/PR/DQ364547
99
99 1998/PR/DQ364517
1999/PR/EU677142
1997/PR/DQ364559
99 1990/VE/AY158329
1990/VE/AF100466
99
1996/VE/EU687220
82
1999/VE/AF398106
1995/PR/EU569708
1993/CO/DQ364512
1997/CO/DQ364497
95
2000/EC/DQ364511
1992/CO/AY577431
I
1996/PR/EU596486
1999/PR/EU677144
99
1998/PR/DQ364500
1997/PR/EU569713
1998/BR/64020
99
1998/BR/63205
1998/BR/63444
1998/BR/63428
2005/PY/EU045313
96
1998/BR/63415
99
89
1976/TH/DQ181815
1978/TH/DQ181811
1981/TH/DQ181825
1977/TH/DQ181813
1974/TH/DQ181816
1974/TH/DQ181806
97
1980/TH/AF264053
99
1979/TH/DQ181808
93
1983/TH/DQ181838
1981/TH/DQ181824
1985/TH/DQ181833
1980/TH/DQ181828
1983/TH/DQ181817
1979/TH/DQ181809
1982/TH/DQ181821
1981/TH/DQ181823
1980/TH/DQ181826
1980/TH/DQ181827
American/
Asian genotype
Asian genotype I
Figure. Neighbor-joining phylogenetic tree of 68 complete envelope (E) gene sequences of
dengue virus type 2 (DENV-2). Only bootstrap values >80% are shown. DENV-2 sequences
obtained from 21 patients infected during the 1990, 1998, and 2007–2008 epidemics were
isolated from acute-phase cases. Sequences of the E gene were compared with DENV-2
sequences of American/Asian genotype deposited in GenBank (www.ncbi.nlm.nih.gov).
Strains of Asian genotype I served as the outgroup. All sequences were aligned by using
ClustalX (www.ebi.ac.uk/clustalw), and phylogenetic analysis was performed by using
MEGA 4.0 (www.megasoftware.net), according to the Tamura-Nei model. The reliability
of the inferred phylogenetic tree was estimated by the bootstrap method, with 1,000
replications. Horizontal branch lengths are drawn to scale, and the tree was rooted by using
the Asian genotype, which always appears as the most divergent. Scale bar represents
percentage of genetic distance. Black circles represent sequences generated in this study
and sequences from Rio de Janiero from 1998 and 2007–2008. The names of DENV-2
isolates include reference to year of isolation and country of origin: BR, Brazil; CO, Colombia;
DO, Dominican Republic; EC, Ecuador; PR, Puerto Rico; PY, Paraguay; TH, Thailand; VE,
Venezuela. A more detailed description of the methods used, as well as GenBank accession
numbers for the isolates, can be found with the online version of this figure (www.cdc.gov/
EID/content/16/3/576-F.htm)
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
577
LETTERS
2008 showed 6 aa substitutions in the
envelope gene: V129I, L131Q, I170T,
E203D, M340T, and I380V. Our results
support the notion that aa positions at
129 and 131 in the envelope gene are
critical genetic markers for phylogenetic classification of DENV-2 (7–9).
Notably, residue 131 in the envelope gene is located within a pH-dependent hinge region at the interface
between domains I and II of the envelope protein. Mutations at this region
may affect the pH threshold of fusion
and the process of conformational
changes (10).
Our results suggest the circulation
of genetically different DENV-2 in
Brazil and that these viruses may have
a role in severity of dengue diseases.
These findings can help to further understand the complex dynamic pathogenic profile of dengue viruses and
their circulation in dengue-endemic
regions.
3.
Michelli Faria Oliveira,1
Josélio Maria Galvão Araújo,1
Orlando Costa Ferreira Jr.,
Davis Fernandes Ferreira,
Dirce Bonfim Lima,
Flavia Barreto Santos,
Hermann Gonçalves
Schatzmayr, Amilcar Tanuri,
and Rita Maria Ribeiro Nogueira
8.
Author’s affiliations: Universidade Federal
do Rio de Janeiro, Rio de Janeiro, Brazil
(M.F. Oliveira, O. Costa Ferreira Jr., D.F.
Feirreira, A. Tanuri); Instituto Oswaldo, Rio
de Janeiro (J.M.G. Araújo, F.B. Santos,
H.G. Schatzmayr, R.M. Ribeiro Nogueira);
and Universidade do Estado do Rio de Janeiro, Rio de Janeiro (D.B. Lima)
DOI: 10.3201/eid1603.090996
References
1.
2.
578
World Health Organization (WHO). Impact of dengue [cited 2009 Feb 25]. http://
www.who.int/csr/disease/dengue/impact/
en/index.html
Schatzmayr HG, Nogueira RM, Travassos
da Rosa AP. An outbreak of dengue virus
at Rio de Janeiro-1986. Mem Inst Oswaldo Cruz. 1986;81:245–6. DOI: 10.1590/
S0074-02761986000200019
4.
5.
6.
7.
9.
10.
Nogueria RM, Miagostovich MP, Lampe
E, Souza RW, Zagne SM, Schatzmayr HG,
et al. Dengue epidemic in the stage of Rio
de Janeiro, Brazil, 1990–1: co-circulation
of dengue 1 and dengue 2 serotypes. Epidemiol Infect. 1993;111:163–70.
Nogueira RM, Schatzmayr HG, Filippis
AM, Santos FB, Cunha RV, Coelho JO,
et al. Dengue type 3, Brazil, 2002. Emerg
Infect Dis. 2005;11:1376–1381.
Secretaria de Vigilância em Saúde (SVS).
Relatório de casos de dengue–2008. 2009
[cited 2009 Feb 25]. http://www.saude.
rj.gov.br/Docs/Acoes/dengue/Dengue/
Relat%C3%B3rio%20de%20Casos%20
de%20Dengue%20_18–02–2009%20
-%2019h25m_%20-%202008.pdf.
Twiddy SS, Farrar JJ, Vinh Chau N, Wills
B, Gould EA, Gritsun T, et al. Phylogenetic relationships and differential selection
pressures among genotypes of dengue-2
virus. Virology. 2002;298:63–72. DOI:
10.1006/viro.2002.1447
Aquino JD, Tang WF, Ishii R, Ono T,
Eshita Y, Aono H, et al. Molecular epidemiology of dengue virus serotypes 2
and 3 in Paraguay during 2001–2006: the
association of viral clade introductions
with shifting serotype dominance. Virus
Res. 2008;137:266–70. DOI: 10.1016/j.
viruses.2008.07.011
Bennett SN, Holmes EC, Chirivella M,
Rodriguez DM, Beltran M, Vorndam V, et
al. Molecular evolution of dengue 2 virus
in Puerto Rico: positive selection in the
viral envelope accompanies clade reintroduction. J Gen Virol. 2006;87:885–93.
DOI: 10.1099/vir.0.81309-0
Modis Y, Ogata S, Clements D, Harrison
SC. A ligand-binding pocket in the dengue
virus envelope glycoprotein. Proc Natl
Acad Sci U S A. 2003;100:6986–91. DOI:
10.1073/pnas.0832193100
Modis Y, Ogata S, Clements D, Harrison SC. Structure of the dengue vírus
envelope protein after membrane fusion.
Nature. 2004;427:313–9. DOI: 10.1038/
nature02165
Address for correspondence: Amilcar Tanuri,
Laboratório de Virologia Molecular Animal,
Departamento de Genética – Instituto de
Biologia, Universidade Federal do Rio de
Janeiro, CCS, Bloco A, sala 121, Av: Brigadeiro
Trompowski, s/n, Ilha do Fundão, Rio de
Janeiro, CEP 21944-970, RJ, Brazil; email:
[email protected]
1
These authors contibuted equally to this
manuscript.
Yersinia Species
Isolated from Bats,
Germany
To the Editor: Bats are distributed worldwide and are among the most
diverse and species-rich mammals on
earth. They exist in a large variety of
distinct ecologic niches. Many bat
species roost near humans, which is of
particular interest for research on batto-human transmission of potential
zoonotic pathogens. Moreover, migratory bats could act as long-distance
vectors for several infectious agents.
In recent decades, scientific interest in
chiropteran species has markedly increased because bats are known hosts
to zoonotic agents, such as henipaviruses, Ebola virus, and severe acute
respiratory syndrome (SARS)–like
corona viruses (1,2). However, investigations regarding bacterial pathogens with potential for mutual transmission between bats and humans are
sparse. The effect of bacterial agents
on individual bats is largely unknown
and has been neglected in most studies
published to date (3).
We conducted a broad study
during 2006–2008 on diseases and
causes of death in bats among 16 species found in Germany. Two hundred
deceased bats, collected in different geographic regions in Germany
(southern Bavaria, eastern Lower Saxony, eastern Brandenburg, and Berlin
greater metropolitan area), were subjected to necropsy and investigated
by using routine histopathologic
and bacteriologic methods. During
necropsy, instruments were dipped in
70% ethanol and moved into a Bunsen burner flame after every incision
to prevent any cross-contamination.
For bacteriologic examination, tissue
samples were treated accordingly to
prevent environmental contamination. A freshly cut tissue surface was
plated onto Columbia agar (5% sheep
blood; Oxoid, Wesel, Germany),
Gassner agar (Oxoid), and MacCo-
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
LETTERS
nkey agar (Oxoid) and incubated at
37°C for 24–48 hours.
Twenty-five bacterial genera were
cultured from bats, including 2 known
human-pathogenic Yersinia spp., i.e.,
Y. pseudotuberculosis and Y. enterocolitica. The first Yersinia strain (Y938)
was cultured from lung, heart, kidney
(pure cultures), liver, spleen, and intestine (mixed cultures) of a greater
mouse-eared bat (Myotis myotis). This
isolate was identified as Y. pseudotuberculosis by Api 20E (bioMérieux,
Nürtingen, Germany), Micronaut-E
(Merlin Diagnostik GmbH, BornheimHersel, Germany), and 16S rRNA gene
analysis (Table). The sequence was
deposited into GenBank under accession no. FN561631. Further serologic
characterization by agglutination test
(Denka Seiken, Tokyo, Japan) and
multilocus sequence typing (4) identified Y. pseudotuberculosis serogroup
1, biovar 5, sequence type (ST) 43 in
all tissue samples investigated. During
necropsy, severe enlargement of the
liver and a marked hemoperitoneum
were seen. Microscopic examination
showed multifocal severe necrotizing
hepatitis and splenitis associated with
numerous intralesional gram-negative
coccobacilli and a moderate to marked
interstitial pneumonia. The remaining
organs, including heart, kidney, and
intestine, had no pathologic changes.
The second Yersinia strain
(Y935), Y. enterocolitica, was isolated
in pure culture from spleen and intes-
tine of a common pipistrelle (Pipistrellus pipistrellus) and identified by
the methods described above (Table).
The 16S rRNA sequence was deposited into GenBank under accession
no. FN561632. No bacteria were cultured from any other organ. Based on
results of an agglutination test (Denka
Seiken), the isolate was characterized
as Y. enterocolitica serotype O:6, biovar 1A. Necropsy and histopathologic
examination showed no inflammatory
changes, suggesting a subclinical state
of infection.
Yersiniosis is a bacterial disease
with a wide distribution and host
range. Y. pseudotuberculosis and Y.
enterocolitica are frequently isolated
from a variety of wild and domestic
animals (5), but little is known about
the occurrence of yersiniosis in freeranging chiropteran species. Only few
reports of fatal Y. pseudotuberculosis
infection in captive flying foxes have
been published (6,7). In Europe, Y.
pseudotuberculosis strains belonging to serogroup 1 are most common
and cause most Y. pseudotuberculosis
infections in humans and animals (5).
Isolates of ST43 in the multilocus sequence typing database (4) came from
humans, birds, hares, hedgehog, cat,
dog, and pig in Europe; humans in
Asia; marsupial in Australia; and deer
in Australia and New Zealand. We report an isolate from a free-ranging bat
in Germany. Y. enterocolitica biovar
1A has been found in a wide range
of human, animal, and environmental
sources. Although often considered
nonpathogenic, this biovar is described as an opportunistic pathogen
(8), and serovar O:6 has been detected
as the causative agent of ovine placentitis and abortion (9).
Transmission of both Yersinia
species generally occurs after ingestion of contaminated food or water.
All bat species in Germany are insectivorous, and insects can be infected
with various microbial agents. Investigations concerning bacteria–insect
interactions showed that insects may
carry pathogenic bacteria, including
Yersinia (10); thus, insects or contaminated water are possible sources of
both species described.
In conclusion, Y. pseudotuberculosis and Y. enterocolitica were isolated from 2 bat species in Germany,
representing evidence of Yersinia spp.
in free-ranging vespertilionids. Histopathologic findings of the greater
mouse-eared bat were consistent with
those of systemic Y. pseudotuberculosis infection, rendering this species
pathogenic for bats. The common
pipistrelle was subclinically infected
with Y. enterocolitica. The role of
wild animals as reservoir hosts for
bacterial pathogens such as Yersinia
spp. is well known, underlining the
need for biologists and persons handling wildlife to be aware of these
zoonotic infectious agents.
Table. Strain typing results of Yersinia spp. isolates from free-ranging bats, Germany*
Method
Y. pseudotuberculosis†
Api 20E profile§
101411217
Micronaut E,¶ % probability
100% Y. pseudotuberculosis
16S rRNA gene analysis, % similarity to sequences in GenBank
100% (1,058 bp) to
Y. pseudotuberculosis YPIII#
Serologic characterization by agglutination test
Serogroup 1, biovar 5
Multilocus sequence typing††
1212521
Y. enterocolitica‡
1154723 17
99.77% Y. enterocolitica
100% (985 bp) to
Y. enterocolitica strain 280**
Serotype O:6, biovar 1A
Not determined
*Y. pseudotuberculosis obtained from lung, heart, kidney, spleen, liver, and intestine; Y. enterocolitica obtained from spleen and intestine. For Y.
pseudotuberculosis spleen, liver, and intestine samples, isolates were obtained in mixed culture accompanied by colonies of 1–2 nonspecific bacteria. For
all remaining tissues, Y. pseudotuberculosis and Y. enterocolitica were isolated in pure culture.
†GenBank accession no. FN561631.
‡GenBank accession no. FN561632.
§bioMérieux, Nürtingen, Germany.
¶Merlin Diagnostik GmbH, Bornheim-Hersel, Germany.
#GenBank accession no. CP000950.
**GenBank accession no. FJ641888.
††Of gene loci adk, argA, aroA, glnA, thrA, tmk, trpE.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
579
LETTERS
Acknowledgments
We thank Nadine Jahn, Doris Krumnow, Stephan Schatz, and Robert Schneider for excellent technical assistance
and Martin Pfeffer and Holger Scholz for
editorial help.
This study was supported by the
Adolf and Hildegard Isler Stiftung and the
Klara Samariter Stiftung. The multilocus
sequence typing database is publicly available at http://mlst.ucc.ie, which is currently supported by a grant from the Science
Foundation of Ireland (05/FE1/B882).
Kristin Mühldorfer,
Gudrun Wibbelt,
Joachim Haensel,
Julia Riehm,
and Stephanie Speck1
Author affiliations: Leibniz Institute for Zoo
and Wildlife Research, Berlin, Germany (K.
Mühldorfer, G. Wibbelt, S. Speck); Berlin,
(J. Haensel); and Federal Armed Forces
Institute of Microbiology, Munich, Germany
(J. Riehm)
DOI: 10.3201/eid1603.091035
1
Current affiliation: Federal Armed Forces
Institute of Microbiology, Munich, Germany.
References
1.
2.
3.
4.
5.
580
Calisher CH, Childs JE, Field HE, Holmes
KV, Schountz T. Bats: important reservoir
hosts of emerging viruses. Clin Microbiol Rev. 2006;19:531–45. DOI: 10.1128/
CMR.00017-06
Wong S, Lau S, Woo P, Yuen K-Y. Bats as
a continuing source of emerging infections
in humans. Rev Med Virol. 2007;17:67–
91. DOI: 10.1002/rmv.520
Wibbelt G, Speck S, Field H. Methods
for assessing diseases in bats. In: Kunz
TH, Parsons S, editors. Ecological and
behavioral methods for the study of bats.
Baltimore: The Johns Hopkins University
Press; 2009. p. 775–94
MLST Databases at the ERI. University
College Cork [cited 2009 Jul 1]. http://mlst.
ucc.ie/mlst/dbs/Ypseudotuberculosis/
documents/primersPseudotuberculosis_
html
Mair NS. Yersiniosis in wildlife and its
public health implications. J Wildl Dis.
1973;9:64–71.
6.
Williams CH. A review of pseudotuberculosis at a European zoo: epidemiology
and approaches to control. In: Health and
conservation of captive and free-ranging
wildlife. Proceedings of the American Association of Zoo Veterinarians, American
Association of Wildlife Veterinarians,
Wildlife Disease Association Joint Conference; 2004 Aug 28–Sep 3; San Diego,
California. p. 303–9.
7. Childs-Sanford SE, Kollias GV, AbouMadi N, McDonough PL, Garner MM,
Mohammed HO. Yersinia pseudotuberculosis in a closed colony of Egyptian fruit
bats (Rousettus aegyptiacus). J Zoo Wildl
Med. 2009;40:8–14. DOI: 10.1638/20070033.1
8. Tennant SM, Grant TH, Robins-Browne
RM. Pathogenicity of Yersinia enterocolitica biotype 1A. FEMS Immunol Med Microbiol. 2003;38:127–37. DOI: 10.1016/
S0928-8244(03)00180-9
9. Corbel MJ, Brewer RA, Hunter D. Characterisation of Yersinia enterocolitica strains
associated with bovine abortion. Vet Rec.
1990;127:526–7.
10. Rahuma N, Ghenghesh KS, Ben Aissa
R, Elamaari A. Carriage by the housefly
(Musca domestica) of multiple-antibiotic-resistant bacteria that are potentially
pathogenic to humans, in hospital and other urban environments in Misurata, Libya.
Ann Trop Med Parasitol. 2005;99:795–
802. DOI: 10.1179/136485905X65134
Address for correspondence: Kristin Mühldorfer,
Leibniz Institute for Zoo and Wildlife Research,
Research Group Wildlife Diseases, AlfredKowalke-Str. 17, D-10315 Berlin, Germany;
email: [email protected]
Letters
Letters commenting on recent
articles as well as letters reporting
cases, outbreaks, or original research are welcome. Letters commenting on articles should contain
no more than 300 words and 5
references; they are more likely to
be published if submitted within 4
weeks of the original article’s publication. Letters reporting cases,
outbreaks, or original research
should contain no more than 800
words and 10 references. They
may have 1 Figure or Table and
should not be divided into sections. All letters should contain
material not previously published
and include a word count.
Human
Herpesvirus 8,
Southern Siberia
To the Editor: Human herpesvirus 8 (HHV-8) is the etiologic agent
of Kaposi sarcoma. Sequence analysis of the highly variable open reading frame (ORF)–K1 of HHV-8 has
enabled the identification of 5 main
molecular subtypes, A–E (1). A and
C subtypes are prevalent in persons
in Europe, Mediterranean countries,
northwestern China, and the United
States; subtype B, in persons in subSaharan Africa; subtype D, in persons
in the Pacific Islands and Japan (2–6);
and subtype E, in Native Americans in
the United States.
Considering that K1 gene polymorphisms of HHV-8–infected persons
reflect the divergence accumulated during the early migrations of modern humans out of Africa (1), it is tempting to
put the polymorphisms observed in the
different subtypes into an evolutionary perspective with their geographic
distribution. It is thought that Native
Americans infected by subtype E and
Pacific Islanders, including those infected by subtype D in the Japanese archipelago, originated from a common
ancestral genetic stock in continental
Asia. Because Siberia constitutes the
geographic link between mainland
Asia, North America, and the Pacific
(online Technical Appendix, www.cdc.
gov/eid/content/16/3/585-Techapp.
pdf), it is likely that the Siberian region has served as a source or a corridor of human dispersals to these regions. Thus, we conducted a molecular
epidemiology HHV-8 survey of the
Buryat population, a major indigenous
group in southern Siberia, to gain new
insights into the origins, possibly common, of HHV-8 subtypes D and E.
After consent of local authorities
and participants, we collected 745 human blood samples in 1995 in 17 medicosocial structures (homes for elderly
persons, veterans of the Russian army,
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
LETTERS
hospitalized persons, blood donors)
located near Lake Baïkal and originating from Ulan Ude (344), Ust Orda
(216), and Chita (185), Siberia, Russia
(additional data can be obtained directly from the authors). The median
age of those included was 52 years
(range 25–98 years); 489 (66%) were
women. Antibodies against HHV-8 latency–associated nuclear antigen were
identified by immunofluorescent antibody assay by using the BC3 cell line
(3). Punctuate nuclear staining of BC3
cells at a 1:160 dilution was observed
for 187 (25.1%) patients with no difference according to investigated regions
(p = 0.32 by χ2 test) or between men
(25.8%) and women (24.7%) (p = 0.76
by χ2 test; online Technical Appendix).
However, HHV-8 seroprevalence increased with patient age, rising from
12.9% (25–43 years) to 46.4% (>61
years) (p = 1.8 × 10–13 by χ2 test for
trend) (Figure; online Technical Appendix). No significant difference was
observed in antibody titers according
to age (p = 0.45 by Fisher exact test).
These results demonstrate that HHV-8
infection is highly prevalent in the Siberian adult population tested.
HHV-8 infection was determined
by nested PCR that amplified a 737-bp
fragment of the ORFK1 in peripheral
blood buffy coats of 85 HHV-8–seropositive and 10 HHV-8–seronegative
persons (3). Amplification was positive in 19/85 (22.4%) samples; sequences were obtained for 18 of these
samples (online Technical Appendix).
These sequences showed 0%–7.31%
nucleotide divergence and 0%–3.55%
amino acid divergence. Nevertheless,
17 strains were found to be closely
related with <1.75% nucleotide differences for 684 nt, and only 1 sequence
(1445 strain) displayed higher nucleotide divergence.
A comparative sequence analysis, including 66 representatives of
K1 gene sequences of the HHV-8 A/C
60
Men
Women
HHV-8 seroprevalence rate, %
50
40
30
20
10
0
30–44
45–50
51–60
61–98
Age group, y
Figure. Age-dependent human herpesvirus 8 (HHV-8) seroprevalence rates for 745 persons
in southern Siberia 25–98 years of age who lived in the Ust Orda, Ulan Ude, or Chita districts
during 1995. Seropositivity was based on strict criteria; only samples showing punctuate
nuclear staining clearly reactive at a dilution >1:160 were considered HHV-8 positive. All
187 HHV-8–seropositive samples were tested for antibodies directed against HIV-1/2 by
using Genscreen HIV-1/2 Antibody Assay (Bio-Rad Laboratories, Marnes-la-Coquette,
France); only 2 were seropositive. Error bars indicate 95% confidence intervals.
subtypes/subgroups, and sequences
obtained from persons originating
from Russia, was performed (7–9).
Seventeen of the 18 HHV-8 strains
from Siberia belonged to the A subtype; 15 clustered in a newly identified
specific subclade (online Technical
Appendix). Notably, the 1445-Siberian strain, which exhibits the typical 5
aa deletion at positions 201–205, belongs to subtype C and clustered with
the 7848 strain previously described
by Lacoste et al. (9). Furthermore,
both strains originate from Chita.
Our results indicate that HHV-8
infection is highly prevalent in the
population tested in southern Siberia and extend current knowledge on
the worldwide distribution of HHV-8
genotypes. The presence of a Siberian
strain monophyletic subclade suggests
the existence of HHV-8 strains preferentially spreading among this population in southern Siberia.
To ascertain the maternal ancestry of these persons, we sequenced the
hypervariable region I (HVS-I) of the
maternally-inherited
mitochondrial
DNA (mtDNA) and assigned haplogroups on the basis of the HVS-I motifs. Our analyses showed that 17/18
persons analyzed showed a mtDNA
motif of clear continental east Asian
origin (e.g., A, D correspond to different mtDNA haplogroups). One person
(1474-strain) had a lineage (i.e., HV1)
that is thought to have a western Eurasian origin. Overall, these mtDNA
analyses indicate that the maternal
ancestry of the persons examined here
can be unambiguously attributed to
East Asia, and not to Western Eurasia. K1 subtype A sequences recently
found in the Xinjiang Uygur region in
China (10) do not correspond to the
specific Siberian clade described in
our study. Thus, we must now consider that the widely distributed HHV-8
A/C subtype, so far mainly observed
in Europe and Mediterranean countries, is also largely predominant in
continental Asia.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
581
LETTERS
ANOTHER DIMENSION
Olivier Cassar, Sylviane Bassot,
Sabine Plancoulaine, Lluis Quintana-Murci,
Christine Harmant, Vladimir Gurtsevitch,
Natalia B. Senyuta, Larissa S. Yakovleva,
Guy de Thé, and Antoine Gessain
Author affiliations: Institut Pasteur, Paris, France (O. Cassar, S. Bassot, S. Plancoulaine, L. Quintana-Murci, G. de Thé,
C. Harmant, A. Gessain); Institut National de la Santé et de la Recherche Médicale (INSERM), Paris (S. Plancoulaine); Centre National de la Recherche Scientifique (CNRS), Paris (L. QuintanaMurci); and Blokhin Cancer Research Center, Moscow, Russia (V.
Gurtsevitch, N.B. Senyuta, L.S. Yakovleva)
DOI: 10.3201/eid1603.091390
References
1.
Hayward GS, Zong JC. Modern evolutionary history of the human
KSHV genome. Curr Top Microbiol Immunol. 2007;312:1–42. DOI:
10.1007/978-3-540-34344-8_1
2. Duprez R, Cassar O, Hbid O, Rougier Y, Morisse L, Bassot S, et al.
Cutaneous disseminated endemic Kaposi’s sarcoma in a Polynesian
man infected with a new divergent human herpesvirus 8 subtype D.
J Clin Virol. 2006;37:222–6. DOI: 10.1016/j.jcv.2006.07.013
3. Cassar O, Afonso PV, Bassot S, Plancoulaine S, Duprez R, Capuano
C, et al. Novel human herpesvirus 8 subtype D strains in Vanuatu,
Melanesia. Emerg Infect Dis. 2007;13:1745–8.
4. Zong JC, Ciufo DM, Alcendor DJ, Wan X, Nicholas J, Browning
PJ, et al. High-level variability in the ORF-K1 membrane protein
gene at the left end of the Kaposi’s sarcoma–associated herpesvirus
genome defines four major virus subtypes and multiple variants or
clades in different human populations. J Virol. 1999;73:4156–70.
5. Meng YX, Spira TJ, Bhat GJ, Birch CJ, Druce JD, Edlin BR, et al.
Individuals from North America, Australasia, and Africa are infected with four different genotypes of human herpesvirus 8. Virology.
1999;261:106–19. DOI: 10.1006/viro.1999.9853
6. Cook PM, Whitby D, Calabro ML, Luppi M, Kakoola DN, Hjalgrim
H, et al. Variability and evolution of Kaposi’s sarcoma–associated
herpesvirus in Europe and Africa. International Collaborative Group.
AIDS. 1999;13:1165–76. DOI: 10.1097/00002030-199907090-00004
7. Davidovici B, Karakis I, Bourboulia D, Ariad S, Zong J, Benharroch
D. et al. Seroepidemiology and molecular epidemiology of Kaposi’s
sarcoma–associated herpesvirus among Jewish population groups
in Israel. J Natl Cancer Inst. 2001;93:194–202. DOI: 10.1093/
jnci/93.3.194
8. Kadyrova E, Lacoste V, Duprez R, Pozharissky K, Molochkov V,
Huerre M, et al. Molecular epidemiology of Kaposi’s sarcoma–
associated herpesvirus/human herpesvirus 8 strains from Russian
patients with classic, posttransplant, and AIDS-associated Kaposi’s
sarcoma. J Med Virol. 2003;71:548–56. DOI: 10.1002/jmv.10530
9. Lacoste V, Kadyrova E, Chistiakova I, Gurtsevitch V, Judde JG, Gessain A. Molecular characterization of Kaposi’s sarcoma–associated
herpesvirus/human herpesvirus-8 strains from Russia. J Gen Virol.
2000;81:1217–22.
10. Fu B, Sun F, Li B, Yang L, Zeng Y, Sun X, et al. Seroprevalence of
Kaposi’s sarcoma–associated herpesvirus and risk factors in Xinjiang,
China. J Med Virol. 2009;81:1422–31. DOI: 10.1002/jmv.21550
Address for correspondence: Antoine Gessain, Unité d’Epidémiologie et
Physiopathologie des Virus Oncogènes – Unité de Recherche Appliquée,
3015, Département de Virologie, Bâtiment Lwoff, Institut Pasteur, 28 rue
du Dr. Roux, 75724 Paris CEDEX 15, France; email: [email protected]
fr
582
Sus-Pense
R.L. Bernstein
Don’t call it swine flu:
if you dine on pork, you
can’t catch the flu, as we know.
But the pork people say
some customers may
be confused by the name and just go.
Now look at the news:
around the world views
show people with a mask on their face.
Despite the name change,
folks who find H1N1 strange
still want to keep swine in their place.
For me it is clear:
I don’t have the fear
of swallowing bacon-wrapped figs.
While others may hurry
to wear masks, I don’t worry.
I really don’t plan to kiss pigs.
Dr. Bernstein is associated with the molecular
biology program at New Mexico State University. He
carries out research and consults in bioinformatics, biotechnology, and regulatory microbiology.
Author affiliation: New Mexico State University, Las Cruces, New Mexico, USA
Address for correspondence: R.L. Bernstein, New Mexico State
University, Molecular Biology Chemistry/Biochem, 1175 N
Horseshoe Drive, Las Cruces, NM 88003-8001, USA; email:
[email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
ABOUT THE COVER
William Blake (1757–1827) The Ghost of a Flea (1819–20) Tempera mixture panel with gold on mahogany (21.4 cm × 16.2 cm) Tate,
London, England
…a flea
Has smaller fleas that on him prey;
And these have smaller still to bite ’em,
And so proceed ad infinitum
—Jonathan Swift, On Poetry: a Rhapsody (1733)
Polyxeni Potter
“T
here was no doubt that this poor man was mad, but
there is something in the madness of this man which
interests me more than the sanity of Lord Byron and Walter Scott,” remarked William Wordsworth about his fellow
poet William Blake. Blake’s own claims to outlandish visions added fuel to rumors of his insanity. As a mere child,
he saw God “put his head through the window” and on
another occasion, “a tree filled with angels, bright angelic
wings bespangling every bough like stars.” Later in life,
when faced with the death of a younger sibling, he saw this
brother’s spirit “clapping its hands for joy.”
Blake was a Londoner, born in a spacious old home
at 28 Broad Street, Golden Square, the son of a hosier. He
never went to school and throughout his life was glad to
have escaped formal education, “Improvement makes strait
roads; but the crooked roads without Improvement are
roads of genius.” His family indulged his talents. “As soon
as the child’s hand could hold a pencil it began to scrawl
rough likenesses of man or beast and make timid copies
of all the prints he came near.” At age 10 he was sent to
a fashionable preparatory school for young artists, and at
14, he was apprenticed to Basire, engraver to the Society
of Antiquaries, who sent him to draw old monuments, especially at Westminster Abbey. His love of Gothic art dates
from this time.
He delighted in the linear nature of monuments for he
believed “firm and determinate lineaments unbroken by
Author affiliation: Centers for Disease Control and Prevention, Atlanta, Georgia, USA
DOI: 10.3201/eid1603.000000
shadows” to be the essence of art. He abhorred chiaroscuro,
the art of Venice and Flanders, because its interplay of light
and shadow blurred outlines. Linear style was also characteristic of religious art. The spirits he drew, Blake insisted,
should be “organized” within determinate and bounding
form. Admiration of Greek antiquities and mythology also
nurtured his style and subject matter.
For a man who never strayed far from his home town,
he became very cultured in the visual arts. In his prime a
distinguished printer, painter, poet, and musician, as well
as prophet and iconoclast, Blake took education in his own
hands. He learned Greek, Latin, and Hebrew to appreciate
the classics in the original and invented his own engraving
and color preservation techniques. He combined his facility with the word and brush in “illuminated printing,” a
technique rooted in the Middle Ages, to bring poetry to the
reader through the eye of the poet’s own imagination. Eccentric and nonconformist, he associated with radical thinkers, among them Thomas Paine and Mary Wollstonecraft.
Blake’s work was on a small scale and often contained
in the pages of books. But his imaginings were boundless.
“He who does not imagine in stronger and better lineaments
and in stronger and better light than his perishing and mortal eye can see does not imagine at all.” To him the great art
of the world depicted not that seen by the “mortal eye” but
a more perfect imagined form. His idiosyncratic approach
to life and the individuality of his craft defy labels. While
his work places him solidly among the Romantics, some
have labeled him a forerunner of modern anarchism.
Many spirits or ghosts Blake drew seemed to derive
from his Gothic studies; others were of kings or queens.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
583
ABOUT THE COVER
The ghost of a flea, on this month’s cover, seems that of a
demon. This miniature was part of a series of “visionary
heads,” commissioned by his friend John Varley, landscape
painter and astrologer, who believed in spirits but was unable to see them. He was drawn to Blake, who professed
to live with them. The two would meet and try to summon
spirits of historical or mythologic figures and if they appeared, Blake would draw them. They were angels, Voltaire, Moses, and the flea, which told them that “Fleas were
inhabited by the souls of such men as were by nature blood
thirsty to excess.”
“I called on him one evening and found Blake more
than usually excited,” Varley reported, “He had seen a
wonderful thing―the ghost of a flea!” “And did you make
a drawing of him?” Varley asked. “I wish I had,” Blake
responded, “but I shall, if he appears again! ...There he
comes! His eager tongue whisking out of this mouth….”
Varley gave him paper and a pencil to draw the portrait. “I
felt convinced by his mode of proceedings that he had a real
image before him, for he left off, and began on another part
of the paper, to make a separate drawing of the mouth of the
flea, which the spirit having opened, he was prevented from
proceeding with the first sketch, till he had closed it.”
Varley described the conception as a “naked figure with
a strong body and a short neck―with burning eyes which
long for moisture, and a face worthy of a murderer holding
a bloody cup in its clawed hands, out of which it seems
eager to drink…. I never saw any shape so strange, nor did
I ever see any colouring so curiously splendid―a kind of
glistening green and dusky gold, beautifully varnished.”
Both in his poetry and his art, Blake often personified
death, war, famine, and other abstractions, ascribing them
faces and human characteristics. The ghost of his flea is
muscular, part human part reptile, loaded with symbolic
clues of its nature and character. The creature strides theatrically across a stage framed by opulent drapes and sprinkled with stars―Blake’s friend and supporter John Linnell
made a copy of this drawing for Zodiacal Physiognomy, as
a sign of Gemini.
The left hand holds an acorn, the right a thorn. The
massive frame scarred by a protruding spine supports a
small head, vaguely alluding to the shape of a flea. On the
floor near the feet, an insect, the physical embodiment,
completes the portrait. Despite claims to a visionary source,
this flea recalls the imps of Henry Fuseli (1741–1825), another painter of monsters, and some of Blake’s previous
work. It could also have been informed by the drawings
of early microscopist Robert Hooke (1635–1703), whose
illustration of a flea in his book Micrographia described it
as “adorn’d with a curiously polish’d suite of sable Armour,
neatly jointed ….”
584
“It’s God. / I’d know him from Blake’s picture anywhere,” Robert Frost’s Eve said in “Masque of Reason.”
Whether he was drawing the Almighty or a tiny insect,
Blake captured and uncloaked the unadulterated character
of the subject. And whatever the source of his inspiration, it
lit and portrayed this character in all its purity.
Not fooled by the tiny creature he tossed on the scene
as a reference, Blake knew and spelled out its horrific nature. And he was not alone. The flea was notorious for its
pestiferous qualities. They did not escape the attention of
Jonathan Swift: “The vermin only tease and pinch / Their
foes superior by an inch.” John Donne (1572–1631) had
exploited the flea’s blood-drinking habits in his immortal
plea to a mistress, acknowledging the importance of fluid
exchange, before the possibility of contagion even entered
the equation, “Me it suck’d first, and now sucks thee, / And
in this flea our two bloods mingled bee.”
The perpetual struggle against these pests inspires poetry to this day: “Fleas / Adam / had’em.” The incongruous
imbalance between their size and their impact on humanity, shown in no less than their deadly connection with the
history of Black Death, is now fully understood. Fleas are
known for the vectors of disease they are, spreading in addition to bubonic plague, murine or fleaborne typhus and
other rickettsioses in new areas, and still tormenting and
killing humans, despite improved diagnostic techniques
and treatments. Swift would see no humor in the ad infinitum emergence of novel spotted fever strains causing
disease in yet more areas. He could not have known that
microorganisms, such as rickettsia, infect fleas and through
them spread to other animals, in fact becoming what he had
lightly referred to as the fleas of fleas.
Bibliography
1. Adjemian J, Parks S, McElroy K, Campbell J, Eremeeva ME, Nicholson WL, et al. Murine typhus in Austin, Texas, USA, 2008. Emerg
Infect Dis. 2010;16:412–7.
2. Bentley GE, Bentley G Jr. William Blake: the critical heritage. London: Routledge; 1995.
3. Gilchrist A. The life of William Blake. London: McMillan; 1863.
4. Raine K. William Blake. New York: Thames and Hudson Inc.;
1988.
5. Kelly PJ, Lucas H, Eremeeva ME, Dirks KG, Rolain JM, Yowell C, et
al. Rickettsia felis, West Indies. Emerg Infect Dis. 2010;16:570–1.
6. Myrone M. The Blake book. London: Tate Gallery; 2007.
7. Spencer T. The iconography of Crabtree. The Crabtree orations
1954–1994. London: Crabtree Foundation; 1997.
8. Spolidorio MG, Labruna MB, Mantovani E, Brandão PE, Richtzenhain LJ, Yoshinari NH. Novel spotted fever rickettsiosis, Brazil.
Emerg Infect Dis. 2010;16:521–3.
Address for correspondence: Polyxeni Potter, EID Journal, Centers for
Disease Control and Prevention, 1600 Clifton Rd NE, Mailstop D61,
Atlanta, GA 30333, USA; email: [email protected]
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 16, No. 3, March 2010
NEWS & NOTES
Upcoming Infectious
Disease Activities
Upcoming Issue
March 18–22, 2010
Fifth Decennial: International
Conference on Healthcare-Associated
Infections 2010
Hyatt Regency Atlanta
Atlanta, GA, USA
http://www.decennial2010.com
Reassortment of G11 Rotavirus Strains in Humans
Livestock-associated Methicillin-Resistant Staphylococcus
aureus Sequence Type 398 in Humans, Canada
Community-associated Methicillin-Resistant Staphylococcus
aureus Strains in Pediatric Intensive Care Unit
Household Transmission of Pandemic (H1N1) 2009,
San Antonio, Texas, USA
Influenza-associated Acute Respiratory Distress Syndrome
Contribution of Streptococcus anginosus to Group C and G
Streptococcal Infections, South India
March 24–26, 2010
16th ISHEID (International
Symposium on HIV & Emerging
Infectious Diseases)
Marseille, France
http://www.isheid.com
May 20–22, 2010
VIII International Conference on
HFRS, HPS and Hantaviruses
Athens, Greece
http://www.hantavirusconference
2010.gr
Escherichia albertii in Wild and Domestic Birds
Clostridium difficile Infection among Hospitalized Children,
United States, 1997–2006
Enterohemorrhagic Escherichia coli O157, Germany,
1987–2008
Genotype Profiles to Differentiate Sources of Foodborne
Outbreaks
Alfred Russel Wallace and the Anti-Vaccination Movement
in Victorian England
Pigs as Reservoir for Gentamicin-Resistant Enterococcus
faecalis
Clostridium difficile, Germany
July 11–14, 2010
International Conference on
Emerging Infectious Diseases 2010
Hyatt Regency Atlanta
Atlanta, GA, USA
http://www.iceid.org
November 11–13, 2010
European Scientific Conference
on Applied Infectious Disease
Epidemiology (ESCAIDE)
Lisbon, Portugal
http://www.escaide.eu
Announcements
Novel Corynebacterium diphtheriae Isolate from Domestic
Cats
To submit an announcement, send an email message
to EIDEditor ([email protected]). In 50–150 words,
describe timely events of interest to our readers. Include the date of the event, the location, the sponsoring
organization(s), and a website that readers may visit or
a telephone number or email address that readers may
contact for more information.
Re-emergence of Dengue Fever in Mauritius
Announcements may be posted on the journal Web
page only, depending on the event date.
Merkel Cell Polyomavirus in Cutaneous Swabs
Limited Susceptibility of Chickens, Turkeys, and Mice to
Pandemic (H1N1) 2009 Virus
Pandemic (H1N1) 2009 in Breeding Turkeys, Valparaiso,
Chile
Sympatric Occurrence of 3 Arenaviruses, Morogoro,
Tanzania
Complete list of articles in the April issue at
http://www.cdc.gov/eid/upcoming.htm
Emerging Infect